Id |
Subject |
Object |
Predicate |
Lexical cue |
T2464 |
13-24 |
JJ |
denotes |
Nephrogenic |
T2466 |
25-33 |
NN |
denotes |
diabetes |
T2465 |
34-43 |
NN |
denotes |
insipidus |
T2468 |
44-45 |
-LRB- |
denotes |
( |
T2469 |
45-48 |
NN |
denotes |
NDI |
T2470 |
48-49 |
-RRB- |
denotes |
) |
T2467 |
50-52 |
VBZ |
denotes |
is |
T2471 |
53-54 |
DT |
denotes |
a |
T2472 |
55-62 |
NN |
denotes |
disease |
T2473 |
63-76 |
VBN |
denotes |
characterized |
T2474 |
77-79 |
IN |
denotes |
by |
T2475 |
80-89 |
JJ |
denotes |
excessive |
T2476 |
90-99 |
NN |
denotes |
urination |
T2477 |
100-103 |
CC |
denotes |
and |
T2478 |
104-110 |
RB |
denotes |
thirst |
T2479 |
110-112 |
, |
denotes |
, |
T2480 |
112-119 |
IN |
denotes |
despite |
T2481 |
120-126 |
JJ |
denotes |
normal |
T2482 |
127-137 |
NN |
denotes |
production |
T2483 |
138-140 |
IN |
denotes |
of |
T2484 |
141-144 |
DT |
denotes |
the |
T2486 |
145-157 |
JJ |
denotes |
antidiuretic |
T2485 |
158-165 |
NN |
denotes |
hormone |
T2487 |
166-174 |
NN |
denotes |
arginine |
T2488 |
175-186 |
NN |
denotes |
vasopressin |
T2489 |
187-188 |
-LRB- |
denotes |
( |
T2490 |
188-191 |
NN |
denotes |
AVP |
T2491 |
191-192 |
-RRB- |
denotes |
) |
T2492 |
193-194 |
-LRB- |
denotes |
[ |
T2493 |
194-195 |
CD |
denotes |
1 |
T2494 |
195-196 |
-RRB- |
denotes |
] |
T2495 |
196-197 |
. |
denotes |
. |
T2496 |
197-340 |
sentence |
denotes |
The inherited forms are either X-linked as a consequence of mutation of the Avpr2 gene [2], or autosomal due to mutation of the Aqp2 gene [3]. |
T2497 |
198-201 |
DT |
denotes |
The |
T2499 |
202-211 |
VBN |
denotes |
inherited |
T2498 |
212-217 |
NNS |
denotes |
forms |
T2500 |
218-221 |
VBP |
denotes |
are |
T2501 |
222-228 |
RB |
denotes |
either |
T2503 |
229-230 |
NN |
denotes |
X |
T2504 |
230-231 |
HYPH |
denotes |
- |
T2502 |
231-237 |
VBN |
denotes |
linked |
T2505 |
238-240 |
IN |
denotes |
as |
T2506 |
241-242 |
DT |
denotes |
a |
T2507 |
243-254 |
NN |
denotes |
consequence |
T2508 |
255-257 |
IN |
denotes |
of |
T2509 |
258-266 |
NN |
denotes |
mutation |
T2510 |
267-269 |
IN |
denotes |
of |
T2511 |
270-273 |
DT |
denotes |
the |
T2513 |
274-279 |
NN |
denotes |
Avpr2 |
T2512 |
280-284 |
NN |
denotes |
gene |
T2514 |
285-286 |
-LRB- |
denotes |
[ |
T2515 |
286-287 |
CD |
denotes |
2 |
T2516 |
287-288 |
-RRB- |
denotes |
] |
T2517 |
288-290 |
, |
denotes |
, |
T2518 |
290-292 |
CC |
denotes |
or |
T2519 |
293-302 |
JJ |
denotes |
autosomal |
T2520 |
303-306 |
JJ |
denotes |
due |
T2521 |
307-309 |
IN |
denotes |
to |
T2522 |
310-318 |
NN |
denotes |
mutation |
T2523 |
319-321 |
IN |
denotes |
of |
T2524 |
322-325 |
DT |
denotes |
the |
T2526 |
326-330 |
NN |
denotes |
Aqp2 |
T2525 |
331-335 |
NN |
denotes |
gene |
T2527 |
336-337 |
-LRB- |
denotes |
[ |
T2528 |
337-338 |
CD |
denotes |
3 |
T2529 |
338-339 |
-RRB- |
denotes |
] |
T2530 |
339-340 |
. |
denotes |
. |
T2531 |
340-504 |
sentence |
denotes |
Aquaporin-2 (AQP2) is a pore-forming protein belonging to a family of water channels [4], and it is expressed in collecting-duct principal cells in the kidney [5]. |
T2532 |
341-350 |
NN |
denotes |
Aquaporin |
T2534 |
350-351 |
HYPH |
denotes |
- |
T2535 |
351-352 |
CD |
denotes |
2 |
T2536 |
353-354 |
-LRB- |
denotes |
( |
T2537 |
354-358 |
NN |
denotes |
AQP2 |
T2538 |
358-359 |
-RRB- |
denotes |
) |
T2533 |
360-362 |
VBZ |
denotes |
is |
T2539 |
363-364 |
DT |
denotes |
a |
T2541 |
365-369 |
NN |
denotes |
pore |
T2543 |
369-370 |
HYPH |
denotes |
- |
T2542 |
370-377 |
VBG |
denotes |
forming |
T2540 |
378-385 |
NN |
denotes |
protein |
T2544 |
386-395 |
VBG |
denotes |
belonging |
T2545 |
396-398 |
IN |
denotes |
to |
T2546 |
399-400 |
DT |
denotes |
a |
T2547 |
401-407 |
NN |
denotes |
family |
T2548 |
408-410 |
IN |
denotes |
of |
T2549 |
411-416 |
NN |
denotes |
water |
T2550 |
417-425 |
NNS |
denotes |
channels |
T2551 |
426-427 |
-LRB- |
denotes |
[ |
T2552 |
427-428 |
CD |
denotes |
4 |
T2553 |
428-429 |
-RRB- |
denotes |
] |
T2554 |
429-431 |
, |
denotes |
, |
T2555 |
431-434 |
CC |
denotes |
and |
T2556 |
435-437 |
PRP |
denotes |
it |
T2558 |
438-440 |
VBZ |
denotes |
is |
T2557 |
441-450 |
VBN |
denotes |
expressed |
T2559 |
451-453 |
IN |
denotes |
in |
T2560 |
454-464 |
VBG |
denotes |
collecting |
T2562 |
464-465 |
HYPH |
denotes |
- |
T2561 |
465-469 |
NN |
denotes |
duct |
T2564 |
470-479 |
JJ |
denotes |
principal |
T2563 |
480-485 |
NNS |
denotes |
cells |
T2565 |
486-488 |
IN |
denotes |
in |
T2566 |
489-492 |
DT |
denotes |
the |
T2567 |
493-499 |
NN |
denotes |
kidney |
T2568 |
500-501 |
-LRB- |
denotes |
[ |
T2569 |
501-502 |
CD |
denotes |
5 |
T2570 |
502-503 |
-RRB- |
denotes |
] |
T2571 |
503-504 |
. |
denotes |
. |
T2572 |
504-713 |
sentence |
denotes |
Generally these proteins permit the passage of water through the plasma membrane (PM) of cells, several of which carry out this role specifically in the process of water reabsorption from urine in the kidney. |
T2573 |
505-514 |
RB |
denotes |
Generally |
T2575 |
515-520 |
DT |
denotes |
these |
T2576 |
521-529 |
NN |
denotes |
proteins |
T2574 |
530-536 |
VBP |
denotes |
permit |
T2577 |
537-540 |
DT |
denotes |
the |
T2578 |
541-548 |
NN |
denotes |
passage |
T2579 |
549-551 |
IN |
denotes |
of |
T2580 |
552-557 |
NN |
denotes |
water |
T2581 |
558-565 |
IN |
denotes |
through |
T2582 |
566-569 |
DT |
denotes |
the |
T2584 |
570-576 |
NN |
denotes |
plasma |
T2583 |
577-585 |
NN |
denotes |
membrane |
T2585 |
586-587 |
-LRB- |
denotes |
( |
T2586 |
587-589 |
NN |
denotes |
PM |
T2587 |
589-590 |
-RRB- |
denotes |
) |
T2588 |
591-593 |
IN |
denotes |
of |
T2589 |
594-599 |
NNS |
denotes |
cells |
T2590 |
599-601 |
, |
denotes |
, |
T2591 |
601-608 |
JJ |
denotes |
several |
T2593 |
609-611 |
IN |
denotes |
of |
T2594 |
612-617 |
WDT |
denotes |
which |
T2592 |
618-623 |
VBP |
denotes |
carry |
T2595 |
624-627 |
RP |
denotes |
out |
T2596 |
628-632 |
DT |
denotes |
this |
T2597 |
633-637 |
NN |
denotes |
role |
T2598 |
638-650 |
RB |
denotes |
specifically |
T2599 |
651-653 |
IN |
denotes |
in |
T2600 |
654-657 |
DT |
denotes |
the |
T2601 |
658-665 |
NN |
denotes |
process |
T2602 |
666-668 |
IN |
denotes |
of |
T2603 |
669-674 |
NN |
denotes |
water |
T2604 |
675-687 |
NN |
denotes |
reabsorption |
T2605 |
688-692 |
IN |
denotes |
from |
T2606 |
693-698 |
NN |
denotes |
urine |
T2607 |
699-701 |
IN |
denotes |
in |
T2608 |
702-705 |
DT |
denotes |
the |
T2609 |
706-712 |
NN |
denotes |
kidney |
T2610 |
712-713 |
. |
denotes |
. |
T2611 |
713-855 |
sentence |
denotes |
It has been established that aquaporins, although functional as a monomer, tetramerize before their insertion into the plasma membrane [4,6]. |
T2612 |
714-716 |
PRP |
denotes |
It |
T2614 |
717-720 |
VBZ |
denotes |
has |
T2615 |
721-725 |
VBN |
denotes |
been |
T2613 |
726-737 |
VBN |
denotes |
established |
T2616 |
738-742 |
IN |
denotes |
that |
T2618 |
743-753 |
NNS |
denotes |
aquaporins |
T2619 |
753-755 |
, |
denotes |
, |
T2620 |
755-763 |
IN |
denotes |
although |
T2621 |
764-774 |
JJ |
denotes |
functional |
T2622 |
775-777 |
IN |
denotes |
as |
T2623 |
778-779 |
DT |
denotes |
a |
T2624 |
780-787 |
NN |
denotes |
monomer |
T2625 |
787-789 |
, |
denotes |
, |
T2617 |
789-800 |
VBP |
denotes |
tetramerize |
T2626 |
801-807 |
IN |
denotes |
before |
T2627 |
808-813 |
PRP$ |
denotes |
their |
T2628 |
814-823 |
NN |
denotes |
insertion |
T2629 |
824-828 |
IN |
denotes |
into |
T2630 |
829-832 |
DT |
denotes |
the |
T2632 |
833-839 |
NN |
denotes |
plasma |
T2631 |
840-848 |
NN |
denotes |
membrane |
T2633 |
849-850 |
-LRB- |
denotes |
[ |
T2635 |
850-851 |
CD |
denotes |
4 |
T2636 |
851-852 |
, |
denotes |
, |
T2634 |
852-853 |
CD |
denotes |
6 |
T2637 |
853-854 |
-RRB- |
denotes |
] |
T2638 |
854-855 |
. |
denotes |
. |
T2639 |
855-1119 |
sentence |
denotes |
Furthermore these proteins can also be differentially targeted to distinct regions of the PM; for example, AQP2 is routed to the apical membrane of cells surrounding the collecting duct, whereas other aquaporins (AQP3 or 4) are inserted into the basolateral face. |
T2640 |
856-867 |
RB |
denotes |
Furthermore |
T2642 |
868-873 |
DT |
denotes |
these |
T2643 |
874-882 |
NN |
denotes |
proteins |
T2644 |
883-886 |
MD |
denotes |
can |
T2645 |
887-891 |
RB |
denotes |
also |
T2646 |
892-894 |
VB |
denotes |
be |
T2647 |
895-909 |
RB |
denotes |
differentially |
T2641 |
910-918 |
VBN |
denotes |
targeted |
T2649 |
919-921 |
IN |
denotes |
to |
T2650 |
922-930 |
JJ |
denotes |
distinct |
T2651 |
931-938 |
NNS |
denotes |
regions |
T2652 |
939-941 |
IN |
denotes |
of |
T2653 |
942-945 |
DT |
denotes |
the |
T2654 |
946-948 |
NN |
denotes |
PM |
T2655 |
948-949 |
: |
denotes |
; |
T2656 |
950-953 |
IN |
denotes |
for |
T2657 |
954-961 |
NN |
denotes |
example |
T2658 |
961-963 |
, |
denotes |
, |
T2659 |
963-967 |
NN |
denotes |
AQP2 |
T2660 |
968-970 |
VBZ |
denotes |
is |
T2648 |
971-977 |
VBN |
denotes |
routed |
T2661 |
978-980 |
IN |
denotes |
to |
T2662 |
981-984 |
DT |
denotes |
the |
T2664 |
985-991 |
JJ |
denotes |
apical |
T2663 |
992-1000 |
NN |
denotes |
membrane |
T2665 |
1001-1003 |
IN |
denotes |
of |
T2666 |
1004-1009 |
NNS |
denotes |
cells |
T2667 |
1010-1021 |
VBG |
denotes |
surrounding |
T2668 |
1022-1025 |
DT |
denotes |
the |
T2670 |
1026-1036 |
VBG |
denotes |
collecting |
T2669 |
1037-1041 |
NN |
denotes |
duct |
T2671 |
1041-1043 |
, |
denotes |
, |
T2672 |
1043-1050 |
IN |
denotes |
whereas |
T2674 |
1051-1056 |
JJ |
denotes |
other |
T2675 |
1057-1067 |
NNS |
denotes |
aquaporins |
T2676 |
1068-1069 |
-LRB- |
denotes |
( |
T2677 |
1069-1073 |
NN |
denotes |
AQP3 |
T2678 |
1074-1076 |
CC |
denotes |
or |
T2679 |
1077-1078 |
CD |
denotes |
4 |
T2680 |
1078-1079 |
-RRB- |
denotes |
) |
T2681 |
1080-1083 |
VBP |
denotes |
are |
T2673 |
1084-1092 |
VBN |
denotes |
inserted |
T2682 |
1093-1097 |
IN |
denotes |
into |
T2683 |
1098-1101 |
DT |
denotes |
the |
T2685 |
1102-1113 |
JJ |
denotes |
basolateral |
T2684 |
1114-1118 |
NN |
denotes |
face |
T2686 |
1118-1119 |
. |
denotes |
. |
T2687 |
1119-1214 |
sentence |
denotes |
Unlike all other family members, AQP2 is not constitutively inserted into the plasma membrane. |
T2688 |
1120-1126 |
IN |
denotes |
Unlike |
T2690 |
1127-1130 |
DT |
denotes |
all |
T2692 |
1131-1136 |
JJ |
denotes |
other |
T2693 |
1137-1143 |
NN |
denotes |
family |
T2691 |
1144-1151 |
NNS |
denotes |
members |
T2694 |
1151-1153 |
, |
denotes |
, |
T2695 |
1153-1157 |
NN |
denotes |
AQP2 |
T2696 |
1158-1160 |
VBZ |
denotes |
is |
T2697 |
1161-1164 |
RB |
denotes |
not |
T2698 |
1165-1179 |
RB |
denotes |
constitutively |
T2689 |
1180-1188 |
VBN |
denotes |
inserted |
T2699 |
1189-1193 |
IN |
denotes |
into |
T2700 |
1194-1197 |
DT |
denotes |
the |
T2702 |
1198-1204 |
NN |
denotes |
plasma |
T2701 |
1205-1213 |
NN |
denotes |
membrane |
T2703 |
1213-1214 |
. |
denotes |
. |
T2704 |
1214-1426 |
sentence |
denotes |
Under basal conditions, the protein resides in subapical intracellular vesicles; however, under conditions requiring water retention AQP2 translocates to the apical membrane, permitting water reabsorption [7,8]. |
T2705 |
1215-1220 |
IN |
denotes |
Under |
T2707 |
1221-1226 |
JJ |
denotes |
basal |
T2708 |
1227-1237 |
NNS |
denotes |
conditions |
T2709 |
1237-1239 |
, |
denotes |
, |
T2710 |
1239-1242 |
DT |
denotes |
the |
T2711 |
1243-1250 |
NN |
denotes |
protein |
T2706 |
1251-1258 |
VBZ |
denotes |
resides |
T2713 |
1259-1261 |
IN |
denotes |
in |
T2714 |
1262-1271 |
JJ |
denotes |
subapical |
T2716 |
1272-1285 |
JJ |
denotes |
intracellular |
T2715 |
1286-1294 |
NNS |
denotes |
vesicles |
T2717 |
1294-1295 |
: |
denotes |
; |
T2718 |
1296-1303 |
RB |
denotes |
however |
T2719 |
1303-1305 |
, |
denotes |
, |
T2720 |
1305-1310 |
IN |
denotes |
under |
T2721 |
1311-1321 |
NNS |
denotes |
conditions |
T2722 |
1322-1331 |
VBG |
denotes |
requiring |
T2723 |
1332-1337 |
NN |
denotes |
water |
T2724 |
1338-1347 |
NN |
denotes |
retention |
T2725 |
1348-1352 |
NN |
denotes |
AQP2 |
T2712 |
1353-1365 |
VBZ |
denotes |
translocates |
T2726 |
1366-1368 |
IN |
denotes |
to |
T2727 |
1369-1372 |
DT |
denotes |
the |
T2729 |
1373-1379 |
JJ |
denotes |
apical |
T2728 |
1380-1388 |
NN |
denotes |
membrane |
T2730 |
1388-1390 |
, |
denotes |
, |
T2731 |
1390-1400 |
VBG |
denotes |
permitting |
T2732 |
1401-1406 |
NN |
denotes |
water |
T2733 |
1407-1419 |
NN |
denotes |
reabsorption |
T2734 |
1420-1421 |
-LRB- |
denotes |
[ |
T2736 |
1421-1422 |
CD |
denotes |
7 |
T2737 |
1422-1423 |
, |
denotes |
, |
T2735 |
1423-1424 |
CD |
denotes |
8 |
T2738 |
1424-1425 |
-RRB- |
denotes |
] |
T2739 |
1425-1426 |
. |
denotes |
. |
T2740 |
1426-1725 |
sentence |
denotes |
For this process to occur, AVP binds its receptor, AVPR2, on the basolateral face of the collecting duct cells, leading to a rise in intracellular cAMP, ultimately resulting in phosphorylation of AQP2 at serine 256 by cAMP-dependent protein kinase [9] and its redistribution to the plasma membrane. |
T2741 |
1427-1430 |
IN |
denotes |
For |
T2743 |
1431-1435 |
DT |
denotes |
this |
T2744 |
1436-1443 |
NN |
denotes |
process |
T2745 |
1444-1446 |
TO |
denotes |
to |
T2742 |
1447-1452 |
VB |
denotes |
occur |
T2747 |
1452-1454 |
, |
denotes |
, |
T2748 |
1454-1457 |
NN |
denotes |
AVP |
T2746 |
1458-1463 |
VBZ |
denotes |
binds |
T2749 |
1464-1467 |
PRP$ |
denotes |
its |
T2750 |
1468-1476 |
NN |
denotes |
receptor |
T2751 |
1476-1478 |
, |
denotes |
, |
T2752 |
1478-1483 |
NN |
denotes |
AVPR2 |
T2753 |
1483-1485 |
, |
denotes |
, |
T2754 |
1485-1487 |
IN |
denotes |
on |
T2755 |
1488-1491 |
DT |
denotes |
the |
T2757 |
1492-1503 |
JJ |
denotes |
basolateral |
T2756 |
1504-1508 |
NN |
denotes |
face |
T2758 |
1509-1511 |
IN |
denotes |
of |
T2759 |
1512-1515 |
DT |
denotes |
the |
T2761 |
1516-1526 |
VBG |
denotes |
collecting |
T2762 |
1527-1531 |
NN |
denotes |
duct |
T2760 |
1532-1537 |
NNS |
denotes |
cells |
T2763 |
1537-1539 |
, |
denotes |
, |
T2764 |
1539-1546 |
VBG |
denotes |
leading |
T2765 |
1547-1549 |
IN |
denotes |
to |
T2766 |
1550-1551 |
DT |
denotes |
a |
T2767 |
1552-1556 |
NN |
denotes |
rise |
T2768 |
1557-1559 |
IN |
denotes |
in |
T2769 |
1560-1573 |
JJ |
denotes |
intracellular |
T2770 |
1574-1578 |
NN |
denotes |
cAMP |
T2771 |
1578-1580 |
, |
denotes |
, |
T2772 |
1580-1590 |
RB |
denotes |
ultimately |
T2773 |
1591-1600 |
VBG |
denotes |
resulting |
T2774 |
1601-1603 |
IN |
denotes |
in |
T2775 |
1604-1619 |
NN |
denotes |
phosphorylation |
T2776 |
1620-1622 |
IN |
denotes |
of |
T2777 |
1623-1627 |
NN |
denotes |
AQP2 |
T2778 |
1628-1630 |
IN |
denotes |
at |
T2779 |
1631-1637 |
NN |
denotes |
serine |
T2780 |
1638-1641 |
CD |
denotes |
256 |
T2781 |
1642-1644 |
IN |
denotes |
by |
T2782 |
1645-1649 |
NN |
denotes |
cAMP |
T2784 |
1649-1650 |
HYPH |
denotes |
- |
T2783 |
1650-1659 |
JJ |
denotes |
dependent |
T2786 |
1660-1667 |
NN |
denotes |
protein |
T2785 |
1668-1674 |
NN |
denotes |
kinase |
T2787 |
1675-1676 |
-LRB- |
denotes |
[ |
T2788 |
1676-1677 |
CD |
denotes |
9 |
T2789 |
1677-1678 |
-RRB- |
denotes |
] |
T2790 |
1679-1682 |
CC |
denotes |
and |
T2791 |
1683-1686 |
PRP$ |
denotes |
its |
T2792 |
1687-1701 |
NN |
denotes |
redistribution |
T2793 |
1702-1704 |
IN |
denotes |
to |
T2794 |
1705-1708 |
DT |
denotes |
the |
T2796 |
1709-1715 |
NN |
denotes |
plasma |
T2795 |
1716-1724 |
NN |
denotes |
membrane |
T2797 |
1724-1725 |
. |
denotes |
. |
T2798 |
1725-1875 |
sentence |
denotes |
The importance of AQP2 redistribution has been highlighted by functional characterization of Aqp2 mutations resulting in severe NDI in humans [3,10]. |
T2799 |
1726-1729 |
DT |
denotes |
The |
T2800 |
1730-1740 |
NN |
denotes |
importance |
T2802 |
1741-1743 |
IN |
denotes |
of |
T2803 |
1744-1748 |
NN |
denotes |
AQP2 |
T2804 |
1749-1763 |
NN |
denotes |
redistribution |
T2805 |
1764-1767 |
VBZ |
denotes |
has |
T2806 |
1768-1772 |
VBN |
denotes |
been |
T2801 |
1773-1784 |
VBN |
denotes |
highlighted |
T2807 |
1785-1787 |
IN |
denotes |
by |
T2808 |
1788-1798 |
JJ |
denotes |
functional |
T2809 |
1799-1815 |
NN |
denotes |
characterization |
T2810 |
1816-1818 |
IN |
denotes |
of |
T2811 |
1819-1823 |
NN |
denotes |
Aqp2 |
T2812 |
1824-1833 |
NNS |
denotes |
mutations |
T2813 |
1834-1843 |
VBG |
denotes |
resulting |
T2814 |
1844-1846 |
IN |
denotes |
in |
T2815 |
1847-1853 |
JJ |
denotes |
severe |
T2816 |
1854-1857 |
NN |
denotes |
NDI |
T2817 |
1858-1860 |
IN |
denotes |
in |
T2818 |
1861-1867 |
NNS |
denotes |
humans |
T2819 |
1868-1869 |
-LRB- |
denotes |
[ |
T2821 |
1869-1870 |
CD |
denotes |
3 |
T2822 |
1870-1871 |
, |
denotes |
, |
T2820 |
1871-1873 |
CD |
denotes |
10 |
T2823 |
1873-1874 |
-RRB- |
denotes |
] |
T2824 |
1874-1875 |
. |
denotes |
. |
T2825 |
1875-2058 |
sentence |
denotes |
Recessive Aqp2 mutations are generally thought to produce an abnormally localized and, in most instances, misfolded water pore that responds abnormally to an increase in cAMP [6,11]. |
T2826 |
1876-1885 |
JJ |
denotes |
Recessive |
T2828 |
1886-1890 |
NN |
denotes |
Aqp2 |
T2827 |
1891-1900 |
NNS |
denotes |
mutations |
T2830 |
1901-1904 |
VBP |
denotes |
are |
T2831 |
1905-1914 |
RB |
denotes |
generally |
T2829 |
1915-1922 |
VBN |
denotes |
thought |
T2832 |
1923-1925 |
TO |
denotes |
to |
T2833 |
1926-1933 |
VB |
denotes |
produce |
T2834 |
1934-1936 |
DT |
denotes |
an |
T2836 |
1937-1947 |
RB |
denotes |
abnormally |
T2837 |
1948-1957 |
VBN |
denotes |
localized |
T2838 |
1958-1961 |
CC |
denotes |
and |
T2839 |
1961-1963 |
, |
denotes |
, |
T2841 |
1963-1965 |
IN |
denotes |
in |
T2842 |
1966-1970 |
JJS |
denotes |
most |
T2843 |
1971-1980 |
NNS |
denotes |
instances |
T2844 |
1980-1982 |
, |
denotes |
, |
T2840 |
1982-1991 |
VBN |
denotes |
misfolded |
T2845 |
1992-1997 |
NN |
denotes |
water |
T2835 |
1998-2002 |
NN |
denotes |
pore |
T2846 |
2003-2007 |
WDT |
denotes |
that |
T2847 |
2008-2016 |
VBZ |
denotes |
responds |
T2848 |
2017-2027 |
RB |
denotes |
abnormally |
T2849 |
2028-2030 |
IN |
denotes |
to |
T2850 |
2031-2033 |
DT |
denotes |
an |
T2851 |
2034-2042 |
NN |
denotes |
increase |
T2852 |
2043-2045 |
IN |
denotes |
in |
T2853 |
2046-2050 |
NN |
denotes |
cAMP |
T2854 |
2051-2052 |
-LRB- |
denotes |
[ |
T2856 |
2052-2053 |
CD |
denotes |
6 |
T2857 |
2053-2054 |
, |
denotes |
, |
T2855 |
2054-2056 |
CD |
denotes |
11 |
T2858 |
2056-2057 |
-RRB- |
denotes |
] |
T2859 |
2057-2058 |
. |
denotes |
. |
T2860 |
2058-2210 |
sentence |
denotes |
Furthermore, dominant mutations have been described and found to misroute both the mutant and the wild-type protein to the basolateral membrane [6,12]. |
T2861 |
2059-2070 |
RB |
denotes |
Furthermore |
T2863 |
2070-2072 |
, |
denotes |
, |
T2864 |
2072-2080 |
JJ |
denotes |
dominant |
T2865 |
2081-2090 |
NNS |
denotes |
mutations |
T2866 |
2091-2095 |
VBP |
denotes |
have |
T2867 |
2096-2100 |
VBN |
denotes |
been |
T2862 |
2101-2110 |
VBN |
denotes |
described |
T2868 |
2111-2114 |
CC |
denotes |
and |
T2869 |
2115-2120 |
VBN |
denotes |
found |
T2870 |
2121-2123 |
TO |
denotes |
to |
T2871 |
2124-2132 |
VB |
denotes |
misroute |
T2872 |
2133-2137 |
CC |
denotes |
both |
T2874 |
2138-2141 |
DT |
denotes |
the |
T2873 |
2142-2148 |
NN |
denotes |
mutant |
T2875 |
2149-2152 |
CC |
denotes |
and |
T2876 |
2153-2156 |
DT |
denotes |
the |
T2878 |
2157-2161 |
JJ |
denotes |
wild |
T2879 |
2161-2162 |
HYPH |
denotes |
- |
T2877 |
2162-2166 |
NN |
denotes |
type |
T2880 |
2167-2174 |
NN |
denotes |
protein |
T2881 |
2175-2177 |
IN |
denotes |
to |
T2882 |
2178-2181 |
DT |
denotes |
the |
T2884 |
2182-2193 |
JJ |
denotes |
basolateral |
T2883 |
2194-2202 |
NN |
denotes |
membrane |
T2885 |
2203-2204 |
-LRB- |
denotes |
[ |
T2887 |
2204-2205 |
CD |
denotes |
6 |
T2888 |
2205-2206 |
, |
denotes |
, |
T2886 |
2206-2208 |
CD |
denotes |
12 |
T2889 |
2208-2209 |
-RRB- |
denotes |
] |
T2890 |
2209-2210 |
. |
denotes |
. |
T2891 |
2210-2282 |
sentence |
denotes |
Several mouse models of diabetes insipidus have been generated [13–17]. |
T2892 |
2211-2218 |
JJ |
denotes |
Several |
T2894 |
2219-2224 |
NN |
denotes |
mouse |
T2893 |
2225-2231 |
NNS |
denotes |
models |
T2896 |
2232-2234 |
IN |
denotes |
of |
T2897 |
2235-2243 |
NN |
denotes |
diabetes |
T2898 |
2244-2253 |
NN |
denotes |
insipidus |
T2899 |
2254-2258 |
VBP |
denotes |
have |
T2900 |
2259-2263 |
VBN |
denotes |
been |
T2895 |
2264-2273 |
VBN |
denotes |
generated |
T2901 |
2274-2275 |
-LRB- |
denotes |
[ |
T2902 |
2275-2277 |
CD |
denotes |
13 |
T2903 |
2277-2278 |
SYM |
denotes |
– |
T2904 |
2278-2280 |
CD |
denotes |
17 |
T2905 |
2280-2281 |
-RRB- |
denotes |
] |
T2906 |
2281-2282 |
. |
denotes |
. |
T2907 |
2282-2390 |
sentence |
denotes |
In an attempt to recapitulate human NDI, mice have been generated with mutations in Aqp2 and Avpr2 [15,18]. |
T2908 |
2283-2285 |
IN |
denotes |
In |
T2910 |
2286-2288 |
DT |
denotes |
an |
T2911 |
2289-2296 |
NN |
denotes |
attempt |
T2912 |
2297-2299 |
TO |
denotes |
to |
T2913 |
2300-2312 |
VB |
denotes |
recapitulate |
T2914 |
2313-2318 |
JJ |
denotes |
human |
T2915 |
2319-2322 |
NN |
denotes |
NDI |
T2916 |
2322-2324 |
, |
denotes |
, |
T2917 |
2324-2328 |
NNS |
denotes |
mice |
T2918 |
2329-2333 |
VBP |
denotes |
have |
T2919 |
2334-2338 |
VBN |
denotes |
been |
T2909 |
2339-2348 |
VBN |
denotes |
generated |
T2920 |
2349-2353 |
IN |
denotes |
with |
T2921 |
2354-2363 |
NNS |
denotes |
mutations |
T2922 |
2364-2366 |
IN |
denotes |
in |
T2923 |
2367-2371 |
NN |
denotes |
Aqp2 |
T2924 |
2372-2375 |
CC |
denotes |
and |
T2925 |
2376-2381 |
NN |
denotes |
Avpr2 |
T2926 |
2382-2383 |
-LRB- |
denotes |
[ |
T2928 |
2383-2385 |
CD |
denotes |
15 |
T2929 |
2385-2386 |
, |
denotes |
, |
T2927 |
2386-2388 |
CD |
denotes |
18 |
T2930 |
2388-2389 |
-RRB- |
denotes |
] |
T2931 |
2389-2390 |
. |
denotes |
. |
T2932 |
2390-2475 |
sentence |
denotes |
Yang and colleagues created a mouse with a T126M knock-in mutation in the Aqp2 gene. |
T2933 |
2391-2395 |
NNP |
denotes |
Yang |
T2935 |
2396-2399 |
CC |
denotes |
and |
T2936 |
2400-2410 |
NNS |
denotes |
colleagues |
T2934 |
2411-2418 |
VBD |
denotes |
created |
T2937 |
2419-2420 |
DT |
denotes |
a |
T2938 |
2421-2426 |
NN |
denotes |
mouse |
T2939 |
2427-2431 |
IN |
denotes |
with |
T2940 |
2432-2433 |
DT |
denotes |
a |
T2942 |
2434-2439 |
NN |
denotes |
T126M |
T2943 |
2440-2445 |
VB |
denotes |
knock |
T2944 |
2445-2446 |
HYPH |
denotes |
- |
T2945 |
2446-2448 |
RP |
denotes |
in |
T2941 |
2449-2457 |
NN |
denotes |
mutation |
T2946 |
2458-2460 |
IN |
denotes |
in |
T2947 |
2461-2464 |
DT |
denotes |
the |
T2949 |
2465-2469 |
NN |
denotes |
Aqp2 |
T2948 |
2470-2474 |
NN |
denotes |
gene |
T2950 |
2474-2475 |
. |
denotes |
. |
T2951 |
2475-2541 |
sentence |
denotes |
Unexpectedly, homozygous mutant mice died within 6 d after birth. |
T2952 |
2476-2488 |
RB |
denotes |
Unexpectedly |
T2954 |
2488-2490 |
, |
denotes |
, |
T2955 |
2490-2500 |
JJ |
denotes |
homozygous |
T2957 |
2501-2507 |
NN |
denotes |
mutant |
T2956 |
2508-2512 |
NNS |
denotes |
mice |
T2953 |
2513-2517 |
VBD |
denotes |
died |
T2958 |
2518-2524 |
IN |
denotes |
within |
T2959 |
2525-2526 |
CD |
denotes |
6 |
T2960 |
2527-2528 |
NNS |
denotes |
d |
T2961 |
2529-2534 |
IN |
denotes |
after |
T2962 |
2535-2540 |
NN |
denotes |
birth |
T2963 |
2540-2541 |
. |
denotes |
. |
T2964 |
2541-2626 |
sentence |
denotes |
Interestingly, AVPR2-deficient male pups also die within the first week after birth. |
T2965 |
2542-2555 |
RB |
denotes |
Interestingly |
T2967 |
2555-2557 |
, |
denotes |
, |
T2968 |
2557-2562 |
NN |
denotes |
AVPR2 |
T2970 |
2562-2563 |
HYPH |
denotes |
- |
T2969 |
2563-2572 |
JJ |
denotes |
deficient |
T2972 |
2573-2577 |
JJ |
denotes |
male |
T2971 |
2578-2582 |
NNS |
denotes |
pups |
T2973 |
2583-2587 |
RB |
denotes |
also |
T2966 |
2588-2591 |
VBP |
denotes |
die |
T2974 |
2592-2598 |
IN |
denotes |
within |
T2975 |
2599-2602 |
DT |
denotes |
the |
T2977 |
2603-2608 |
JJ |
denotes |
first |
T2976 |
2609-2613 |
NN |
denotes |
week |
T2978 |
2614-2619 |
IN |
denotes |
after |
T2979 |
2620-2625 |
NN |
denotes |
birth |
T2980 |
2625-2626 |
. |
denotes |
. |
T2981 |
2626-2780 |
sentence |
denotes |
Together these models suggest that the mouse may be a highly sensitive organism with regard to water homeostasis, and is unable to survive with polyuria. |
T2982 |
2627-2635 |
RB |
denotes |
Together |
T2984 |
2636-2641 |
DT |
denotes |
these |
T2985 |
2642-2648 |
NNS |
denotes |
models |
T2983 |
2649-2656 |
VBP |
denotes |
suggest |
T2986 |
2657-2661 |
IN |
denotes |
that |
T2988 |
2662-2665 |
DT |
denotes |
the |
T2989 |
2666-2671 |
NN |
denotes |
mouse |
T2990 |
2672-2675 |
MD |
denotes |
may |
T2987 |
2676-2678 |
VB |
denotes |
be |
T2991 |
2679-2680 |
DT |
denotes |
a |
T2993 |
2681-2687 |
RB |
denotes |
highly |
T2994 |
2688-2697 |
JJ |
denotes |
sensitive |
T2992 |
2698-2706 |
NN |
denotes |
organism |
T2995 |
2707-2711 |
IN |
denotes |
with |
T2996 |
2712-2718 |
NN |
denotes |
regard |
T2997 |
2719-2721 |
IN |
denotes |
to |
T2998 |
2722-2727 |
NN |
denotes |
water |
T2999 |
2728-2739 |
NN |
denotes |
homeostasis |
T3000 |
2739-2741 |
, |
denotes |
, |
T3001 |
2741-2744 |
CC |
denotes |
and |
T3002 |
2745-2747 |
VBZ |
denotes |
is |
T3003 |
2748-2754 |
JJ |
denotes |
unable |
T3004 |
2755-2757 |
TO |
denotes |
to |
T3005 |
2758-2765 |
VB |
denotes |
survive |
T3006 |
2766-2770 |
IN |
denotes |
with |
T3007 |
2771-2779 |
NN |
denotes |
polyuria |
T3008 |
2779-2780 |
. |
denotes |
. |
T3009 |
2780-2855 |
sentence |
denotes |
In a forward genetic screen, a mouse with an Aqp2 mutation was identified. |
T3010 |
2781-2783 |
IN |
denotes |
In |
T3012 |
2784-2785 |
DT |
denotes |
a |
T3014 |
2786-2793 |
RB |
denotes |
forward |
T3015 |
2794-2801 |
JJ |
denotes |
genetic |
T3013 |
2802-2808 |
NN |
denotes |
screen |
T3016 |
2808-2810 |
, |
denotes |
, |
T3017 |
2810-2811 |
DT |
denotes |
a |
T3018 |
2812-2817 |
NN |
denotes |
mouse |
T3019 |
2818-2822 |
IN |
denotes |
with |
T3020 |
2823-2825 |
DT |
denotes |
an |
T3022 |
2826-2830 |
NN |
denotes |
Aqp2 |
T3021 |
2831-2839 |
NN |
denotes |
mutation |
T3023 |
2840-2843 |
VBD |
denotes |
was |
T3011 |
2844-2854 |
VBN |
denotes |
identified |
T3024 |
2854-2855 |
. |
denotes |
. |
T3025 |
2855-2948 |
sentence |
denotes |
The purpose of this study was to characterize this murine model of recessive nephrogenic DI. |
T3026 |
2856-2859 |
DT |
denotes |
The |
T3027 |
2860-2867 |
NN |
denotes |
purpose |
T3029 |
2868-2870 |
IN |
denotes |
of |
T3030 |
2871-2875 |
DT |
denotes |
this |
T3031 |
2876-2881 |
NN |
denotes |
study |
T3028 |
2882-2885 |
VBD |
denotes |
was |
T3032 |
2886-2888 |
TO |
denotes |
to |
T3033 |
2889-2901 |
VB |
denotes |
characterize |
T3034 |
2902-2906 |
DT |
denotes |
this |
T3036 |
2907-2913 |
JJ |
denotes |
murine |
T3035 |
2914-2919 |
NN |
denotes |
model |
T3037 |
2920-2922 |
IN |
denotes |
of |
T3038 |
2923-2932 |
JJ |
denotes |
recessive |
T3040 |
2933-2944 |
JJ |
denotes |
nephrogenic |
T3039 |
2945-2947 |
NN |
denotes |
DI |
T3041 |
2947-2948 |
. |
denotes |
. |
T3042 |
2948-3003 |
sentence |
denotes |
We now report a novel F204V mutation in the Aqp2 gene. |
T3043 |
2949-2951 |
PRP |
denotes |
We |
T3045 |
2952-2955 |
RB |
denotes |
now |
T3044 |
2956-2962 |
VBP |
denotes |
report |
T3046 |
2963-2964 |
DT |
denotes |
a |
T3048 |
2965-2970 |
JJ |
denotes |
novel |
T3049 |
2971-2976 |
NN |
denotes |
F204V |
T3047 |
2977-2985 |
NN |
denotes |
mutation |
T3050 |
2986-2988 |
IN |
denotes |
in |
T3051 |
2989-2992 |
DT |
denotes |
the |
T3053 |
2993-2997 |
NN |
denotes |
Aqp2 |
T3052 |
2998-3002 |
NN |
denotes |
gene |
T3054 |
3002-3003 |
. |
denotes |
. |
T3055 |
3003-3111 |
sentence |
denotes |
This allele of Aqp2 was found to cause the first mouse model of NDI to survive past the first week of life. |
T3056 |
3004-3008 |
DT |
denotes |
This |
T3057 |
3009-3015 |
NN |
denotes |
allele |
T3059 |
3016-3018 |
IN |
denotes |
of |
T3060 |
3019-3023 |
NN |
denotes |
Aqp2 |
T3061 |
3024-3027 |
VBD |
denotes |
was |
T3058 |
3028-3033 |
VBN |
denotes |
found |
T3062 |
3034-3036 |
TO |
denotes |
to |
T3063 |
3037-3042 |
VB |
denotes |
cause |
T3064 |
3043-3046 |
DT |
denotes |
the |
T3066 |
3047-3052 |
JJ |
denotes |
first |
T3067 |
3053-3058 |
NN |
denotes |
mouse |
T3065 |
3059-3064 |
NN |
denotes |
model |
T3069 |
3065-3067 |
IN |
denotes |
of |
T3070 |
3068-3071 |
NN |
denotes |
NDI |
T3071 |
3072-3074 |
TO |
denotes |
to |
T3068 |
3075-3082 |
VB |
denotes |
survive |
T3072 |
3083-3087 |
IN |
denotes |
past |
T3073 |
3088-3091 |
DT |
denotes |
the |
T3075 |
3092-3097 |
JJ |
denotes |
first |
T3074 |
3098-3102 |
NN |
denotes |
week |
T3076 |
3103-3105 |
IN |
denotes |
of |
T3077 |
3106-3110 |
NN |
denotes |
life |
T3078 |
3110-3111 |
. |
denotes |
. |
T3079 |
3111-3312 |
sentence |
denotes |
Molecular analyses concluded that mutant AQP2 adopts a different subcellular localization in renal collecting-duct cells, and was resistant to translocation induced by desmopressin, an agonist of AVP. |
T3080 |
3112-3121 |
JJ |
denotes |
Molecular |
T3081 |
3122-3130 |
NNS |
denotes |
analyses |
T3082 |
3131-3140 |
VBD |
denotes |
concluded |
T3083 |
3141-3145 |
IN |
denotes |
that |
T3085 |
3146-3152 |
NN |
denotes |
mutant |
T3086 |
3153-3157 |
NN |
denotes |
AQP2 |
T3084 |
3158-3164 |
VBZ |
denotes |
adopts |
T3087 |
3165-3166 |
DT |
denotes |
a |
T3089 |
3167-3176 |
JJ |
denotes |
different |
T3090 |
3177-3188 |
JJ |
denotes |
subcellular |
T3088 |
3189-3201 |
NN |
denotes |
localization |
T3091 |
3202-3204 |
IN |
denotes |
in |
T3092 |
3205-3210 |
JJ |
denotes |
renal |
T3094 |
3211-3221 |
VBG |
denotes |
collecting |
T3096 |
3221-3222 |
HYPH |
denotes |
- |
T3095 |
3222-3226 |
NN |
denotes |
duct |
T3093 |
3227-3232 |
NNS |
denotes |
cells |
T3097 |
3232-3234 |
, |
denotes |
, |
T3098 |
3234-3237 |
CC |
denotes |
and |
T3099 |
3238-3241 |
VBD |
denotes |
was |
T3100 |
3242-3251 |
JJ |
denotes |
resistant |
T3101 |
3252-3254 |
IN |
denotes |
to |
T3102 |
3255-3268 |
NN |
denotes |
translocation |
T3103 |
3269-3276 |
VBN |
denotes |
induced |
T3104 |
3277-3279 |
IN |
denotes |
by |
T3105 |
3280-3292 |
NN |
denotes |
desmopressin |
T3106 |
3292-3294 |
, |
denotes |
, |
T3107 |
3294-3296 |
DT |
denotes |
an |
T3108 |
3297-3304 |
NN |
denotes |
agonist |
T3109 |
3305-3307 |
IN |
denotes |
of |
T3110 |
3308-3311 |
NN |
denotes |
AVP |
T3111 |
3311-3312 |
. |
denotes |
. |
T3112 |
3312-3494 |
sentence |
denotes |
In vitro studies using the Madin-Darby canine kidney (MDCK) cell line demonstrated an endoplasmic reticulum pattern for the mutant protein, and apparent resistance to translocation. |
T3113 |
3313-3315 |
FW |
denotes |
In |
T3114 |
3316-3321 |
FW |
denotes |
vitro |
T3115 |
3322-3329 |
NNS |
denotes |
studies |
T3117 |
3330-3335 |
VBG |
denotes |
using |
T3118 |
3336-3339 |
DT |
denotes |
the |
T3120 |
3340-3345 |
NN |
denotes |
Madin |
T3122 |
3345-3346 |
HYPH |
denotes |
- |
T3121 |
3346-3351 |
NN |
denotes |
Darby |
T3124 |
3352-3358 |
JJ |
denotes |
canine |
T3123 |
3359-3365 |
NN |
denotes |
kidney |
T3125 |
3366-3367 |
-LRB- |
denotes |
( |
T3126 |
3367-3371 |
NN |
denotes |
MDCK |
T3127 |
3371-3372 |
-RRB- |
denotes |
) |
T3128 |
3373-3377 |
NN |
denotes |
cell |
T3119 |
3378-3382 |
NN |
denotes |
line |
T3116 |
3383-3395 |
VBD |
denotes |
demonstrated |
T3129 |
3396-3398 |
DT |
denotes |
an |
T3131 |
3399-3410 |
JJ |
denotes |
endoplasmic |
T3132 |
3411-3420 |
NN |
denotes |
reticulum |
T3130 |
3421-3428 |
NN |
denotes |
pattern |
T3133 |
3429-3432 |
IN |
denotes |
for |
T3134 |
3433-3436 |
DT |
denotes |
the |
T3136 |
3437-3443 |
NN |
denotes |
mutant |
T3135 |
3444-3451 |
NN |
denotes |
protein |
T3137 |
3451-3453 |
, |
denotes |
, |
T3138 |
3453-3456 |
CC |
denotes |
and |
T3139 |
3457-3465 |
JJ |
denotes |
apparent |
T3140 |
3466-3476 |
NN |
denotes |
resistance |
T3141 |
3477-3479 |
IN |
denotes |
to |
T3142 |
3480-3493 |
NN |
denotes |
translocation |
T3143 |
3493-3494 |
. |
denotes |
. |
T3144 |
3494-3617 |
sentence |
denotes |
These data conclusively prove that autosomal recessive NDI is a consequence of improper AQP2 routing in the intact mammal. |
T3145 |
3495-3500 |
DT |
denotes |
These |
T3146 |
3501-3505 |
NNS |
denotes |
data |
T3148 |
3506-3518 |
RB |
denotes |
conclusively |
T3147 |
3519-3524 |
VBP |
denotes |
prove |
T3149 |
3525-3529 |
IN |
denotes |
that |
T3151 |
3530-3539 |
JJ |
denotes |
autosomal |
T3153 |
3540-3549 |
JJ |
denotes |
recessive |
T3152 |
3550-3553 |
NN |
denotes |
NDI |
T3150 |
3554-3556 |
VBZ |
denotes |
is |
T3154 |
3557-3558 |
DT |
denotes |
a |
T3155 |
3559-3570 |
NN |
denotes |
consequence |
T3156 |
3571-3573 |
IN |
denotes |
of |
T3157 |
3574-3582 |
JJ |
denotes |
improper |
T3159 |
3583-3587 |
NN |
denotes |
AQP2 |
T3158 |
3588-3595 |
NN |
denotes |
routing |
T3160 |
3596-3598 |
IN |
denotes |
in |
T3161 |
3599-3602 |
DT |
denotes |
the |
T3163 |
3603-3609 |
JJ |
denotes |
intact |
T3162 |
3610-3616 |
NN |
denotes |
mammal |
T3164 |
3616-3617 |
. |
denotes |
. |
T8951 |
3627-3629 |
IN |
denotes |
In |
T8953 |
3630-3631 |
DT |
denotes |
a |
T8955 |
3632-3639 |
JJ |
denotes |
forward |
T8956 |
3640-3647 |
JJ |
denotes |
genetic |
T8954 |
3648-3654 |
NN |
denotes |
screen |
T8957 |
3655-3659 |
WDT |
denotes |
that |
T8958 |
3660-3664 |
VBD |
denotes |
used |
T8959 |
3665-3681 |
NN |
denotes |
ethylnitrosourea |
T8960 |
3682-3683 |
-LRB- |
denotes |
( |
T8961 |
3683-3686 |
NN |
denotes |
ENU |
T8962 |
3686-3687 |
-RRB- |
denotes |
) |
T8963 |
3688-3690 |
TO |
denotes |
to |
T8964 |
3691-3697 |
VB |
denotes |
induce |
T8965 |
3698-3707 |
NNS |
denotes |
mutations |
T8966 |
3708-3710 |
IN |
denotes |
in |
T8967 |
3711-3712 |
DT |
denotes |
a |
T8969 |
3713-3720 |
NN |
denotes |
founder |
T8968 |
3721-3727 |
NN |
denotes |
animal |
T8970 |
3728-3733 |
WP$ |
denotes |
whose |
T8971 |
3734-3743 |
NN |
denotes |
offspring |
T8973 |
3744-3748 |
VBD |
denotes |
were |
T8974 |
3749-3753 |
RB |
denotes |
then |
T8972 |
3754-3762 |
VBN |
denotes |
screened |
T8975 |
3763-3766 |
IN |
denotes |
for |
T8976 |
3767-3775 |
JJ |
denotes |
abnormal |
T8978 |
3776-3781 |
JJ |
denotes |
whole |
T8979 |
3782-3786 |
NN |
denotes |
body |
T8977 |
3787-3797 |
NN |
denotes |
metabolism |
T8980 |
3798-3799 |
-LRB- |
denotes |
[ |
T8982 |
3799-3801 |
CD |
denotes |
19 |
T8983 |
3801-3802 |
, |
denotes |
, |
T8981 |
3802-3804 |
CD |
denotes |
20 |
T8984 |
3804-3805 |
-RRB- |
denotes |
] |
T8985 |
3805-3807 |
, |
denotes |
, |
T8986 |
3807-3809 |
PRP |
denotes |
we |
T8952 |
3810-3815 |
VBD |
denotes |
found |
T8987 |
3816-3817 |
DT |
denotes |
a |
T8988 |
3818-3824 |
NN |
denotes |
family |
T8989 |
3825-3827 |
IN |
denotes |
of |
T8990 |
3828-3832 |
NNS |
denotes |
mice |
T8991 |
3833-3837 |
WDT |
denotes |
that |
T8992 |
3838-3846 |
VBD |
denotes |
urinated |
T8993 |
3847-3850 |
CC |
denotes |
and |
T8994 |
3851-3856 |
VBD |
denotes |
drank |
T8995 |
3857-3868 |
RB |
denotes |
excessively |
T8996 |
3868-3869 |
. |
denotes |
. |
T8997 |
3869-3998 |
sentence |
denotes |
Serum and urine analysis showed that plasma glucose levels were normal and there was no glucose in the urine (unpublished data). |
T8998 |
3870-3875 |
NN |
denotes |
Serum |
T9000 |
3876-3879 |
CC |
denotes |
and |
T9001 |
3880-3885 |
NN |
denotes |
urine |
T8999 |
3886-3894 |
NN |
denotes |
analysis |
T9002 |
3895-3901 |
VBD |
denotes |
showed |
T9003 |
3902-3906 |
IN |
denotes |
that |
T9005 |
3907-3913 |
NN |
denotes |
plasma |
T9007 |
3914-3921 |
NN |
denotes |
glucose |
T9006 |
3922-3928 |
NNS |
denotes |
levels |
T9004 |
3929-3933 |
VBD |
denotes |
were |
T9008 |
3934-3940 |
JJ |
denotes |
normal |
T9009 |
3941-3944 |
CC |
denotes |
and |
T9010 |
3945-3950 |
EX |
denotes |
there |
T9011 |
3951-3954 |
VBD |
denotes |
was |
T9012 |
3955-3957 |
DT |
denotes |
no |
T9013 |
3958-3965 |
NN |
denotes |
glucose |
T9014 |
3966-3968 |
IN |
denotes |
in |
T9015 |
3969-3972 |
DT |
denotes |
the |
T9016 |
3973-3978 |
NN |
denotes |
urine |
T9017 |
3979-3980 |
-LRB- |
denotes |
( |
T9019 |
3980-3991 |
JJ |
denotes |
unpublished |
T9018 |
3992-3996 |
NNS |
denotes |
data |
T9020 |
3996-3997 |
-RRB- |
denotes |
) |
T9021 |
3997-3998 |
. |
denotes |
. |
T9022 |
3998-4048 |
sentence |
denotes |
Hence, this was an example of diabetes insipidus. |
T9023 |
3999-4004 |
RB |
denotes |
Hence |
T9025 |
4004-4006 |
, |
denotes |
, |
T9026 |
4006-4010 |
DT |
denotes |
this |
T9024 |
4011-4014 |
VBD |
denotes |
was |
T9027 |
4015-4017 |
DT |
denotes |
an |
T9028 |
4018-4025 |
NN |
denotes |
example |
T9029 |
4026-4028 |
IN |
denotes |
of |
T9030 |
4029-4037 |
NN |
denotes |
diabetes |
T9031 |
4038-4047 |
NN |
denotes |
insipidus |
T9032 |
4047-4048 |
. |
denotes |
. |
T9033 |
4048-4160 |
sentence |
denotes |
The disorder in these mice segregated in a monogenic, autosomal recessive manner, making Aqp2 a candidate gene. |
T9034 |
4049-4052 |
DT |
denotes |
The |
T9035 |
4053-4061 |
NN |
denotes |
disorder |
T9037 |
4062-4064 |
IN |
denotes |
in |
T9038 |
4065-4070 |
DT |
denotes |
these |
T9039 |
4071-4075 |
NNS |
denotes |
mice |
T9036 |
4076-4086 |
VBD |
denotes |
segregated |
T9040 |
4087-4089 |
IN |
denotes |
in |
T9041 |
4090-4091 |
DT |
denotes |
a |
T9043 |
4092-4101 |
JJ |
denotes |
monogenic |
T9044 |
4101-4103 |
, |
denotes |
, |
T9045 |
4103-4112 |
JJ |
denotes |
autosomal |
T9046 |
4113-4122 |
JJ |
denotes |
recessive |
T9042 |
4123-4129 |
NN |
denotes |
manner |
T9047 |
4129-4131 |
, |
denotes |
, |
T9048 |
4131-4137 |
VBG |
denotes |
making |
T9049 |
4138-4142 |
NN |
denotes |
Aqp2 |
T9051 |
4143-4144 |
DT |
denotes |
a |
T9052 |
4145-4154 |
NN |
denotes |
candidate |
T9050 |
4155-4159 |
NN |
denotes |
gene |
T9053 |
4159-4160 |
. |
denotes |
. |
T9054 |
4160-4389 |
sentence |
denotes |
Sequencing of Aqp2 coding region of affected mice identified a thymine to guanine (T to G) transversion (Figure 1A), which is predicted to lead to a valine for phenylalanine substitution at amino acid 204 of the protein (F204V). |
T9055 |
4161-4171 |
NN |
denotes |
Sequencing |
T9057 |
4172-4174 |
IN |
denotes |
of |
T9058 |
4175-4179 |
NN |
denotes |
Aqp2 |
T9060 |
4180-4186 |
NN |
denotes |
coding |
T9059 |
4187-4193 |
NN |
denotes |
region |
T9061 |
4194-4196 |
IN |
denotes |
of |
T9062 |
4197-4205 |
VBN |
denotes |
affected |
T9063 |
4206-4210 |
NNS |
denotes |
mice |
T9056 |
4211-4221 |
VBD |
denotes |
identified |
T9064 |
4222-4223 |
DT |
denotes |
a |
T9066 |
4224-4231 |
NN |
denotes |
thymine |
T9067 |
4232-4234 |
IN |
denotes |
to |
T9068 |
4235-4242 |
NN |
denotes |
guanine |
T9069 |
4243-4244 |
-LRB- |
denotes |
( |
T9070 |
4244-4245 |
NN |
denotes |
T |
T9071 |
4246-4248 |
IN |
denotes |
to |
T9072 |
4249-4250 |
NN |
denotes |
G |
T9073 |
4250-4251 |
-RRB- |
denotes |
) |
T9065 |
4252-4264 |
NN |
denotes |
transversion |
T9074 |
4265-4266 |
-LRB- |
denotes |
( |
T9075 |
4266-4272 |
NN |
denotes |
Figure |
T9076 |
4273-4275 |
CD |
denotes |
1A |
T9077 |
4275-4276 |
-RRB- |
denotes |
) |
T9078 |
4276-4278 |
, |
denotes |
, |
T9079 |
4278-4283 |
WDT |
denotes |
which |
T9081 |
4284-4286 |
VBZ |
denotes |
is |
T9080 |
4287-4296 |
VBN |
denotes |
predicted |
T9082 |
4297-4299 |
TO |
denotes |
to |
T9083 |
4300-4304 |
VB |
denotes |
lead |
T9084 |
4305-4307 |
IN |
denotes |
to |
T9085 |
4308-4309 |
DT |
denotes |
a |
T9087 |
4310-4316 |
NN |
denotes |
valine |
T9088 |
4317-4320 |
IN |
denotes |
for |
T9089 |
4321-4334 |
NN |
denotes |
phenylalanine |
T9086 |
4335-4347 |
NN |
denotes |
substitution |
T9090 |
4348-4350 |
IN |
denotes |
at |
T9091 |
4351-4356 |
NN |
denotes |
amino |
T9092 |
4357-4361 |
NN |
denotes |
acid |
T9093 |
4362-4365 |
CD |
denotes |
204 |
T9094 |
4366-4368 |
IN |
denotes |
of |
T9095 |
4369-4372 |
DT |
denotes |
the |
T9096 |
4373-4380 |
NN |
denotes |
protein |
T9097 |
4381-4382 |
-LRB- |
denotes |
( |
T9098 |
4382-4387 |
NN |
denotes |
F204V |
T9099 |
4387-4388 |
-RRB- |
denotes |
) |
T9100 |
4388-4389 |
. |
denotes |
. |
T9101 |
4389-5579 |
sentence |
denotes |
Figure 1 Analysis of Aqp2 Sequence and Phenotype in Mutant Mice
(A) Chromatographic traces of Aqp2 F204V mutation. The box shows the mutated codon, TTC (Phe) to GTC (Val) at position 204.
WT, wild type; Mut, mutant.
(B) Amino acid conservation of mouse AQP2 (residues 194–214). The boxed residue indicates phenylalanine at position 204.
hAQP2, human AQP2; mAQP1, mouse AQP1; mAQP2, mouse AQP2; rAQP2, rat AQP2; xAQP2, Xenopus AQP2.
(C) Urine production (ml) and water consumption (ml) of 58 F2 mice over a 24-h period (both sexes, aged 10–22 wk). Mutant mice (black squares) exhibit overt polyuria and polydipsia compared to littermate wild-type (white triangles) and heterozygous (grey circles) mice.
(D) Urine osmolality and concentrating ability in Aqp2 mutant and their littermates (10–22 wk, both sexes), before (white bars) and after (black bars) dDAVP treatment. Wild type (WT; n = 12); heterozygote (Het; n = 20); mutant (Mut; n = 9). Data represent averages ± standard error of the mean, **p < 0.01; ***p < 0.001. AQP2 is a six-transmembrane water channel, and F204 lies near the extracellular face of the sixth membrane spanning domain, a region rich in hydrophobic amino acids. |
T9102 |
5414-5418 |
NN |
denotes |
AQP2 |
T9103 |
5419-5421 |
VBZ |
denotes |
is |
T9104 |
5422-5423 |
DT |
denotes |
a |
T9106 |
5424-5427 |
CD |
denotes |
six |
T9108 |
5427-5428 |
HYPH |
denotes |
- |
T9107 |
5428-5441 |
NN |
denotes |
transmembrane |
T9109 |
5442-5447 |
NN |
denotes |
water |
T9105 |
5448-5455 |
NN |
denotes |
channel |
T9110 |
5455-5457 |
, |
denotes |
, |
T9111 |
5457-5460 |
CC |
denotes |
and |
T9112 |
5461-5465 |
NN |
denotes |
F204 |
T9113 |
5466-5470 |
VBZ |
denotes |
lies |
T9114 |
5471-5475 |
IN |
denotes |
near |
T9115 |
5476-5479 |
DT |
denotes |
the |
T9117 |
5480-5493 |
JJ |
denotes |
extracellular |
T9116 |
5494-5498 |
NN |
denotes |
face |
T9118 |
5499-5501 |
IN |
denotes |
of |
T9119 |
5502-5505 |
DT |
denotes |
the |
T9121 |
5506-5511 |
JJ |
denotes |
sixth |
T9122 |
5512-5520 |
NN |
denotes |
membrane |
T9123 |
5521-5529 |
VBG |
denotes |
spanning |
T9120 |
5530-5536 |
NN |
denotes |
domain |
T9124 |
5536-5538 |
, |
denotes |
, |
T9125 |
5538-5539 |
DT |
denotes |
a |
T9126 |
5540-5546 |
NN |
denotes |
region |
T9127 |
5547-5551 |
JJ |
denotes |
rich |
T9128 |
5552-5554 |
IN |
denotes |
in |
T9129 |
5555-5566 |
JJ |
denotes |
hydrophobic |
T9131 |
5567-5572 |
NN |
denotes |
amino |
T9130 |
5573-5578 |
NNS |
denotes |
acids |
T9132 |
5578-5579 |
. |
denotes |
. |
T9133 |
5579-5664 |
sentence |
denotes |
This and the other membrane-spanning domains are conserved among vertebrate species. |
T9134 |
5580-5584 |
DT |
denotes |
This |
T9136 |
5585-5588 |
CC |
denotes |
and |
T9137 |
5589-5592 |
DT |
denotes |
the |
T9138 |
5593-5598 |
JJ |
denotes |
other |
T9140 |
5599-5607 |
NN |
denotes |
membrane |
T9142 |
5607-5608 |
HYPH |
denotes |
- |
T9141 |
5608-5616 |
VBG |
denotes |
spanning |
T9139 |
5617-5624 |
NNS |
denotes |
domains |
T9143 |
5625-5628 |
VBP |
denotes |
are |
T9135 |
5629-5638 |
VBN |
denotes |
conserved |
T9144 |
5639-5644 |
IN |
denotes |
among |
T9145 |
5645-5655 |
JJ |
denotes |
vertebrate |
T9146 |
5656-5663 |
NNS |
denotes |
species |
T9147 |
5663-5664 |
. |
denotes |
. |
T9148 |
5664-5829 |
sentence |
denotes |
The phenylalanine at position 204 is particularly well conserved (Figure 1B), not only among vertebrate AQP2 proteins, but also among others members of this family. |
T9149 |
5665-5668 |
DT |
denotes |
The |
T9150 |
5669-5682 |
NN |
denotes |
phenylalanine |
T9152 |
5683-5685 |
IN |
denotes |
at |
T9153 |
5686-5694 |
NN |
denotes |
position |
T9154 |
5695-5698 |
CD |
denotes |
204 |
T9151 |
5699-5701 |
VBZ |
denotes |
is |
T9155 |
5702-5714 |
RB |
denotes |
particularly |
T9157 |
5715-5719 |
RB |
denotes |
well |
T9156 |
5720-5729 |
VBN |
denotes |
conserved |
T9158 |
5730-5731 |
-LRB- |
denotes |
( |
T9159 |
5731-5737 |
NN |
denotes |
Figure |
T9160 |
5738-5740 |
CD |
denotes |
1B |
T9161 |
5740-5741 |
-RRB- |
denotes |
) |
T9162 |
5741-5743 |
, |
denotes |
, |
T9163 |
5743-5746 |
RB |
denotes |
not |
T9165 |
5747-5751 |
RB |
denotes |
only |
T9164 |
5752-5757 |
IN |
denotes |
among |
T9166 |
5758-5768 |
JJ |
denotes |
vertebrate |
T9168 |
5769-5773 |
NN |
denotes |
AQP2 |
T9167 |
5774-5782 |
NN |
denotes |
proteins |
T9169 |
5782-5784 |
, |
denotes |
, |
T9170 |
5784-5787 |
CC |
denotes |
but |
T9171 |
5788-5792 |
RB |
denotes |
also |
T9172 |
5793-5798 |
IN |
denotes |
among |
T9173 |
5799-5805 |
NNS |
denotes |
others |
T9174 |
5806-5813 |
NNS |
denotes |
members |
T9175 |
5814-5816 |
IN |
denotes |
of |
T9176 |
5817-5821 |
DT |
denotes |
this |
T9177 |
5822-5828 |
NN |
denotes |
family |
T9178 |
5828-5829 |
. |
denotes |
. |
T9179 |
5829-6036 |
sentence |
denotes |
Aqp2F204V/F204V mice have dramatically increased urine production, in some cases producing an amount of urine in 24 h that exceeds their body weight, compared to their heterozygous or wild-type littermates. |
T9180 |
5830-5839 |
NN |
denotes |
Aqp2F204V |
T9182 |
5839-5840 |
HYPH |
denotes |
/ |
T9181 |
5840-5845 |
NN |
denotes |
F204V |
T9183 |
5846-5850 |
NNS |
denotes |
mice |
T9184 |
5851-5855 |
VBP |
denotes |
have |
T9185 |
5856-5868 |
RB |
denotes |
dramatically |
T9186 |
5869-5878 |
VBN |
denotes |
increased |
T9188 |
5879-5884 |
NN |
denotes |
urine |
T9187 |
5885-5895 |
NN |
denotes |
production |
T9189 |
5895-5897 |
, |
denotes |
, |
T9190 |
5897-5899 |
IN |
denotes |
in |
T9192 |
5900-5904 |
DT |
denotes |
some |
T9193 |
5905-5910 |
NNS |
denotes |
cases |
T9191 |
5911-5920 |
VBG |
denotes |
producing |
T9194 |
5921-5923 |
DT |
denotes |
an |
T9195 |
5924-5930 |
NN |
denotes |
amount |
T9196 |
5931-5933 |
IN |
denotes |
of |
T9197 |
5934-5939 |
NN |
denotes |
urine |
T9198 |
5940-5942 |
IN |
denotes |
in |
T9199 |
5943-5945 |
CD |
denotes |
24 |
T9200 |
5946-5947 |
NN |
denotes |
h |
T9201 |
5948-5952 |
WDT |
denotes |
that |
T9202 |
5953-5960 |
VBZ |
denotes |
exceeds |
T9203 |
5961-5966 |
PRP$ |
denotes |
their |
T9205 |
5967-5971 |
NN |
denotes |
body |
T9204 |
5972-5978 |
NN |
denotes |
weight |
T9206 |
5978-5980 |
, |
denotes |
, |
T9207 |
5980-5988 |
VBN |
denotes |
compared |
T9208 |
5989-5991 |
IN |
denotes |
to |
T9209 |
5992-5997 |
PRP$ |
denotes |
their |
T9211 |
5998-6010 |
JJ |
denotes |
heterozygous |
T9212 |
6011-6013 |
CC |
denotes |
or |
T9213 |
6014-6018 |
JJ |
denotes |
wild |
T9215 |
6018-6019 |
HYPH |
denotes |
- |
T9214 |
6019-6023 |
NN |
denotes |
type |
T9210 |
6024-6035 |
NNS |
denotes |
littermates |
T9216 |
6035-6036 |
. |
denotes |
. |
T9217 |
6036-6140 |
sentence |
denotes |
Such loss of water would rapidly lead to dehydration were it not compensated by increased water intake. |
T9218 |
6037-6041 |
JJ |
denotes |
Such |
T9219 |
6042-6046 |
NN |
denotes |
loss |
T9221 |
6047-6049 |
IN |
denotes |
of |
T9222 |
6050-6055 |
NN |
denotes |
water |
T9223 |
6056-6061 |
MD |
denotes |
would |
T9224 |
6062-6069 |
RB |
denotes |
rapidly |
T9220 |
6070-6074 |
VB |
denotes |
lead |
T9225 |
6075-6077 |
IN |
denotes |
to |
T9226 |
6078-6089 |
NN |
denotes |
dehydration |
T9227 |
6090-6094 |
VBD |
denotes |
were |
T9229 |
6095-6097 |
PRP |
denotes |
it |
T9230 |
6098-6101 |
RB |
denotes |
not |
T9228 |
6102-6113 |
VBN |
denotes |
compensated |
T9231 |
6114-6116 |
IN |
denotes |
by |
T9232 |
6117-6126 |
VBN |
denotes |
increased |
T9234 |
6127-6132 |
NN |
denotes |
water |
T9233 |
6133-6139 |
NN |
denotes |
intake |
T9235 |
6139-6140 |
. |
denotes |
. |
T9236 |
6140-6275 |
sentence |
denotes |
Indeed, mutant mice also dramatically increase their water intake (Figure 1C) compared to their heterozygous or wild-type littermates. |
T9237 |
6141-6147 |
RB |
denotes |
Indeed |
T9239 |
6147-6149 |
, |
denotes |
, |
T9240 |
6149-6155 |
NN |
denotes |
mutant |
T9241 |
6156-6160 |
NNS |
denotes |
mice |
T9242 |
6161-6165 |
RB |
denotes |
also |
T9243 |
6166-6178 |
RB |
denotes |
dramatically |
T9238 |
6179-6187 |
VB |
denotes |
increase |
T9244 |
6188-6193 |
PRP$ |
denotes |
their |
T9246 |
6194-6199 |
NN |
denotes |
water |
T9245 |
6200-6206 |
NN |
denotes |
intake |
T9247 |
6207-6208 |
-LRB- |
denotes |
( |
T9248 |
6208-6214 |
NN |
denotes |
Figure |
T9249 |
6215-6217 |
CD |
denotes |
1C |
T9250 |
6217-6218 |
-RRB- |
denotes |
) |
T9251 |
6219-6227 |
VBN |
denotes |
compared |
T9252 |
6228-6230 |
IN |
denotes |
to |
T9253 |
6231-6236 |
PRP$ |
denotes |
their |
T9255 |
6237-6249 |
JJ |
denotes |
heterozygous |
T9256 |
6250-6252 |
CC |
denotes |
or |
T9257 |
6253-6257 |
JJ |
denotes |
wild |
T9259 |
6257-6258 |
HYPH |
denotes |
- |
T9258 |
6258-6262 |
NN |
denotes |
type |
T9254 |
6263-6274 |
NNS |
denotes |
littermates |
T9260 |
6274-6275 |
. |
denotes |
. |
T9261 |
6275-6426 |
sentence |
denotes |
This phenotype—increased urinary output and water intake—showed complete concordance with homozygosity of the F204V mutation in the 58 animals tested. |
T9262 |
6276-6280 |
DT |
denotes |
This |
T9263 |
6281-6290 |
NN |
denotes |
phenotype |
T9265 |
6290-6291 |
, |
denotes |
— |
T9266 |
6291-6300 |
VBN |
denotes |
increased |
T9268 |
6301-6308 |
JJ |
denotes |
urinary |
T9267 |
6309-6315 |
NN |
denotes |
output |
T9269 |
6316-6319 |
CC |
denotes |
and |
T9270 |
6320-6325 |
NN |
denotes |
water |
T9271 |
6326-6332 |
NN |
denotes |
intake |
T9272 |
6332-6333 |
, |
denotes |
— |
T9264 |
6333-6339 |
VBD |
denotes |
showed |
T9273 |
6340-6348 |
JJ |
denotes |
complete |
T9274 |
6349-6360 |
NN |
denotes |
concordance |
T9275 |
6361-6365 |
IN |
denotes |
with |
T9276 |
6366-6378 |
NN |
denotes |
homozygosity |
T9277 |
6379-6381 |
IN |
denotes |
of |
T9278 |
6382-6385 |
DT |
denotes |
the |
T9280 |
6386-6391 |
NN |
denotes |
F204V |
T9279 |
6392-6400 |
NN |
denotes |
mutation |
T9281 |
6401-6403 |
IN |
denotes |
in |
T9282 |
6404-6407 |
DT |
denotes |
the |
T9284 |
6408-6410 |
CD |
denotes |
58 |
T9283 |
6411-6418 |
NNS |
denotes |
animals |
T9285 |
6419-6425 |
VBN |
denotes |
tested |
T9286 |
6425-6426 |
. |
denotes |
. |
T9287 |
6426-6516 |
sentence |
denotes |
Diabetes insipidus can be defined as an inability to concentrate urine where appropriate. |
T9288 |
6427-6435 |
NN |
denotes |
Diabetes |
T9289 |
6436-6445 |
NN |
denotes |
insipidus |
T9291 |
6446-6449 |
MD |
denotes |
can |
T9292 |
6450-6452 |
VB |
denotes |
be |
T9290 |
6453-6460 |
VBN |
denotes |
defined |
T9293 |
6461-6463 |
IN |
denotes |
as |
T9294 |
6464-6466 |
DT |
denotes |
an |
T9295 |
6467-6476 |
NN |
denotes |
inability |
T9296 |
6477-6479 |
TO |
denotes |
to |
T9297 |
6480-6491 |
VB |
denotes |
concentrate |
T9298 |
6492-6497 |
NN |
denotes |
urine |
T9299 |
6498-6503 |
WRB |
denotes |
where |
T9300 |
6504-6515 |
JJ |
denotes |
appropriate |
T9301 |
6515-6516 |
. |
denotes |
. |
T9302 |
6516-6627 |
sentence |
denotes |
Compared to wild-type or heterozygous littermates, Aqp2F204V/F204V mice produce very dilute urine (Figure 1D). |
T9303 |
6517-6525 |
VBN |
denotes |
Compared |
T9305 |
6526-6528 |
IN |
denotes |
to |
T9306 |
6529-6533 |
JJ |
denotes |
wild |
T9308 |
6533-6534 |
HYPH |
denotes |
- |
T9307 |
6534-6538 |
NN |
denotes |
type |
T9310 |
6539-6541 |
CC |
denotes |
or |
T9311 |
6542-6554 |
JJ |
denotes |
heterozygous |
T9309 |
6555-6566 |
NNS |
denotes |
littermates |
T9312 |
6566-6568 |
, |
denotes |
, |
T9313 |
6568-6577 |
NN |
denotes |
Aqp2F204V |
T9315 |
6577-6578 |
HYPH |
denotes |
/ |
T9314 |
6578-6583 |
NN |
denotes |
F204V |
T9316 |
6584-6588 |
NNS |
denotes |
mice |
T9304 |
6589-6596 |
VBP |
denotes |
produce |
T9317 |
6597-6601 |
RB |
denotes |
very |
T9318 |
6602-6608 |
JJ |
denotes |
dilute |
T9319 |
6609-6614 |
NN |
denotes |
urine |
T9320 |
6615-6616 |
-LRB- |
denotes |
( |
T9321 |
6616-6622 |
NN |
denotes |
Figure |
T9322 |
6623-6625 |
CD |
denotes |
1D |
T9323 |
6625-6626 |
-RRB- |
denotes |
) |
T9324 |
6626-6627 |
. |
denotes |
. |
T9325 |
6627-6747 |
sentence |
denotes |
Basal urine concentration in mutant mice is about 161 mOsm, compared to about 1,293 mOsm in wild-type mice (p < 0.001). |
T9326 |
6628-6633 |
JJ |
denotes |
Basal |
T9328 |
6634-6639 |
NN |
denotes |
urine |
T9327 |
6640-6653 |
NN |
denotes |
concentration |
T9330 |
6654-6656 |
IN |
denotes |
in |
T9331 |
6657-6663 |
NN |
denotes |
mutant |
T9332 |
6664-6668 |
NNS |
denotes |
mice |
T9329 |
6669-6671 |
VBZ |
denotes |
is |
T9333 |
6672-6677 |
RB |
denotes |
about |
T9334 |
6678-6681 |
CD |
denotes |
161 |
T9335 |
6682-6686 |
NN |
denotes |
mOsm |
T9336 |
6686-6688 |
, |
denotes |
, |
T9337 |
6688-6696 |
VBN |
denotes |
compared |
T9338 |
6697-6699 |
IN |
denotes |
to |
T9339 |
6700-6705 |
IN |
denotes |
about |
T9340 |
6706-6711 |
CD |
denotes |
1,293 |
T9341 |
6712-6716 |
NN |
denotes |
mOsm |
T9342 |
6717-6719 |
IN |
denotes |
in |
T9343 |
6720-6724 |
JJ |
denotes |
wild |
T9345 |
6724-6725 |
HYPH |
denotes |
- |
T9344 |
6725-6729 |
NN |
denotes |
type |
T9346 |
6730-6734 |
NNS |
denotes |
mice |
T9347 |
6735-6736 |
-LRB- |
denotes |
( |
T9349 |
6736-6737 |
NN |
denotes |
p |
T9350 |
6738-6739 |
SYM |
denotes |
< |
T9348 |
6740-6745 |
CD |
denotes |
0.001 |
T9351 |
6745-6746 |
-RRB- |
denotes |
) |
T9352 |
6746-6747 |
. |
denotes |
. |
T9353 |
6747-6890 |
sentence |
denotes |
Normally, urine concentration is under the control of the hypothalamus, which, in response to hypovolemia or hypernatremia [21], secretes AVP. |
T9354 |
6748-6756 |
RB |
denotes |
Normally |
T9356 |
6756-6758 |
, |
denotes |
, |
T9357 |
6758-6763 |
NN |
denotes |
urine |
T9358 |
6764-6777 |
NN |
denotes |
concentration |
T9355 |
6778-6780 |
VBZ |
denotes |
is |
T9359 |
6781-6786 |
IN |
denotes |
under |
T9360 |
6787-6790 |
DT |
denotes |
the |
T9361 |
6791-6798 |
NN |
denotes |
control |
T9362 |
6799-6801 |
IN |
denotes |
of |
T9363 |
6802-6805 |
DT |
denotes |
the |
T9364 |
6806-6818 |
NN |
denotes |
hypothalamus |
T9365 |
6818-6820 |
, |
denotes |
, |
T9366 |
6820-6825 |
WDT |
denotes |
which |
T9368 |
6825-6827 |
, |
denotes |
, |
T9369 |
6827-6829 |
IN |
denotes |
in |
T9370 |
6830-6838 |
NN |
denotes |
response |
T9371 |
6839-6841 |
IN |
denotes |
to |
T9372 |
6842-6853 |
NN |
denotes |
hypovolemia |
T9373 |
6854-6856 |
CC |
denotes |
or |
T9374 |
6857-6870 |
NN |
denotes |
hypernatremia |
T9375 |
6871-6872 |
-LRB- |
denotes |
[ |
T9376 |
6872-6874 |
CD |
denotes |
21 |
T9377 |
6874-6875 |
-RRB- |
denotes |
] |
T9378 |
6875-6877 |
, |
denotes |
, |
T9367 |
6877-6885 |
VBZ |
denotes |
secretes |
T9379 |
6886-6889 |
NN |
denotes |
AVP |
T9380 |
6889-6890 |
. |
denotes |
. |
T9381 |
6890-7016 |
sentence |
denotes |
The synthetic AVP analog, 1-deamino-8-D-arginine vasopressin (dDAVP; also called desmopressin), is a potent agonist of AVPR2. |
T9382 |
6891-6894 |
DT |
denotes |
The |
T9384 |
6895-6904 |
JJ |
denotes |
synthetic |
T9385 |
6905-6908 |
NN |
denotes |
AVP |
T9383 |
6909-6915 |
NN |
denotes |
analog |
T9387 |
6915-6917 |
, |
denotes |
, |
T9388 |
6917-6918 |
CD |
denotes |
1 |
T9390 |
6918-6919 |
HYPH |
denotes |
- |
T9389 |
6919-6926 |
NN |
denotes |
deamino |
T9392 |
6926-6927 |
HYPH |
denotes |
- |
T9393 |
6927-6928 |
CD |
denotes |
8 |
T9394 |
6928-6929 |
HYPH |
denotes |
- |
T9395 |
6929-6930 |
NN |
denotes |
D |
T9396 |
6930-6931 |
HYPH |
denotes |
- |
T9391 |
6931-6939 |
NN |
denotes |
arginine |
T9397 |
6940-6951 |
NN |
denotes |
vasopressin |
T9398 |
6952-6953 |
-LRB- |
denotes |
( |
T9399 |
6953-6958 |
NN |
denotes |
dDAVP |
T9400 |
6958-6959 |
: |
denotes |
; |
T9401 |
6960-6964 |
RB |
denotes |
also |
T9402 |
6965-6971 |
VBN |
denotes |
called |
T9403 |
6972-6984 |
NN |
denotes |
desmopressin |
T9404 |
6984-6985 |
-RRB- |
denotes |
) |
T9405 |
6985-6987 |
, |
denotes |
, |
T9386 |
6987-6989 |
VBZ |
denotes |
is |
T9406 |
6990-6991 |
DT |
denotes |
a |
T9408 |
6992-6998 |
JJ |
denotes |
potent |
T9407 |
6999-7006 |
NN |
denotes |
agonist |
T9409 |
7007-7009 |
IN |
denotes |
of |
T9410 |
7010-7015 |
NN |
denotes |
AVPR2 |
T9411 |
7015-7016 |
. |
denotes |
. |
T9412 |
7016-7160 |
sentence |
denotes |
When administered to wild-type mice, dDAVP leads to a dramatic increase in urine concentration, from 1,293 to 5,885 mOsm (4.6-fold; Figure 1D). |
T9413 |
7017-7021 |
WRB |
denotes |
When |
T9414 |
7022-7034 |
VBN |
denotes |
administered |
T9416 |
7035-7037 |
IN |
denotes |
to |
T9417 |
7038-7042 |
JJ |
denotes |
wild |
T9419 |
7042-7043 |
HYPH |
denotes |
- |
T9418 |
7043-7047 |
NN |
denotes |
type |
T9420 |
7048-7052 |
NNS |
denotes |
mice |
T9421 |
7052-7054 |
, |
denotes |
, |
T9422 |
7054-7059 |
NN |
denotes |
dDAVP |
T9415 |
7060-7065 |
VBZ |
denotes |
leads |
T9423 |
7066-7068 |
IN |
denotes |
to |
T9424 |
7069-7070 |
DT |
denotes |
a |
T9426 |
7071-7079 |
JJ |
denotes |
dramatic |
T9425 |
7080-7088 |
NN |
denotes |
increase |
T9427 |
7089-7091 |
IN |
denotes |
in |
T9428 |
7092-7097 |
NN |
denotes |
urine |
T9429 |
7098-7111 |
NN |
denotes |
concentration |
T9430 |
7111-7113 |
, |
denotes |
, |
T9431 |
7113-7117 |
IN |
denotes |
from |
T9432 |
7118-7123 |
CD |
denotes |
1,293 |
T9433 |
7124-7126 |
IN |
denotes |
to |
T9434 |
7127-7132 |
CD |
denotes |
5,885 |
T9435 |
7133-7137 |
NN |
denotes |
mOsm |
T9436 |
7138-7139 |
-LRB- |
denotes |
( |
T9438 |
7139-7147 |
RB |
denotes |
4.6-fold |
T9439 |
7147-7148 |
: |
denotes |
; |
T9437 |
7149-7155 |
NN |
denotes |
Figure |
T9440 |
7156-7158 |
CD |
denotes |
1D |
T9441 |
7158-7159 |
-RRB- |
denotes |
) |
T9442 |
7159-7160 |
. |
denotes |
. |
T9443 |
7160-7432 |
sentence |
denotes |
With similar treatment, mutant mice concentrate their urine to a lesser but still significant extent, from 161 to 470 mOsm (2.9-fold), indicating that these animals are not only unable to concentrate their urine properly but are also defective in their response to dDAVP. |
T9444 |
7161-7165 |
IN |
denotes |
With |
T9446 |
7166-7173 |
JJ |
denotes |
similar |
T9447 |
7174-7183 |
NN |
denotes |
treatment |
T9448 |
7183-7185 |
, |
denotes |
, |
T9449 |
7185-7191 |
NN |
denotes |
mutant |
T9450 |
7192-7196 |
NNS |
denotes |
mice |
T9445 |
7197-7208 |
VBP |
denotes |
concentrate |
T9451 |
7209-7214 |
PRP$ |
denotes |
their |
T9452 |
7215-7220 |
NN |
denotes |
urine |
T9453 |
7221-7223 |
IN |
denotes |
to |
T9454 |
7224-7225 |
DT |
denotes |
a |
T9456 |
7226-7232 |
JJR |
denotes |
lesser |
T9457 |
7233-7236 |
CC |
denotes |
but |
T9458 |
7237-7242 |
RB |
denotes |
still |
T9459 |
7243-7254 |
JJ |
denotes |
significant |
T9455 |
7255-7261 |
NN |
denotes |
extent |
T9460 |
7261-7263 |
, |
denotes |
, |
T9461 |
7263-7267 |
IN |
denotes |
from |
T9462 |
7268-7271 |
CD |
denotes |
161 |
T9463 |
7272-7274 |
IN |
denotes |
to |
T9464 |
7275-7278 |
CD |
denotes |
470 |
T9465 |
7279-7283 |
NN |
denotes |
mOsm |
T9466 |
7284-7285 |
-LRB- |
denotes |
( |
T9467 |
7285-7293 |
RB |
denotes |
2.9-fold |
T9468 |
7293-7294 |
-RRB- |
denotes |
) |
T9469 |
7294-7296 |
, |
denotes |
, |
T9470 |
7296-7306 |
VBG |
denotes |
indicating |
T9471 |
7307-7311 |
IN |
denotes |
that |
T9473 |
7312-7317 |
DT |
denotes |
these |
T9474 |
7318-7325 |
NNS |
denotes |
animals |
T9472 |
7326-7329 |
VBP |
denotes |
are |
T9475 |
7330-7333 |
RB |
denotes |
not |
T9476 |
7334-7338 |
RB |
denotes |
only |
T9477 |
7339-7345 |
JJ |
denotes |
unable |
T9478 |
7346-7348 |
TO |
denotes |
to |
T9479 |
7349-7360 |
VB |
denotes |
concentrate |
T9480 |
7361-7366 |
PRP$ |
denotes |
their |
T9481 |
7367-7372 |
NN |
denotes |
urine |
T9482 |
7373-7381 |
RB |
denotes |
properly |
T9483 |
7382-7385 |
CC |
denotes |
but |
T9484 |
7386-7389 |
VBP |
denotes |
are |
T9485 |
7390-7394 |
RB |
denotes |
also |
T9486 |
7395-7404 |
JJ |
denotes |
defective |
T9487 |
7405-7407 |
IN |
denotes |
in |
T9488 |
7408-7413 |
PRP$ |
denotes |
their |
T9489 |
7414-7422 |
NN |
denotes |
response |
T9490 |
7423-7425 |
IN |
denotes |
to |
T9491 |
7426-7431 |
NN |
denotes |
dDAVP |
T9492 |
7431-7432 |
. |
denotes |
. |
T9493 |
7432-7631 |
sentence |
denotes |
The smaller response to dDAVP indicates some residual activity of the mutant AQP2 channel, which must be sufficient to allow survival of the individual, in contrast to the T126M knock-in mouse [18]. |
T9494 |
7433-7436 |
DT |
denotes |
The |
T9496 |
7437-7444 |
JJR |
denotes |
smaller |
T9495 |
7445-7453 |
NN |
denotes |
response |
T9498 |
7454-7456 |
IN |
denotes |
to |
T9499 |
7457-7462 |
NN |
denotes |
dDAVP |
T9497 |
7463-7472 |
VBZ |
denotes |
indicates |
T9500 |
7473-7477 |
DT |
denotes |
some |
T9502 |
7478-7486 |
JJ |
denotes |
residual |
T9501 |
7487-7495 |
NN |
denotes |
activity |
T9503 |
7496-7498 |
IN |
denotes |
of |
T9504 |
7499-7502 |
DT |
denotes |
the |
T9506 |
7503-7509 |
NN |
denotes |
mutant |
T9507 |
7510-7514 |
NN |
denotes |
AQP2 |
T9505 |
7515-7522 |
NN |
denotes |
channel |
T9508 |
7522-7524 |
, |
denotes |
, |
T9509 |
7524-7529 |
WDT |
denotes |
which |
T9511 |
7530-7534 |
MD |
denotes |
must |
T9510 |
7535-7537 |
VB |
denotes |
be |
T9512 |
7538-7548 |
JJ |
denotes |
sufficient |
T9513 |
7549-7551 |
TO |
denotes |
to |
T9514 |
7552-7557 |
VB |
denotes |
allow |
T9515 |
7558-7566 |
NN |
denotes |
survival |
T9516 |
7567-7569 |
IN |
denotes |
of |
T9517 |
7570-7573 |
DT |
denotes |
the |
T9518 |
7574-7584 |
NN |
denotes |
individual |
T9519 |
7584-7586 |
, |
denotes |
, |
T9520 |
7586-7588 |
IN |
denotes |
in |
T9521 |
7589-7597 |
NN |
denotes |
contrast |
T9522 |
7598-7600 |
IN |
denotes |
to |
T9523 |
7601-7604 |
DT |
denotes |
the |
T9525 |
7605-7610 |
NN |
denotes |
T126M |
T9526 |
7611-7616 |
VB |
denotes |
knock |
T9527 |
7616-7617 |
HYPH |
denotes |
- |
T9528 |
7617-7619 |
RP |
denotes |
in |
T9524 |
7620-7625 |
NN |
denotes |
mouse |
T9529 |
7626-7627 |
-LRB- |
denotes |
[ |
T9530 |
7627-7629 |
CD |
denotes |
18 |
T9531 |
7629-7630 |
-RRB- |
denotes |
] |
T9532 |
7630-7631 |
. |
denotes |
. |
T9533 |
7631-7889 |
sentence |
denotes |
Multiple heterozygous matings yielded 101 animals, which appeared at a ratio of 26:49:26, near the expected Mendelian wild type, heterozygote, and mutant frequencies, respectively, indicating that there is no reduced viability associated with this mutation. |
T9534 |
7632-7640 |
JJ |
denotes |
Multiple |
T9536 |
7641-7653 |
JJ |
denotes |
heterozygous |
T9535 |
7654-7661 |
NNS |
denotes |
matings |
T9537 |
7662-7669 |
VBD |
denotes |
yielded |
T9538 |
7670-7673 |
CD |
denotes |
101 |
T9539 |
7674-7681 |
NNS |
denotes |
animals |
T9540 |
7681-7683 |
, |
denotes |
, |
T9541 |
7683-7688 |
WDT |
denotes |
which |
T9542 |
7689-7697 |
VBD |
denotes |
appeared |
T9543 |
7698-7700 |
IN |
denotes |
at |
T9544 |
7701-7702 |
DT |
denotes |
a |
T9545 |
7703-7708 |
NN |
denotes |
ratio |
T9546 |
7709-7711 |
IN |
denotes |
of |
T9547 |
7712-7714 |
CD |
denotes |
26 |
T9548 |
7714-7715 |
SYM |
denotes |
: |
T9549 |
7715-7717 |
CD |
denotes |
49 |
T9550 |
7717-7718 |
SYM |
denotes |
: |
T9551 |
7718-7720 |
CD |
denotes |
26 |
T9552 |
7720-7722 |
, |
denotes |
, |
T9553 |
7722-7726 |
IN |
denotes |
near |
T9554 |
7727-7730 |
DT |
denotes |
the |
T9556 |
7731-7739 |
VBN |
denotes |
expected |
T9557 |
7740-7749 |
JJ |
denotes |
Mendelian |
T9559 |
7750-7754 |
JJ |
denotes |
wild |
T9558 |
7755-7759 |
NN |
denotes |
type |
T9560 |
7759-7761 |
, |
denotes |
, |
T9561 |
7761-7773 |
NN |
denotes |
heterozygote |
T9562 |
7773-7775 |
, |
denotes |
, |
T9563 |
7775-7778 |
CC |
denotes |
and |
T9564 |
7779-7785 |
NN |
denotes |
mutant |
T9555 |
7786-7797 |
NNS |
denotes |
frequencies |
T9565 |
7797-7799 |
, |
denotes |
, |
T9566 |
7799-7811 |
RB |
denotes |
respectively |
T9567 |
7811-7813 |
, |
denotes |
, |
T9568 |
7813-7823 |
VBG |
denotes |
indicating |
T9569 |
7824-7828 |
IN |
denotes |
that |
T9571 |
7829-7834 |
EX |
denotes |
there |
T9570 |
7835-7837 |
VBZ |
denotes |
is |
T9572 |
7838-7840 |
DT |
denotes |
no |
T9574 |
7841-7848 |
VBN |
denotes |
reduced |
T9573 |
7849-7858 |
NN |
denotes |
viability |
T9575 |
7859-7869 |
VBN |
denotes |
associated |
T9576 |
7870-7874 |
IN |
denotes |
with |
T9577 |
7875-7879 |
DT |
denotes |
this |
T9578 |
7880-7888 |
NN |
denotes |
mutation |
T9579 |
7888-7889 |
. |
denotes |
. |
T9580 |
7889-8072 |
sentence |
denotes |
Other than the increased urine production and water intake, there was no overt phenotype in mutant mice, save distended kidneys, which appeared variably in adult animals (Figure 2A). |
T9581 |
7890-7895 |
JJ |
denotes |
Other |
T9583 |
7896-7900 |
IN |
denotes |
than |
T9584 |
7901-7904 |
DT |
denotes |
the |
T9586 |
7905-7914 |
VBN |
denotes |
increased |
T9587 |
7915-7920 |
NN |
denotes |
urine |
T9585 |
7921-7931 |
NN |
denotes |
production |
T9588 |
7932-7935 |
CC |
denotes |
and |
T9589 |
7936-7941 |
NN |
denotes |
water |
T9590 |
7942-7948 |
NN |
denotes |
intake |
T9591 |
7948-7950 |
, |
denotes |
, |
T9592 |
7950-7955 |
EX |
denotes |
there |
T9582 |
7956-7959 |
VBD |
denotes |
was |
T9593 |
7960-7962 |
DT |
denotes |
no |
T9595 |
7963-7968 |
JJ |
denotes |
overt |
T9594 |
7969-7978 |
NN |
denotes |
phenotype |
T9596 |
7979-7981 |
IN |
denotes |
in |
T9597 |
7982-7988 |
NN |
denotes |
mutant |
T9598 |
7989-7993 |
NNS |
denotes |
mice |
T9599 |
7993-7995 |
, |
denotes |
, |
T9600 |
7995-7999 |
IN |
denotes |
save |
T9601 |
8000-8009 |
JJ |
denotes |
distended |
T9602 |
8010-8017 |
NNS |
denotes |
kidneys |
T9603 |
8017-8019 |
, |
denotes |
, |
T9604 |
8019-8024 |
WDT |
denotes |
which |
T9605 |
8025-8033 |
VBD |
denotes |
appeared |
T9606 |
8034-8042 |
RB |
denotes |
variably |
T9607 |
8043-8045 |
IN |
denotes |
in |
T9608 |
8046-8051 |
JJ |
denotes |
adult |
T9609 |
8052-8059 |
NNS |
denotes |
animals |
T9610 |
8060-8061 |
-LRB- |
denotes |
( |
T9611 |
8061-8067 |
NN |
denotes |
Figure |
T9612 |
8068-8070 |
CD |
denotes |
2A |
T9613 |
8070-8071 |
-RRB- |
denotes |
) |
T9614 |
8071-8072 |
. |
denotes |
. |
T9615 |
8072-8152 |
sentence |
denotes |
Although not specifically measured, mutant mice seem to have a normal lifespan. |
T9616 |
8073-8081 |
IN |
denotes |
Although |
T9618 |
8082-8085 |
RB |
denotes |
not |
T9619 |
8086-8098 |
RB |
denotes |
specifically |
T9617 |
8099-8107 |
VBN |
denotes |
measured |
T9621 |
8107-8109 |
, |
denotes |
, |
T9622 |
8109-8115 |
NN |
denotes |
mutant |
T9623 |
8116-8120 |
NNS |
denotes |
mice |
T9620 |
8121-8125 |
VBP |
denotes |
seem |
T9624 |
8126-8128 |
TO |
denotes |
to |
T9625 |
8129-8133 |
VB |
denotes |
have |
T9626 |
8134-8135 |
DT |
denotes |
a |
T9628 |
8136-8142 |
JJ |
denotes |
normal |
T9627 |
8143-8151 |
NN |
denotes |
lifespan |
T9629 |
8151-8152 |
. |
denotes |
. |
T9630 |
8152-8236 |
sentence |
denotes |
The one animal that was followed lived to 18 mo, typical for animals in our colony. |
T9631 |
8153-8156 |
DT |
denotes |
The |
T9633 |
8157-8160 |
CD |
denotes |
one |
T9632 |
8161-8167 |
NN |
denotes |
animal |
T9635 |
8168-8172 |
WDT |
denotes |
that |
T9637 |
8173-8176 |
VBD |
denotes |
was |
T9636 |
8177-8185 |
VBN |
denotes |
followed |
T9634 |
8186-8191 |
VBN |
denotes |
lived |
T9638 |
8192-8194 |
IN |
denotes |
to |
T9639 |
8195-8197 |
CD |
denotes |
18 |
T9640 |
8198-8200 |
NNS |
denotes |
mo |
T9641 |
8200-8202 |
, |
denotes |
, |
T9642 |
8202-8209 |
JJ |
denotes |
typical |
T9643 |
8210-8213 |
IN |
denotes |
for |
T9644 |
8214-8221 |
NNS |
denotes |
animals |
T9645 |
8222-8224 |
IN |
denotes |
in |
T9646 |
8225-8228 |
PRP$ |
denotes |
our |
T9647 |
8229-8235 |
NN |
denotes |
colony |
T9648 |
8235-8236 |
. |
denotes |
. |
T9649 |
8236-9234 |
sentence |
denotes |
Figure 2 Anatomy and Histology of Mouse Kidneys
(A) Gross anatomy of an affected mouse (8-mo-old male). This shows the enlargement and cystic dilatation of the renal pelvis. There is thinning of the overlying renal parenchyma imparting a translucent appearance to portions of the kidney and collecting system. The bladder is also dilated.
(B) Left kidney from mutant mouse (right) shown in (A) compared to a kidney from an age-sex matched unaffected littermate (left).
(C) Hematoxylin and eosin stained section of ureter from a mutant mouse, showing normal histology despite bloating of the kidney.
(D) Hematoxylin and eosin stained histologic section of a kidney from a 4-wk-old female mutant mouse. The mutant kidney shows marked dilatation of the renal pelvis with blunting of the papilla. There is preservation of the cortex and medulla. Aqp2F204V/F204V mice suffer from severe hydronephrosis (Figure 2A and 2B), presumably as a consequence of an inability to cope with the extreme polyuria. |
T9650 |
9081-9090 |
NN |
denotes |
Aqp2F204V |
T9652 |
9090-9091 |
HYPH |
denotes |
/ |
T9651 |
9091-9096 |
NN |
denotes |
F204V |
T9653 |
9097-9101 |
NNS |
denotes |
mice |
T9654 |
9102-9108 |
VBP |
denotes |
suffer |
T9655 |
9109-9113 |
IN |
denotes |
from |
T9656 |
9114-9120 |
JJ |
denotes |
severe |
T9657 |
9121-9135 |
NN |
denotes |
hydronephrosis |
T9658 |
9136-9137 |
-LRB- |
denotes |
( |
T9660 |
9137-9143 |
NN |
denotes |
Figure |
T9659 |
9144-9146 |
CD |
denotes |
2A |
T9661 |
9147-9150 |
CC |
denotes |
and |
T9662 |
9151-9153 |
CD |
denotes |
2B |
T9663 |
9153-9154 |
-RRB- |
denotes |
) |
T9664 |
9154-9156 |
, |
denotes |
, |
T9665 |
9156-9166 |
RB |
denotes |
presumably |
T9666 |
9167-9169 |
IN |
denotes |
as |
T9667 |
9170-9171 |
DT |
denotes |
a |
T9668 |
9172-9183 |
NN |
denotes |
consequence |
T9669 |
9184-9186 |
IN |
denotes |
of |
T9670 |
9187-9189 |
DT |
denotes |
an |
T9671 |
9190-9199 |
NN |
denotes |
inability |
T9672 |
9200-9202 |
TO |
denotes |
to |
T9673 |
9203-9207 |
VB |
denotes |
cope |
T9674 |
9208-9212 |
IN |
denotes |
with |
T9675 |
9213-9216 |
DT |
denotes |
the |
T9677 |
9217-9224 |
JJ |
denotes |
extreme |
T9676 |
9225-9233 |
NN |
denotes |
polyuria |
T9678 |
9233-9234 |
. |
denotes |
. |
T9679 |
9234-9376 |
sentence |
denotes |
We found distended kidneys in all Aqp2F204V/F204V mice; however, the degree of inflation was variable in affected mice and worsened with age. |
T9680 |
9235-9237 |
PRP |
denotes |
We |
T9681 |
9238-9243 |
VBD |
denotes |
found |
T9683 |
9244-9253 |
JJ |
denotes |
distended |
T9684 |
9254-9261 |
NNS |
denotes |
kidneys |
T9685 |
9262-9264 |
IN |
denotes |
in |
T9686 |
9265-9268 |
DT |
denotes |
all |
T9688 |
9269-9278 |
NN |
denotes |
Aqp2F204V |
T9690 |
9278-9279 |
HYPH |
denotes |
/ |
T9689 |
9279-9284 |
NN |
denotes |
F204V |
T9687 |
9285-9289 |
NNS |
denotes |
mice |
T9691 |
9289-9290 |
: |
denotes |
; |
T9692 |
9291-9298 |
RB |
denotes |
however |
T9693 |
9298-9300 |
, |
denotes |
, |
T9694 |
9300-9303 |
DT |
denotes |
the |
T9695 |
9304-9310 |
NN |
denotes |
degree |
T9696 |
9311-9313 |
IN |
denotes |
of |
T9697 |
9314-9323 |
NN |
denotes |
inflation |
T9682 |
9324-9327 |
VBD |
denotes |
was |
T9698 |
9328-9336 |
JJ |
denotes |
variable |
T9699 |
9337-9339 |
IN |
denotes |
in |
T9700 |
9340-9348 |
VBN |
denotes |
affected |
T9701 |
9349-9353 |
NNS |
denotes |
mice |
T9702 |
9354-9357 |
CC |
denotes |
and |
T9703 |
9358-9366 |
VBD |
denotes |
worsened |
T9704 |
9367-9371 |
IN |
denotes |
with |
T9705 |
9372-9375 |
NN |
denotes |
age |
T9706 |
9375-9376 |
. |
denotes |
. |
T9707 |
9376-9489 |
sentence |
denotes |
Severe hydronephrosis has previously been observed in double Aqp1/Aqp3 knock-out mice [17], and appears at 6 wk. |
T9708 |
9377-9383 |
JJ |
denotes |
Severe |
T9709 |
9384-9398 |
NN |
denotes |
hydronephrosis |
T9711 |
9399-9402 |
VBZ |
denotes |
has |
T9712 |
9403-9413 |
RB |
denotes |
previously |
T9713 |
9414-9418 |
VBN |
denotes |
been |
T9710 |
9419-9427 |
VBN |
denotes |
observed |
T9714 |
9428-9430 |
IN |
denotes |
in |
T9715 |
9431-9437 |
JJ |
denotes |
double |
T9717 |
9438-9442 |
NN |
denotes |
Aqp1 |
T9719 |
9442-9443 |
HYPH |
denotes |
/ |
T9718 |
9443-9447 |
NN |
denotes |
Aqp3 |
T9716 |
9448-9453 |
VB |
denotes |
knock |
T9721 |
9453-9454 |
HYPH |
denotes |
- |
T9722 |
9454-9457 |
RP |
denotes |
out |
T9720 |
9458-9462 |
NNS |
denotes |
mice |
T9723 |
9463-9464 |
-LRB- |
denotes |
[ |
T9724 |
9464-9466 |
CD |
denotes |
17 |
T9725 |
9466-9467 |
-RRB- |
denotes |
] |
T9726 |
9467-9469 |
, |
denotes |
, |
T9727 |
9469-9472 |
CC |
denotes |
and |
T9728 |
9473-9480 |
VBZ |
denotes |
appears |
T9729 |
9481-9483 |
IN |
denotes |
at |
T9730 |
9484-9485 |
CD |
denotes |
6 |
T9731 |
9486-9488 |
NNS |
denotes |
wk |
T9732 |
9488-9489 |
. |
denotes |
. |
T9733 |
9489-9544 |
sentence |
denotes |
Even at 4 wk, Aqp2F204V/F204V mice had hydronephrosis. |
T9734 |
9490-9494 |
RB |
denotes |
Even |
T9735 |
9495-9497 |
IN |
denotes |
at |
T9737 |
9498-9499 |
CD |
denotes |
4 |
T9738 |
9500-9502 |
NNS |
denotes |
wk |
T9739 |
9502-9504 |
, |
denotes |
, |
T9740 |
9504-9513 |
NN |
denotes |
Aqp2F204V |
T9742 |
9513-9514 |
HYPH |
denotes |
/ |
T9741 |
9514-9519 |
NN |
denotes |
F204V |
T9743 |
9520-9524 |
NNS |
denotes |
mice |
T9736 |
9525-9528 |
VBD |
denotes |
had |
T9744 |
9529-9543 |
NN |
denotes |
hydronephrosis |
T9745 |
9543-9544 |
. |
denotes |
. |
T9746 |
9544-9697 |
sentence |
denotes |
Histologic sections from Aqp2F204V/F204V mice demonstrated marked dilatation of the renal pelvis yet normal morphology of the ureter (Figure 2C and 2D). |
T9747 |
9545-9555 |
JJ |
denotes |
Histologic |
T9748 |
9556-9564 |
NNS |
denotes |
sections |
T9750 |
9565-9569 |
IN |
denotes |
from |
T9751 |
9570-9579 |
NN |
denotes |
Aqp2F204V |
T9753 |
9579-9580 |
HYPH |
denotes |
/ |
T9752 |
9580-9585 |
NN |
denotes |
F204V |
T9754 |
9586-9590 |
NNS |
denotes |
mice |
T9749 |
9591-9603 |
VBD |
denotes |
demonstrated |
T9755 |
9604-9610 |
JJ |
denotes |
marked |
T9756 |
9611-9621 |
NN |
denotes |
dilatation |
T9757 |
9622-9624 |
IN |
denotes |
of |
T9758 |
9625-9628 |
DT |
denotes |
the |
T9760 |
9629-9634 |
JJ |
denotes |
renal |
T9759 |
9635-9641 |
NN |
denotes |
pelvis |
T9761 |
9642-9645 |
CC |
denotes |
yet |
T9762 |
9646-9652 |
JJ |
denotes |
normal |
T9763 |
9653-9663 |
NN |
denotes |
morphology |
T9764 |
9664-9666 |
IN |
denotes |
of |
T9765 |
9667-9670 |
DT |
denotes |
the |
T9766 |
9671-9677 |
NN |
denotes |
ureter |
T9767 |
9678-9679 |
-LRB- |
denotes |
( |
T9769 |
9679-9685 |
NN |
denotes |
Figure |
T9768 |
9686-9688 |
CD |
denotes |
2C |
T9770 |
9689-9692 |
CC |
denotes |
and |
T9771 |
9693-9695 |
CD |
denotes |
2D |
T9772 |
9695-9696 |
-RRB- |
denotes |
) |
T9773 |
9696-9697 |
. |
denotes |
. |
T9774 |
9697-9774 |
sentence |
denotes |
In particular, the muscularis propria was neither hypertrophied nor thinned. |
T9775 |
9698-9700 |
IN |
denotes |
In |
T9777 |
9701-9711 |
JJ |
denotes |
particular |
T9778 |
9711-9713 |
, |
denotes |
, |
T9779 |
9713-9716 |
DT |
denotes |
the |
T9781 |
9717-9727 |
NN |
denotes |
muscularis |
T9780 |
9728-9735 |
NN |
denotes |
propria |
T9776 |
9736-9739 |
VBD |
denotes |
was |
T9782 |
9740-9747 |
CC |
denotes |
neither |
T9783 |
9748-9761 |
JJ |
denotes |
hypertrophied |
T9784 |
9762-9765 |
CC |
denotes |
nor |
T9785 |
9766-9773 |
JJ |
denotes |
thinned |
T9786 |
9773-9774 |
. |
denotes |
. |
T9787 |
9774-9893 |
sentence |
denotes |
There was the normal festooned appearance of the urothelium, and this transitional epithelium was of normal thickness. |
T9788 |
9775-9780 |
EX |
denotes |
There |
T9789 |
9781-9784 |
VBD |
denotes |
was |
T9790 |
9785-9788 |
DT |
denotes |
the |
T9792 |
9789-9795 |
JJ |
denotes |
normal |
T9793 |
9796-9805 |
VBN |
denotes |
festooned |
T9791 |
9806-9816 |
NN |
denotes |
appearance |
T9794 |
9817-9819 |
IN |
denotes |
of |
T9795 |
9820-9823 |
DT |
denotes |
the |
T9796 |
9824-9834 |
NN |
denotes |
urothelium |
T9797 |
9834-9836 |
, |
denotes |
, |
T9798 |
9836-9839 |
CC |
denotes |
and |
T9799 |
9840-9844 |
DT |
denotes |
this |
T9801 |
9845-9857 |
JJ |
denotes |
transitional |
T9800 |
9858-9868 |
NN |
denotes |
epithelium |
T9802 |
9869-9872 |
VBD |
denotes |
was |
T9803 |
9873-9875 |
IN |
denotes |
of |
T9804 |
9876-9882 |
JJ |
denotes |
normal |
T9805 |
9883-9892 |
NN |
denotes |
thickness |
T9806 |
9892-9893 |
. |
denotes |
. |
T9807 |
9893-9974 |
sentence |
denotes |
There was thinning of the kidney as measured from renal capsule to renal pelvis. |
T9808 |
9894-9899 |
EX |
denotes |
There |
T9809 |
9900-9903 |
VBD |
denotes |
was |
T9810 |
9904-9912 |
NN |
denotes |
thinning |
T9811 |
9913-9915 |
IN |
denotes |
of |
T9812 |
9916-9919 |
DT |
denotes |
the |
T9813 |
9920-9926 |
NN |
denotes |
kidney |
T9814 |
9927-9929 |
IN |
denotes |
as |
T9815 |
9930-9938 |
VBN |
denotes |
measured |
T9816 |
9939-9943 |
IN |
denotes |
from |
T9817 |
9944-9949 |
JJ |
denotes |
renal |
T9818 |
9950-9957 |
NN |
denotes |
capsule |
T9819 |
9958-9960 |
IN |
denotes |
to |
T9820 |
9961-9966 |
JJ |
denotes |
renal |
T9821 |
9967-9973 |
NN |
denotes |
pelvis |
T9822 |
9973-9974 |
. |
denotes |
. |
T9823 |
9974-10084 |
sentence |
denotes |
However, the morphologic features of the glomeruli and proximal/distal tubules were unremarkable (Figure 2D). |
T9824 |
9975-9982 |
RB |
denotes |
However |
T9826 |
9982-9984 |
, |
denotes |
, |
T9827 |
9984-9987 |
DT |
denotes |
the |
T9829 |
9988-9999 |
JJ |
denotes |
morphologic |
T9828 |
10000-10008 |
NNS |
denotes |
features |
T9830 |
10009-10011 |
IN |
denotes |
of |
T9831 |
10012-10015 |
DT |
denotes |
the |
T9832 |
10016-10025 |
NNS |
denotes |
glomeruli |
T9833 |
10026-10029 |
CC |
denotes |
and |
T9834 |
10030-10038 |
JJ |
denotes |
proximal |
T9836 |
10038-10039 |
HYPH |
denotes |
/ |
T9835 |
10039-10045 |
JJ |
denotes |
distal |
T9837 |
10046-10053 |
NNS |
denotes |
tubules |
T9825 |
10054-10058 |
VBD |
denotes |
were |
T9838 |
10059-10071 |
JJ |
denotes |
unremarkable |
T9839 |
10072-10073 |
-LRB- |
denotes |
( |
T9840 |
10073-10079 |
NN |
denotes |
Figure |
T9841 |
10080-10082 |
CD |
denotes |
2D |
T9842 |
10082-10083 |
-RRB- |
denotes |
) |
T9843 |
10083-10084 |
. |
denotes |
. |
T9844 |
10084-10233 |
sentence |
denotes |
As shown previously [18,22], immunoblotting revealed three different forms of AQP2, due to different degrees and forms of glycosylation (Figure 3A). |
T9845 |
10085-10087 |
IN |
denotes |
As |
T9846 |
10088-10093 |
VBN |
denotes |
shown |
T9848 |
10094-10104 |
RB |
denotes |
previously |
T9849 |
10105-10106 |
-LRB- |
denotes |
[ |
T9851 |
10106-10108 |
CD |
denotes |
18 |
T9852 |
10108-10109 |
, |
denotes |
, |
T9850 |
10109-10111 |
CD |
denotes |
22 |
T9853 |
10111-10112 |
-RRB- |
denotes |
] |
T9854 |
10112-10114 |
, |
denotes |
, |
T9855 |
10114-10128 |
NN |
denotes |
immunoblotting |
T9847 |
10129-10137 |
VBD |
denotes |
revealed |
T9856 |
10138-10143 |
CD |
denotes |
three |
T9858 |
10144-10153 |
JJ |
denotes |
different |
T9857 |
10154-10159 |
NNS |
denotes |
forms |
T9859 |
10160-10162 |
IN |
denotes |
of |
T9860 |
10163-10167 |
NN |
denotes |
AQP2 |
T9861 |
10167-10169 |
, |
denotes |
, |
T9862 |
10169-10172 |
IN |
denotes |
due |
T9863 |
10173-10175 |
IN |
denotes |
to |
T9864 |
10176-10185 |
JJ |
denotes |
different |
T9865 |
10186-10193 |
NNS |
denotes |
degrees |
T9866 |
10194-10197 |
CC |
denotes |
and |
T9867 |
10198-10203 |
NNS |
denotes |
forms |
T9868 |
10204-10206 |
IN |
denotes |
of |
T9869 |
10207-10220 |
NN |
denotes |
glycosylation |
T9870 |
10221-10222 |
-LRB- |
denotes |
( |
T9871 |
10222-10228 |
NN |
denotes |
Figure |
T9872 |
10229-10231 |
CD |
denotes |
3A |
T9873 |
10231-10232 |
-RRB- |
denotes |
) |
T9874 |
10232-10233 |
. |
denotes |
. |
T9875 |
10233-10397 |
sentence |
denotes |
Previous reports have demonstrated that nonglycosylated protein appears as a 29 kDa band, while complex glycosylated protein runs as a smear between 35 and 45 kDa. |
T9876 |
10234-10242 |
JJ |
denotes |
Previous |
T9877 |
10243-10250 |
NNS |
denotes |
reports |
T9879 |
10251-10255 |
VBP |
denotes |
have |
T9878 |
10256-10268 |
VBN |
denotes |
demonstrated |
T9880 |
10269-10273 |
IN |
denotes |
that |
T9882 |
10274-10289 |
JJ |
denotes |
nonglycosylated |
T9883 |
10290-10297 |
NN |
denotes |
protein |
T9881 |
10298-10305 |
VBZ |
denotes |
appears |
T9884 |
10306-10308 |
IN |
denotes |
as |
T9885 |
10309-10310 |
DT |
denotes |
a |
T9887 |
10311-10313 |
CD |
denotes |
29 |
T9888 |
10314-10317 |
NN |
denotes |
kDa |
T9886 |
10318-10322 |
NN |
denotes |
band |
T9889 |
10322-10324 |
, |
denotes |
, |
T9890 |
10324-10329 |
IN |
denotes |
while |
T9892 |
10330-10337 |
JJ |
denotes |
complex |
T9894 |
10338-10350 |
VBN |
denotes |
glycosylated |
T9893 |
10351-10358 |
NN |
denotes |
protein |
T9891 |
10359-10363 |
VBZ |
denotes |
runs |
T9895 |
10364-10366 |
IN |
denotes |
as |
T9896 |
10367-10368 |
DT |
denotes |
a |
T9897 |
10369-10374 |
NN |
denotes |
smear |
T9898 |
10375-10382 |
IN |
denotes |
between |
T9899 |
10383-10385 |
CD |
denotes |
35 |
T9901 |
10386-10389 |
CC |
denotes |
and |
T9902 |
10390-10392 |
CD |
denotes |
45 |
T9900 |
10393-10396 |
NN |
denotes |
kDa |
T9903 |
10396-10397 |
. |
denotes |
. |
T9904 |
10397-10549 |
sentence |
denotes |
A short-lived intermediate form of 31 kDa representing core, high-mannose glycosylation of AQP2 is apparent from pulse-chase labeling experiments [22]. |
T9905 |
10398-10399 |
DT |
denotes |
A |
T9907 |
10400-10405 |
JJ |
denotes |
short |
T9909 |
10405-10406 |
HYPH |
denotes |
- |
T9908 |
10406-10411 |
JJ |
denotes |
lived |
T9910 |
10412-10424 |
JJ |
denotes |
intermediate |
T9906 |
10425-10429 |
NN |
denotes |
form |
T9912 |
10430-10432 |
IN |
denotes |
of |
T9913 |
10433-10435 |
CD |
denotes |
31 |
T9914 |
10436-10439 |
NN |
denotes |
kDa |
T9915 |
10440-10452 |
VBG |
denotes |
representing |
T9916 |
10453-10457 |
NN |
denotes |
core |
T9918 |
10457-10459 |
, |
denotes |
, |
T9919 |
10459-10463 |
JJ |
denotes |
high |
T9921 |
10463-10464 |
HYPH |
denotes |
- |
T9920 |
10464-10471 |
NN |
denotes |
mannose |
T9917 |
10472-10485 |
NN |
denotes |
glycosylation |
T9922 |
10486-10488 |
IN |
denotes |
of |
T9923 |
10489-10493 |
NN |
denotes |
AQP2 |
T9911 |
10494-10496 |
VBZ |
denotes |
is |
T9924 |
10497-10505 |
JJ |
denotes |
apparent |
T9925 |
10506-10510 |
IN |
denotes |
from |
T9926 |
10511-10516 |
NN |
denotes |
pulse |
T9928 |
10516-10517 |
HYPH |
denotes |
- |
T9927 |
10517-10522 |
NN |
denotes |
chase |
T9929 |
10523-10531 |
NN |
denotes |
labeling |
T9930 |
10532-10543 |
NNS |
denotes |
experiments |
T9931 |
10544-10545 |
-LRB- |
denotes |
[ |
T9932 |
10545-10547 |
CD |
denotes |
22 |
T9933 |
10547-10548 |
-RRB- |
denotes |
] |
T9934 |
10548-10549 |
. |
denotes |
. |
T9935 |
10549-10796 |
sentence |
denotes |
Compared to that from the kidneys of wild-type animals, AQP2 from mutant animals was reduced in both the high molecular weight, diffuse form and the lowest molecular weight form, but enriched in the intermediate molecular weight form (Figure 3A). |
T9936 |
10550-10558 |
VBN |
denotes |
Compared |
T9938 |
10559-10561 |
IN |
denotes |
to |
T9939 |
10562-10566 |
DT |
denotes |
that |
T9940 |
10567-10571 |
IN |
denotes |
from |
T9941 |
10572-10575 |
DT |
denotes |
the |
T9942 |
10576-10583 |
NNS |
denotes |
kidneys |
T9943 |
10584-10586 |
IN |
denotes |
of |
T9944 |
10587-10591 |
JJ |
denotes |
wild |
T9946 |
10591-10592 |
HYPH |
denotes |
- |
T9945 |
10592-10596 |
NN |
denotes |
type |
T9947 |
10597-10604 |
NNS |
denotes |
animals |
T9948 |
10604-10606 |
, |
denotes |
, |
T9949 |
10606-10610 |
NN |
denotes |
AQP2 |
T9950 |
10611-10615 |
IN |
denotes |
from |
T9951 |
10616-10622 |
NN |
denotes |
mutant |
T9952 |
10623-10630 |
NNS |
denotes |
animals |
T9953 |
10631-10634 |
VBD |
denotes |
was |
T9937 |
10635-10642 |
VBN |
denotes |
reduced |
T9954 |
10643-10645 |
IN |
denotes |
in |
T9955 |
10646-10650 |
CC |
denotes |
both |
T9957 |
10651-10654 |
DT |
denotes |
the |
T9958 |
10655-10659 |
JJ |
denotes |
high |
T9960 |
10660-10669 |
JJ |
denotes |
molecular |
T9959 |
10670-10676 |
NN |
denotes |
weight |
T9961 |
10676-10678 |
, |
denotes |
, |
T9962 |
10678-10685 |
JJ |
denotes |
diffuse |
T9956 |
10686-10690 |
NN |
denotes |
form |
T9963 |
10691-10694 |
CC |
denotes |
and |
T9964 |
10695-10698 |
DT |
denotes |
the |
T9966 |
10699-10705 |
JJS |
denotes |
lowest |
T9968 |
10706-10715 |
JJ |
denotes |
molecular |
T9967 |
10716-10722 |
NN |
denotes |
weight |
T9965 |
10723-10727 |
NN |
denotes |
form |
T9969 |
10727-10729 |
, |
denotes |
, |
T9970 |
10729-10732 |
CC |
denotes |
but |
T9971 |
10733-10741 |
VBN |
denotes |
enriched |
T9972 |
10742-10744 |
IN |
denotes |
in |
T9973 |
10745-10748 |
DT |
denotes |
the |
T9975 |
10749-10761 |
JJ |
denotes |
intermediate |
T9977 |
10762-10771 |
JJ |
denotes |
molecular |
T9976 |
10772-10778 |
NN |
denotes |
weight |
T9974 |
10779-10783 |
NN |
denotes |
form |
T9978 |
10784-10785 |
-LRB- |
denotes |
( |
T9979 |
10785-10791 |
NN |
denotes |
Figure |
T9980 |
10792-10794 |
CD |
denotes |
3A |
T9981 |
10794-10795 |
-RRB- |
denotes |
) |
T9982 |
10795-10796 |
. |
denotes |
. |
T9983 |
10796-10865 |
sentence |
denotes |
Heterozygous animals showed intermediate amounts of all three forms. |
T9984 |
10797-10809 |
JJ |
denotes |
Heterozygous |
T9985 |
10810-10817 |
NNS |
denotes |
animals |
T9986 |
10818-10824 |
VBD |
denotes |
showed |
T9987 |
10825-10837 |
JJ |
denotes |
intermediate |
T9988 |
10838-10845 |
NNS |
denotes |
amounts |
T9989 |
10846-10848 |
IN |
denotes |
of |
T9990 |
10849-10852 |
DT |
denotes |
all |
T9992 |
10853-10858 |
CD |
denotes |
three |
T9991 |
10859-10864 |
NNS |
denotes |
forms |
T9993 |
10864-10865 |
. |
denotes |
. |
T9994 |
10865-11034 |
sentence |
denotes |
The nature of these glycosylated forms was revealed by digestion with endoglycosidase H, which specifically cleaves mannose-rich carbohydrate from the protein backbone. |
T9995 |
10866-10869 |
DT |
denotes |
The |
T9996 |
10870-10876 |
NN |
denotes |
nature |
T9998 |
10877-10879 |
IN |
denotes |
of |
T9999 |
10880-10885 |
DT |
denotes |
these |
T10001 |
10886-10898 |
VBN |
denotes |
glycosylated |
T10000 |
10899-10904 |
NNS |
denotes |
forms |
T10002 |
10905-10908 |
VBD |
denotes |
was |
T9997 |
10909-10917 |
VBN |
denotes |
revealed |
T10003 |
10918-10920 |
IN |
denotes |
by |
T10004 |
10921-10930 |
NN |
denotes |
digestion |
T10005 |
10931-10935 |
IN |
denotes |
with |
T10006 |
10936-10951 |
NN |
denotes |
endoglycosidase |
T10007 |
10952-10953 |
NN |
denotes |
H |
T10008 |
10953-10955 |
, |
denotes |
, |
T10009 |
10955-10960 |
WDT |
denotes |
which |
T10011 |
10961-10973 |
RB |
denotes |
specifically |
T10010 |
10974-10981 |
VBZ |
denotes |
cleaves |
T10012 |
10982-10989 |
NN |
denotes |
mannose |
T10014 |
10989-10990 |
HYPH |
denotes |
- |
T10013 |
10990-10994 |
JJ |
denotes |
rich |
T10015 |
10995-11007 |
NN |
denotes |
carbohydrate |
T10016 |
11008-11012 |
IN |
denotes |
from |
T10017 |
11013-11016 |
DT |
denotes |
the |
T10019 |
11017-11024 |
NN |
denotes |
protein |
T10018 |
11025-11033 |
NN |
denotes |
backbone |
T10020 |
11033-11034 |
. |
denotes |
. |
T10021 |
11034-11197 |
sentence |
denotes |
Treatment of endogenous AQP2 from kidneys of wild-type, heterozygous, and mutant animals specifically affected the intermediate molecular weight form (Figure 3B). |
T10022 |
11035-11044 |
NN |
denotes |
Treatment |
T10024 |
11045-11047 |
IN |
denotes |
of |
T10025 |
11048-11058 |
JJ |
denotes |
endogenous |
T10026 |
11059-11063 |
NN |
denotes |
AQP2 |
T10027 |
11064-11068 |
IN |
denotes |
from |
T10028 |
11069-11076 |
NNS |
denotes |
kidneys |
T10029 |
11077-11079 |
IN |
denotes |
of |
T10030 |
11080-11084 |
JJ |
denotes |
wild |
T10032 |
11084-11085 |
HYPH |
denotes |
- |
T10031 |
11085-11089 |
NN |
denotes |
type |
T10034 |
11089-11091 |
, |
denotes |
, |
T10035 |
11091-11103 |
JJ |
denotes |
heterozygous |
T10036 |
11103-11105 |
, |
denotes |
, |
T10037 |
11105-11108 |
CC |
denotes |
and |
T10038 |
11109-11115 |
JJ |
denotes |
mutant |
T10033 |
11116-11123 |
NNS |
denotes |
animals |
T10039 |
11124-11136 |
RB |
denotes |
specifically |
T10023 |
11137-11145 |
VBD |
denotes |
affected |
T10040 |
11146-11149 |
DT |
denotes |
the |
T10042 |
11150-11162 |
JJ |
denotes |
intermediate |
T10044 |
11163-11172 |
JJ |
denotes |
molecular |
T10043 |
11173-11179 |
NN |
denotes |
weight |
T10041 |
11180-11184 |
NN |
denotes |
form |
T10045 |
11185-11186 |
-LRB- |
denotes |
( |
T10046 |
11186-11192 |
NN |
denotes |
Figure |
T10047 |
11193-11195 |
CD |
denotes |
3B |
T10048 |
11195-11196 |
-RRB- |
denotes |
) |
T10049 |
11196-11197 |
. |
denotes |
. |
T10050 |
11197-11406 |
sentence |
denotes |
The presence of some mature glycosylated proteins (35–45 kDa) in Aqp2F204V/F204V mice presumably permits their survival compared to Aqp2T126M/T126M mice, and is consistent with a diminished response to dDAVP. |
T10051 |
11198-11201 |
DT |
denotes |
The |
T10052 |
11202-11210 |
NN |
denotes |
presence |
T10054 |
11211-11213 |
IN |
denotes |
of |
T10055 |
11214-11218 |
DT |
denotes |
some |
T10057 |
11219-11225 |
JJ |
denotes |
mature |
T10058 |
11226-11238 |
VBN |
denotes |
glycosylated |
T10056 |
11239-11247 |
NN |
denotes |
proteins |
T10059 |
11248-11249 |
-LRB- |
denotes |
( |
T10061 |
11249-11251 |
CD |
denotes |
35 |
T10063 |
11251-11252 |
SYM |
denotes |
– |
T10062 |
11252-11254 |
CD |
denotes |
45 |
T10060 |
11255-11258 |
NN |
denotes |
kDa |
T10064 |
11258-11259 |
-RRB- |
denotes |
) |
T10065 |
11260-11262 |
IN |
denotes |
in |
T10066 |
11263-11272 |
NN |
denotes |
Aqp2F204V |
T10068 |
11272-11273 |
HYPH |
denotes |
/ |
T10067 |
11273-11278 |
NN |
denotes |
F204V |
T10069 |
11279-11283 |
NNS |
denotes |
mice |
T10070 |
11284-11294 |
RB |
denotes |
presumably |
T10053 |
11295-11302 |
VBZ |
denotes |
permits |
T10071 |
11303-11308 |
PRP$ |
denotes |
their |
T10072 |
11309-11317 |
NN |
denotes |
survival |
T10073 |
11318-11326 |
VBN |
denotes |
compared |
T10074 |
11327-11329 |
IN |
denotes |
to |
T10075 |
11330-11339 |
NN |
denotes |
Aqp2T126M |
T10077 |
11339-11340 |
HYPH |
denotes |
/ |
T10076 |
11340-11345 |
NN |
denotes |
T126M |
T10078 |
11346-11350 |
NNS |
denotes |
mice |
T10079 |
11350-11352 |
, |
denotes |
, |
T10080 |
11352-11355 |
CC |
denotes |
and |
T10081 |
11356-11358 |
VBZ |
denotes |
is |
T10082 |
11359-11369 |
JJ |
denotes |
consistent |
T10083 |
11370-11374 |
IN |
denotes |
with |
T10084 |
11375-11376 |
DT |
denotes |
a |
T10086 |
11377-11387 |
JJ |
denotes |
diminished |
T10085 |
11388-11396 |
NN |
denotes |
response |
T10087 |
11397-11399 |
IN |
denotes |
to |
T10088 |
11400-11405 |
NN |
denotes |
dDAVP |
T10089 |
11405-11406 |
. |
denotes |
. |
T10090 |
11406-12060 |
sentence |
denotes |
Figure 3 Immunoblot Analyses of AQP2 from Mouse Kidneys
(A) Western blot analyses of total kidney membranes from littermate mice. An intermediate form of AQP2 at 31 kDa was identified in kidney membranes from a mutant mouse (Mut) and partially in a heterozygous mouse (Het).
(B) Total kidney membranes were subjected to endoglycosidase H treatment (Endo H) prior to Western blotting. High-mannose (h.m.) glycosylated proteins that have not exited the ER are sensitive to endoglycosidase H digestion. In humans, recessive alleles of Aqp2 are postulated to cause NDI because they do not properly translocate to the apical cell surface in response to AVP. |
T10091 |
11908-11910 |
IN |
denotes |
In |
T10093 |
11911-11917 |
NNS |
denotes |
humans |
T10094 |
11917-11919 |
, |
denotes |
, |
T10095 |
11919-11928 |
JJ |
denotes |
recessive |
T10096 |
11929-11936 |
NNS |
denotes |
alleles |
T10097 |
11937-11939 |
IN |
denotes |
of |
T10098 |
11940-11944 |
NN |
denotes |
Aqp2 |
T10099 |
11945-11948 |
VBP |
denotes |
are |
T10092 |
11949-11959 |
VBN |
denotes |
postulated |
T10100 |
11960-11962 |
TO |
denotes |
to |
T10101 |
11963-11968 |
VB |
denotes |
cause |
T10102 |
11969-11972 |
NN |
denotes |
NDI |
T10103 |
11973-11980 |
IN |
denotes |
because |
T10105 |
11981-11985 |
PRP |
denotes |
they |
T10106 |
11986-11988 |
VBP |
denotes |
do |
T10107 |
11989-11992 |
RB |
denotes |
not |
T10108 |
11993-12001 |
RB |
denotes |
properly |
T10104 |
12002-12013 |
VB |
denotes |
translocate |
T10109 |
12014-12016 |
IN |
denotes |
to |
T10110 |
12017-12020 |
DT |
denotes |
the |
T10112 |
12021-12027 |
JJ |
denotes |
apical |
T10113 |
12028-12032 |
NN |
denotes |
cell |
T10111 |
12033-12040 |
NN |
denotes |
surface |
T10114 |
12041-12043 |
IN |
denotes |
in |
T10115 |
12044-12052 |
NN |
denotes |
response |
T10116 |
12053-12055 |
IN |
denotes |
to |
T10117 |
12056-12059 |
NN |
denotes |
AVP |
T10118 |
12059-12060 |
. |
denotes |
. |
T10119 |
12060-12218 |
sentence |
denotes |
This postulate comes solely from in vitro studies in which mutant Aqp2 cDNAs corresponding to human disease mutations are transfected into kidney cell lines. |
T10120 |
12061-12065 |
DT |
denotes |
This |
T10121 |
12066-12075 |
NN |
denotes |
postulate |
T10122 |
12076-12081 |
VBZ |
denotes |
comes |
T10123 |
12082-12088 |
RB |
denotes |
solely |
T10124 |
12089-12093 |
IN |
denotes |
from |
T10125 |
12094-12096 |
FW |
denotes |
in |
T10126 |
12097-12102 |
FW |
denotes |
vitro |
T10127 |
12103-12110 |
NNS |
denotes |
studies |
T10128 |
12111-12113 |
IN |
denotes |
in |
T10130 |
12114-12119 |
WDT |
denotes |
which |
T10131 |
12120-12126 |
NN |
denotes |
mutant |
T10133 |
12127-12131 |
NN |
denotes |
Aqp2 |
T10132 |
12132-12137 |
NNS |
denotes |
cDNAs |
T10134 |
12138-12151 |
VBG |
denotes |
corresponding |
T10135 |
12152-12154 |
IN |
denotes |
to |
T10136 |
12155-12160 |
JJ |
denotes |
human |
T10138 |
12161-12168 |
NN |
denotes |
disease |
T10137 |
12169-12178 |
NNS |
denotes |
mutations |
T10139 |
12179-12182 |
VBP |
denotes |
are |
T10129 |
12183-12194 |
VBN |
denotes |
transfected |
T10140 |
12195-12199 |
IN |
denotes |
into |
T10141 |
12200-12206 |
NN |
denotes |
kidney |
T10143 |
12207-12211 |
NN |
denotes |
cell |
T10142 |
12212-12217 |
NNS |
denotes |
lines |
T10144 |
12217-12218 |
. |
denotes |
. |
T10145 |
12218-12337 |
sentence |
denotes |
In general, such recessive alleles, when visualized immunocytochemically, fail to localize to AVP-responsive vesicles. |
T10146 |
12219-12221 |
IN |
denotes |
In |
T10148 |
12222-12229 |
JJ |
denotes |
general |
T10149 |
12229-12231 |
, |
denotes |
, |
T10150 |
12231-12235 |
JJ |
denotes |
such |
T10152 |
12236-12245 |
JJ |
denotes |
recessive |
T10151 |
12246-12253 |
NNS |
denotes |
alleles |
T10153 |
12253-12255 |
, |
denotes |
, |
T10154 |
12255-12259 |
WRB |
denotes |
when |
T10155 |
12260-12270 |
VBN |
denotes |
visualized |
T10156 |
12271-12291 |
RB |
denotes |
immunocytochemically |
T10157 |
12291-12293 |
, |
denotes |
, |
T10147 |
12293-12297 |
VBP |
denotes |
fail |
T10158 |
12298-12300 |
TO |
denotes |
to |
T10159 |
12301-12309 |
VB |
denotes |
localize |
T10160 |
12310-12312 |
IN |
denotes |
to |
T10161 |
12313-12316 |
NN |
denotes |
AVP |
T10163 |
12316-12317 |
HYPH |
denotes |
- |
T10162 |
12317-12327 |
JJ |
denotes |
responsive |
T10164 |
12328-12336 |
NNS |
denotes |
vesicles |
T10165 |
12336-12337 |
. |
denotes |
. |
T10166 |
12337-12397 |
sentence |
denotes |
Rather, they get trapped in the endoplasmic reticulum (ER). |
T10167 |
12338-12344 |
RB |
denotes |
Rather |
T10169 |
12344-12346 |
, |
denotes |
, |
T10170 |
12346-12350 |
PRP |
denotes |
they |
T10171 |
12351-12354 |
VBP |
denotes |
get |
T10168 |
12355-12362 |
VBN |
denotes |
trapped |
T10172 |
12363-12365 |
IN |
denotes |
in |
T10173 |
12366-12369 |
DT |
denotes |
the |
T10175 |
12370-12381 |
JJ |
denotes |
endoplasmic |
T10174 |
12382-12391 |
NN |
denotes |
reticulum |
T10176 |
12392-12393 |
-LRB- |
denotes |
( |
T10177 |
12393-12395 |
NN |
denotes |
ER |
T10178 |
12395-12396 |
-RRB- |
denotes |
) |
T10179 |
12396-12397 |
. |
denotes |
. |
T10180 |
12397-12494 |
sentence |
denotes |
Our mouse model of NDI affords the first opportunity to test this hypothesis in a mature animal. |
T10181 |
12398-12401 |
PRP$ |
denotes |
Our |
T10183 |
12402-12407 |
NN |
denotes |
mouse |
T10182 |
12408-12413 |
NN |
denotes |
model |
T10185 |
12414-12416 |
IN |
denotes |
of |
T10186 |
12417-12420 |
NN |
denotes |
NDI |
T10184 |
12421-12428 |
VBZ |
denotes |
affords |
T10187 |
12429-12432 |
DT |
denotes |
the |
T10189 |
12433-12438 |
JJ |
denotes |
first |
T10188 |
12439-12450 |
NN |
denotes |
opportunity |
T10190 |
12451-12453 |
TO |
denotes |
to |
T10191 |
12454-12458 |
VB |
denotes |
test |
T10192 |
12459-12463 |
DT |
denotes |
this |
T10193 |
12464-12474 |
NN |
denotes |
hypothesis |
T10194 |
12475-12477 |
IN |
denotes |
in |
T10195 |
12478-12479 |
DT |
denotes |
a |
T10197 |
12480-12486 |
JJ |
denotes |
mature |
T10196 |
12487-12493 |
NN |
denotes |
animal |
T10198 |
12493-12494 |
. |
denotes |
. |
T10199 |
12494-12664 |
sentence |
denotes |
As shown in Figure 4A (top row of photomicrographs), AQP2 (stained red) normally localized to the subapical region of collecting duct cells in kidneys of wild-type mice. |
T10200 |
12495-12497 |
IN |
denotes |
As |
T10201 |
12498-12503 |
VBN |
denotes |
shown |
T10203 |
12504-12506 |
IN |
denotes |
in |
T10204 |
12507-12513 |
NN |
denotes |
Figure |
T10205 |
12514-12516 |
CD |
denotes |
4A |
T10206 |
12517-12518 |
-LRB- |
denotes |
( |
T10208 |
12518-12521 |
JJ |
denotes |
top |
T10207 |
12522-12525 |
NN |
denotes |
row |
T10209 |
12526-12528 |
IN |
denotes |
of |
T10210 |
12529-12545 |
NNS |
denotes |
photomicrographs |
T10211 |
12545-12546 |
-RRB- |
denotes |
) |
T10212 |
12546-12548 |
, |
denotes |
, |
T10213 |
12548-12552 |
NN |
denotes |
AQP2 |
T10214 |
12553-12554 |
-LRB- |
denotes |
( |
T10215 |
12554-12561 |
VBN |
denotes |
stained |
T10216 |
12562-12565 |
JJ |
denotes |
red |
T10217 |
12565-12566 |
-RRB- |
denotes |
) |
T10218 |
12567-12575 |
RB |
denotes |
normally |
T10202 |
12576-12585 |
VBD |
denotes |
localized |
T10219 |
12586-12588 |
IN |
denotes |
to |
T10220 |
12589-12592 |
DT |
denotes |
the |
T10222 |
12593-12602 |
JJ |
denotes |
subapical |
T10221 |
12603-12609 |
NN |
denotes |
region |
T10223 |
12610-12612 |
IN |
denotes |
of |
T10224 |
12613-12623 |
VBG |
denotes |
collecting |
T10225 |
12624-12628 |
NN |
denotes |
duct |
T10226 |
12629-12634 |
NNS |
denotes |
cells |
T10227 |
12635-12637 |
IN |
denotes |
in |
T10228 |
12638-12645 |
NNS |
denotes |
kidneys |
T10229 |
12646-12648 |
IN |
denotes |
of |
T10230 |
12649-12653 |
JJ |
denotes |
wild |
T10232 |
12653-12654 |
HYPH |
denotes |
- |
T10231 |
12654-12658 |
NN |
denotes |
type |
T10233 |
12659-12663 |
NNS |
denotes |
mice |
T10234 |
12663-12664 |
. |
denotes |
. |
T10235 |
12664-12764 |
sentence |
denotes |
Upon stimulation with dDAVP, AQP2 translocated to or near the cell surface (Figure 4A, second row). |
T10236 |
12665-12669 |
IN |
denotes |
Upon |
T10238 |
12670-12681 |
NN |
denotes |
stimulation |
T10239 |
12682-12686 |
IN |
denotes |
with |
T10240 |
12687-12692 |
NN |
denotes |
dDAVP |
T10241 |
12692-12694 |
, |
denotes |
, |
T10242 |
12694-12698 |
NN |
denotes |
AQP2 |
T10237 |
12699-12711 |
VBD |
denotes |
translocated |
T10243 |
12712-12714 |
IN |
denotes |
to |
T10244 |
12715-12717 |
CC |
denotes |
or |
T10245 |
12718-12722 |
IN |
denotes |
near |
T10246 |
12723-12726 |
DT |
denotes |
the |
T10248 |
12727-12731 |
NN |
denotes |
cell |
T10247 |
12732-12739 |
NN |
denotes |
surface |
T10249 |
12740-12741 |
-LRB- |
denotes |
( |
T10251 |
12741-12747 |
NN |
denotes |
Figure |
T10252 |
12748-12750 |
CD |
denotes |
4A |
T10253 |
12750-12752 |
, |
denotes |
, |
T10254 |
12752-12758 |
JJ |
denotes |
second |
T10250 |
12759-12762 |
NN |
denotes |
row |
T10255 |
12762-12763 |
-RRB- |
denotes |
) |
T10256 |
12763-12764 |
. |
denotes |
. |
T10257 |
12764-12980 |
sentence |
denotes |
In kidneys taken from mutant animals, however, AQP2 was distributed randomly throughout the cell in the basal state (Figure 4A, third row), while AQP3 (green) appropriately localized to the basolateral surface [23]. |
T10258 |
12765-12767 |
IN |
denotes |
In |
T10260 |
12768-12775 |
NNS |
denotes |
kidneys |
T10261 |
12776-12781 |
VBN |
denotes |
taken |
T10262 |
12782-12786 |
IN |
denotes |
from |
T10263 |
12787-12793 |
NN |
denotes |
mutant |
T10264 |
12794-12801 |
NNS |
denotes |
animals |
T10265 |
12801-12803 |
, |
denotes |
, |
T10266 |
12803-12810 |
RB |
denotes |
however |
T10267 |
12810-12812 |
, |
denotes |
, |
T10268 |
12812-12816 |
NN |
denotes |
AQP2 |
T10269 |
12817-12820 |
VBD |
denotes |
was |
T10259 |
12821-12832 |
VBN |
denotes |
distributed |
T10270 |
12833-12841 |
RB |
denotes |
randomly |
T10271 |
12842-12852 |
IN |
denotes |
throughout |
T10272 |
12853-12856 |
DT |
denotes |
the |
T10273 |
12857-12861 |
NN |
denotes |
cell |
T10274 |
12862-12864 |
IN |
denotes |
in |
T10275 |
12865-12868 |
DT |
denotes |
the |
T10277 |
12869-12874 |
JJ |
denotes |
basal |
T10276 |
12875-12880 |
NN |
denotes |
state |
T10278 |
12881-12882 |
-LRB- |
denotes |
( |
T10280 |
12882-12888 |
NN |
denotes |
Figure |
T10281 |
12889-12891 |
CD |
denotes |
4A |
T10282 |
12891-12893 |
, |
denotes |
, |
T10283 |
12893-12898 |
JJ |
denotes |
third |
T10279 |
12899-12902 |
NN |
denotes |
row |
T10284 |
12902-12903 |
-RRB- |
denotes |
) |
T10285 |
12903-12905 |
, |
denotes |
, |
T10286 |
12905-12910 |
IN |
denotes |
while |
T10288 |
12911-12915 |
NN |
denotes |
AQP3 |
T10289 |
12916-12917 |
-LRB- |
denotes |
( |
T10290 |
12917-12922 |
NN |
denotes |
green |
T10291 |
12922-12923 |
-RRB- |
denotes |
) |
T10292 |
12924-12937 |
RB |
denotes |
appropriately |
T10287 |
12938-12947 |
VBD |
denotes |
localized |
T10293 |
12948-12950 |
IN |
denotes |
to |
T10294 |
12951-12954 |
DT |
denotes |
the |
T10296 |
12955-12966 |
JJ |
denotes |
basolateral |
T10295 |
12967-12974 |
NN |
denotes |
surface |
T10297 |
12975-12976 |
-LRB- |
denotes |
[ |
T10298 |
12976-12978 |
CD |
denotes |
23 |
T10299 |
12978-12979 |
-RRB- |
denotes |
] |
T10300 |
12979-12980 |
. |
denotes |
. |
T10301 |
12980-13095 |
sentence |
denotes |
Furthermore, upon dDAVP stimulation, AQP2-F204V failed to translocate to the cell surface (Figure 4A, bottom row). |
T10302 |
12981-12992 |
RB |
denotes |
Furthermore |
T10304 |
12992-12994 |
, |
denotes |
, |
T10305 |
12994-12998 |
IN |
denotes |
upon |
T10306 |
12999-13004 |
NN |
denotes |
dDAVP |
T10307 |
13005-13016 |
NN |
denotes |
stimulation |
T10308 |
13016-13018 |
, |
denotes |
, |
T10309 |
13018-13022 |
NN |
denotes |
AQP2 |
T10311 |
13022-13023 |
HYPH |
denotes |
- |
T10310 |
13023-13028 |
NN |
denotes |
F204V |
T10303 |
13029-13035 |
VBD |
denotes |
failed |
T10312 |
13036-13038 |
TO |
denotes |
to |
T10313 |
13039-13050 |
VB |
denotes |
translocate |
T10314 |
13051-13053 |
IN |
denotes |
to |
T10315 |
13054-13057 |
DT |
denotes |
the |
T10317 |
13058-13062 |
NN |
denotes |
cell |
T10316 |
13063-13070 |
NN |
denotes |
surface |
T10318 |
13071-13072 |
-LRB- |
denotes |
( |
T10320 |
13072-13078 |
NN |
denotes |
Figure |
T10321 |
13079-13081 |
CD |
denotes |
4A |
T10322 |
13081-13083 |
, |
denotes |
, |
T10323 |
13083-13089 |
JJ |
denotes |
bottom |
T10319 |
13090-13093 |
NN |
denotes |
row |
T10324 |
13093-13094 |
-RRB- |
denotes |
) |
T10325 |
13094-13095 |
. |
denotes |
. |
T10326 |
13095-13281 |
sentence |
denotes |
To confirm these findings, the staining was repeated in kidneys taken from two further mice for each class, wild-type or mutant, with or without dDAVP treatment, with identical results. |
T10327 |
13096-13098 |
TO |
denotes |
To |
T10328 |
13099-13106 |
VB |
denotes |
confirm |
T10330 |
13107-13112 |
DT |
denotes |
these |
T10331 |
13113-13121 |
NNS |
denotes |
findings |
T10332 |
13121-13123 |
, |
denotes |
, |
T10333 |
13123-13126 |
DT |
denotes |
the |
T10334 |
13127-13135 |
NN |
denotes |
staining |
T10335 |
13136-13139 |
VBD |
denotes |
was |
T10329 |
13140-13148 |
VBN |
denotes |
repeated |
T10336 |
13149-13151 |
IN |
denotes |
in |
T10337 |
13152-13159 |
NNS |
denotes |
kidneys |
T10338 |
13160-13165 |
VBN |
denotes |
taken |
T10339 |
13166-13170 |
IN |
denotes |
from |
T10340 |
13171-13174 |
CD |
denotes |
two |
T10342 |
13175-13182 |
JJ |
denotes |
further |
T10341 |
13183-13187 |
NNS |
denotes |
mice |
T10343 |
13188-13191 |
IN |
denotes |
for |
T10344 |
13192-13196 |
DT |
denotes |
each |
T10345 |
13197-13202 |
NN |
denotes |
class |
T10346 |
13202-13204 |
, |
denotes |
, |
T10347 |
13204-13208 |
JJ |
denotes |
wild |
T10349 |
13208-13209 |
HYPH |
denotes |
- |
T10348 |
13209-13213 |
NN |
denotes |
type |
T10350 |
13214-13216 |
CC |
denotes |
or |
T10351 |
13217-13223 |
NN |
denotes |
mutant |
T10352 |
13223-13225 |
, |
denotes |
, |
T10353 |
13225-13229 |
IN |
denotes |
with |
T10354 |
13230-13232 |
CC |
denotes |
or |
T10355 |
13233-13240 |
IN |
denotes |
without |
T10356 |
13241-13246 |
NN |
denotes |
dDAVP |
T10357 |
13247-13256 |
NN |
denotes |
treatment |
T10358 |
13256-13258 |
, |
denotes |
, |
T10359 |
13258-13262 |
IN |
denotes |
with |
T10360 |
13263-13272 |
JJ |
denotes |
identical |
T10361 |
13273-13280 |
NNS |
denotes |
results |
T10362 |
13280-13281 |
. |
denotes |
. |
T10363 |
13281-15061 |
sentence |
denotes |
Figure 4 AQP2 Subcellular Localization and Translocation in Mouse Kidney Collecting Ducts and MDCK Cell Lines
(A) Immunohistochemistry on collecting ducts in kidney sections from an AQP2-F204V mutant (Mut) mouse and an age-sex matched wild-type (WT) littermate. Mice were injected intraperitoneally with PBS (NT) or dDAVP before sacrificing and fixation of the kidneys. Kidneys sections were immunostained for AQP2 (red) and the basolateral marker AQP3 (green). The images were merged and an area of the cytoplasm was magnified (zoom). Note that mutant AQP2 is not properly localized to the subapical compartment, nor does it respond to dDAVP.
(B) MDCK cell lines, stably transfected with constructs encoding mouse WT or AQP2-F204V, were treated with and without 150 μM forskolin for 90 min, after which cells were fixed, permeabilized, and subjected to immunocytochemistry. AQP2 is shown in green, and the basolateral marker Na+/K+-ATPase is shown in red, alongside the nuclear stain DAPI. The z-profile images were reconstructed from multiple z-sections, along the dotted line. Mutant AQP2 fails to localize to the cell surface upon forskolin stimulation. Rather, the perinuclear staining is consistent with an ER localization of mutant AQP2.
(C) The MDCK cell line expressing AQP2-F204V was grown on fibronectin-coated coverslips until tight junctions formed, at which point the cells were treated with 150 μM forskolin for 90 min. Cells were fixed, permeabilized, and sequentially immunoblotted for AQP2 (green) and calnexin (red), an ER marker. The merged image shows that AQP2-F204V colocalizes with the endoplasmic reticulum marker. Scale bar refers to 10 μm. To investigate the mechanism of defective translocation of AQP2-F204V, we turned to transfection of MDCK cells. |
T10364 |
14950-14952 |
TO |
denotes |
To |
T10365 |
14953-14964 |
VB |
denotes |
investigate |
T10367 |
14965-14968 |
DT |
denotes |
the |
T10368 |
14969-14978 |
NN |
denotes |
mechanism |
T10369 |
14979-14981 |
IN |
denotes |
of |
T10370 |
14982-14991 |
JJ |
denotes |
defective |
T10371 |
14992-15005 |
NN |
denotes |
translocation |
T10372 |
15006-15008 |
IN |
denotes |
of |
T10373 |
15009-15013 |
NN |
denotes |
AQP2 |
T10375 |
15013-15014 |
HYPH |
denotes |
- |
T10374 |
15014-15019 |
NN |
denotes |
F204V |
T10376 |
15019-15021 |
, |
denotes |
, |
T10377 |
15021-15023 |
PRP |
denotes |
we |
T10366 |
15024-15030 |
VBD |
denotes |
turned |
T10378 |
15031-15033 |
IN |
denotes |
to |
T10379 |
15034-15046 |
NN |
denotes |
transfection |
T10380 |
15047-15049 |
IN |
denotes |
of |
T10381 |
15050-15054 |
NN |
denotes |
MDCK |
T10382 |
15055-15060 |
NNS |
denotes |
cells |
T10383 |
15060-15061 |
. |
denotes |
. |
T10384 |
15061-15144 |
sentence |
denotes |
Stable cell lines expressing mouse wild-type AQP2 and AQP2-F204V were established. |
T10385 |
15062-15068 |
JJ |
denotes |
Stable |
T10387 |
15069-15073 |
NN |
denotes |
cell |
T10386 |
15074-15079 |
NNS |
denotes |
lines |
T10389 |
15080-15090 |
VBG |
denotes |
expressing |
T10390 |
15091-15096 |
NN |
denotes |
mouse |
T10392 |
15097-15101 |
JJ |
denotes |
wild |
T10394 |
15101-15102 |
HYPH |
denotes |
- |
T10393 |
15102-15106 |
NN |
denotes |
type |
T10391 |
15107-15111 |
NN |
denotes |
AQP2 |
T10395 |
15112-15115 |
CC |
denotes |
and |
T10396 |
15116-15120 |
NN |
denotes |
AQP2 |
T10398 |
15120-15121 |
HYPH |
denotes |
- |
T10397 |
15121-15126 |
NN |
denotes |
F204V |
T10399 |
15127-15131 |
VBD |
denotes |
were |
T10388 |
15132-15143 |
VBN |
denotes |
established |
T10400 |
15143-15144 |
. |
denotes |
. |
T10401 |
15144-15300 |
sentence |
denotes |
Immunoblots of protein extracts from stable cell lines showed that MDCK cells recapitulate the glycosylation defect seen in mutant mice (unpublished data). |
T10402 |
15145-15156 |
NNS |
denotes |
Immunoblots |
T10404 |
15157-15159 |
IN |
denotes |
of |
T10405 |
15160-15167 |
NN |
denotes |
protein |
T10406 |
15168-15176 |
NNS |
denotes |
extracts |
T10407 |
15177-15181 |
IN |
denotes |
from |
T10408 |
15182-15188 |
JJ |
denotes |
stable |
T10410 |
15189-15193 |
NN |
denotes |
cell |
T10409 |
15194-15199 |
NNS |
denotes |
lines |
T10403 |
15200-15206 |
VBD |
denotes |
showed |
T10411 |
15207-15211 |
IN |
denotes |
that |
T10413 |
15212-15216 |
NN |
denotes |
MDCK |
T10414 |
15217-15222 |
NNS |
denotes |
cells |
T10412 |
15223-15235 |
VBP |
denotes |
recapitulate |
T10415 |
15236-15239 |
DT |
denotes |
the |
T10417 |
15240-15253 |
NN |
denotes |
glycosylation |
T10416 |
15254-15260 |
NN |
denotes |
defect |
T10418 |
15261-15265 |
VBN |
denotes |
seen |
T10419 |
15266-15268 |
IN |
denotes |
in |
T10420 |
15269-15275 |
NN |
denotes |
mutant |
T10421 |
15276-15280 |
NNS |
denotes |
mice |
T10422 |
15281-15282 |
-LRB- |
denotes |
( |
T10424 |
15282-15293 |
JJ |
denotes |
unpublished |
T10423 |
15294-15298 |
NNS |
denotes |
data |
T10425 |
15298-15299 |
-RRB- |
denotes |
) |
T10426 |
15299-15300 |
. |
denotes |
. |
T10427 |
15300-15366 |
sentence |
denotes |
The wild-type protein was again present in three different forms. |
T10428 |
15301-15304 |
DT |
denotes |
The |
T10430 |
15305-15309 |
JJ |
denotes |
wild |
T10432 |
15309-15310 |
HYPH |
denotes |
- |
T10431 |
15310-15314 |
NN |
denotes |
type |
T10429 |
15315-15322 |
NN |
denotes |
protein |
T10433 |
15323-15326 |
VBD |
denotes |
was |
T10434 |
15327-15332 |
RB |
denotes |
again |
T10435 |
15333-15340 |
JJ |
denotes |
present |
T10436 |
15341-15343 |
IN |
denotes |
in |
T10437 |
15344-15349 |
CD |
denotes |
three |
T10439 |
15350-15359 |
JJ |
denotes |
different |
T10438 |
15360-15365 |
NNS |
denotes |
forms |
T10440 |
15365-15366 |
. |
denotes |
. |
T10441 |
15366-15476 |
sentence |
denotes |
Cells expressing AQP2-F204V lacked the 35–45 kDa form and were enriched in the core-glycosylated 31 kDa form. |
T10442 |
15367-15372 |
NNS |
denotes |
Cells |
T10444 |
15373-15383 |
VBG |
denotes |
expressing |
T10445 |
15384-15388 |
NN |
denotes |
AQP2 |
T10447 |
15388-15389 |
HYPH |
denotes |
- |
T10446 |
15389-15394 |
NN |
denotes |
F204V |
T10443 |
15395-15401 |
VBD |
denotes |
lacked |
T10448 |
15402-15405 |
DT |
denotes |
the |
T10450 |
15406-15408 |
CD |
denotes |
35 |
T10452 |
15408-15409 |
SYM |
denotes |
– |
T10451 |
15409-15411 |
CD |
denotes |
45 |
T10453 |
15412-15415 |
NN |
denotes |
kDa |
T10449 |
15416-15420 |
NN |
denotes |
form |
T10454 |
15421-15424 |
CC |
denotes |
and |
T10455 |
15425-15429 |
VBD |
denotes |
were |
T10456 |
15430-15438 |
VBN |
denotes |
enriched |
T10457 |
15439-15441 |
IN |
denotes |
in |
T10458 |
15442-15445 |
DT |
denotes |
the |
T10460 |
15446-15450 |
NN |
denotes |
core |
T10462 |
15450-15451 |
HYPH |
denotes |
- |
T10461 |
15451-15463 |
VBN |
denotes |
glycosylated |
T10463 |
15464-15466 |
CD |
denotes |
31 |
T10464 |
15467-15470 |
NN |
denotes |
kDa |
T10459 |
15471-15475 |
NN |
denotes |
form |
T10465 |
15475-15476 |
. |
denotes |
. |
T10466 |
15476-15714 |
sentence |
denotes |
In transfected, unstimulated MDCK cells, wild-type AQP2 (stained green) appeared in a punctate pattern distributed throughout the subapical region (Figure 4B, left column photomicrographs), consistent with vesicular compartmentalization. |
T10467 |
15477-15479 |
IN |
denotes |
In |
T10469 |
15480-15491 |
VBN |
denotes |
transfected |
T10471 |
15491-15493 |
, |
denotes |
, |
T10472 |
15493-15505 |
JJ |
denotes |
unstimulated |
T10473 |
15506-15510 |
NN |
denotes |
MDCK |
T10470 |
15511-15516 |
NNS |
denotes |
cells |
T10474 |
15516-15518 |
, |
denotes |
, |
T10475 |
15518-15522 |
JJ |
denotes |
wild |
T10477 |
15522-15523 |
HYPH |
denotes |
- |
T10476 |
15523-15527 |
NN |
denotes |
type |
T10478 |
15528-15532 |
NN |
denotes |
AQP2 |
T10479 |
15533-15534 |
-LRB- |
denotes |
( |
T10480 |
15534-15541 |
VBN |
denotes |
stained |
T10481 |
15542-15547 |
JJ |
denotes |
green |
T10482 |
15547-15548 |
-RRB- |
denotes |
) |
T10468 |
15549-15557 |
VBD |
denotes |
appeared |
T10483 |
15558-15560 |
IN |
denotes |
in |
T10484 |
15561-15562 |
DT |
denotes |
a |
T10486 |
15563-15571 |
NN |
denotes |
punctate |
T10485 |
15572-15579 |
NN |
denotes |
pattern |
T10487 |
15580-15591 |
VBN |
denotes |
distributed |
T10488 |
15592-15602 |
IN |
denotes |
throughout |
T10489 |
15603-15606 |
DT |
denotes |
the |
T10491 |
15607-15616 |
JJ |
denotes |
subapical |
T10490 |
15617-15623 |
NN |
denotes |
region |
T10492 |
15624-15625 |
-LRB- |
denotes |
( |
T10494 |
15625-15631 |
NN |
denotes |
Figure |
T10495 |
15632-15634 |
CD |
denotes |
4B |
T10496 |
15634-15636 |
, |
denotes |
, |
T10497 |
15636-15640 |
JJ |
denotes |
left |
T10498 |
15641-15647 |
NN |
denotes |
column |
T10493 |
15648-15664 |
NNS |
denotes |
photomicrographs |
T10499 |
15664-15665 |
-RRB- |
denotes |
) |
T10500 |
15665-15667 |
, |
denotes |
, |
T10501 |
15667-15677 |
JJ |
denotes |
consistent |
T10502 |
15678-15682 |
IN |
denotes |
with |
T10503 |
15683-15692 |
JJ |
denotes |
vesicular |
T10504 |
15693-15713 |
NN |
denotes |
compartmentalization |
T10505 |
15713-15714 |
. |
denotes |
. |
T10506 |
15714-15819 |
sentence |
denotes |
AQP2-F204V, on the other hand, appeared in a punctate but perinuclear pattern (Figure 4B, third column). |
T10507 |
15715-15719 |
NN |
denotes |
AQP2 |
T10509 |
15719-15720 |
HYPH |
denotes |
- |
T10508 |
15720-15725 |
NN |
denotes |
F204V |
T10511 |
15725-15727 |
, |
denotes |
, |
T10512 |
15727-15729 |
IN |
denotes |
on |
T10513 |
15730-15733 |
DT |
denotes |
the |
T10515 |
15734-15739 |
JJ |
denotes |
other |
T10514 |
15740-15744 |
NN |
denotes |
hand |
T10516 |
15744-15746 |
, |
denotes |
, |
T10510 |
15746-15754 |
VBD |
denotes |
appeared |
T10517 |
15755-15757 |
IN |
denotes |
in |
T10518 |
15758-15759 |
DT |
denotes |
a |
T10520 |
15760-15768 |
NN |
denotes |
punctate |
T10522 |
15769-15772 |
CC |
denotes |
but |
T10521 |
15773-15784 |
JJ |
denotes |
perinuclear |
T10519 |
15785-15792 |
NN |
denotes |
pattern |
T10523 |
15793-15794 |
-LRB- |
denotes |
( |
T10525 |
15794-15800 |
NN |
denotes |
Figure |
T10526 |
15801-15803 |
CD |
denotes |
4B |
T10527 |
15803-15805 |
, |
denotes |
, |
T10528 |
15805-15810 |
JJ |
denotes |
third |
T10524 |
15811-15817 |
NN |
denotes |
column |
T10529 |
15817-15818 |
-RRB- |
denotes |
) |
T10530 |
15818-15819 |
. |
denotes |
. |
T10531 |
15819-15997 |
sentence |
denotes |
Upon stimulation with forskolin, a cAMP-dependent protein kinase activator, wild-type AQP2 translocated to the apical surface of polarized MDCK cells (Figure 4B, second column). |
T10532 |
15820-15824 |
IN |
denotes |
Upon |
T10534 |
15825-15836 |
NN |
denotes |
stimulation |
T10535 |
15837-15841 |
IN |
denotes |
with |
T10536 |
15842-15851 |
NN |
denotes |
forskolin |
T10537 |
15851-15853 |
, |
denotes |
, |
T10538 |
15853-15854 |
DT |
denotes |
a |
T10540 |
15855-15859 |
NN |
denotes |
cAMP |
T10542 |
15859-15860 |
HYPH |
denotes |
- |
T10541 |
15860-15869 |
JJ |
denotes |
dependent |
T10543 |
15870-15877 |
NN |
denotes |
protein |
T10544 |
15878-15884 |
NN |
denotes |
kinase |
T10539 |
15885-15894 |
NN |
denotes |
activator |
T10545 |
15894-15896 |
, |
denotes |
, |
T10546 |
15896-15900 |
JJ |
denotes |
wild |
T10548 |
15900-15901 |
HYPH |
denotes |
- |
T10547 |
15901-15905 |
NN |
denotes |
type |
T10549 |
15906-15910 |
NN |
denotes |
AQP2 |
T10533 |
15911-15923 |
VBD |
denotes |
translocated |
T10550 |
15924-15926 |
IN |
denotes |
to |
T10551 |
15927-15930 |
DT |
denotes |
the |
T10553 |
15931-15937 |
JJ |
denotes |
apical |
T10552 |
15938-15945 |
NN |
denotes |
surface |
T10554 |
15946-15948 |
IN |
denotes |
of |
T10555 |
15949-15958 |
VBN |
denotes |
polarized |
T10557 |
15959-15963 |
NN |
denotes |
MDCK |
T10556 |
15964-15969 |
NNS |
denotes |
cells |
T10558 |
15970-15971 |
-LRB- |
denotes |
( |
T10560 |
15971-15977 |
NN |
denotes |
Figure |
T10561 |
15978-15980 |
CD |
denotes |
4B |
T10562 |
15980-15982 |
, |
denotes |
, |
T10563 |
15982-15988 |
JJ |
denotes |
second |
T10559 |
15989-15995 |
NN |
denotes |
column |
T10564 |
15995-15996 |
-RRB- |
denotes |
) |
T10565 |
15996-15997 |
. |
denotes |
. |
T10566 |
15997-16170 |
sentence |
denotes |
Along the z-axis, the perinuclear distribution of AQP2-F204V was clearly seen, and this distribution is not altered by forskolin (Figure 4B, bottom row, two right columns). |
T10567 |
15998-16003 |
IN |
denotes |
Along |
T10569 |
16004-16007 |
DT |
denotes |
the |
T10571 |
16008-16009 |
NN |
denotes |
z |
T10572 |
16009-16010 |
HYPH |
denotes |
- |
T10570 |
16010-16014 |
NN |
denotes |
axis |
T10573 |
16014-16016 |
, |
denotes |
, |
T10574 |
16016-16019 |
DT |
denotes |
the |
T10576 |
16020-16031 |
JJ |
denotes |
perinuclear |
T10575 |
16032-16044 |
NN |
denotes |
distribution |
T10577 |
16045-16047 |
IN |
denotes |
of |
T10578 |
16048-16052 |
NN |
denotes |
AQP2 |
T10580 |
16052-16053 |
HYPH |
denotes |
- |
T10579 |
16053-16058 |
NN |
denotes |
F204V |
T10581 |
16059-16062 |
VBD |
denotes |
was |
T10582 |
16063-16070 |
RB |
denotes |
clearly |
T10568 |
16071-16075 |
VBN |
denotes |
seen |
T10583 |
16075-16077 |
, |
denotes |
, |
T10584 |
16077-16080 |
CC |
denotes |
and |
T10585 |
16081-16085 |
DT |
denotes |
this |
T10586 |
16086-16098 |
NN |
denotes |
distribution |
T10588 |
16099-16101 |
VBZ |
denotes |
is |
T10589 |
16102-16105 |
RB |
denotes |
not |
T10587 |
16106-16113 |
VBN |
denotes |
altered |
T10590 |
16114-16116 |
IN |
denotes |
by |
T10591 |
16117-16126 |
NN |
denotes |
forskolin |
T10592 |
16127-16128 |
-LRB- |
denotes |
( |
T10594 |
16128-16134 |
NN |
denotes |
Figure |
T10595 |
16135-16137 |
CD |
denotes |
4B |
T10596 |
16137-16139 |
, |
denotes |
, |
T10597 |
16139-16145 |
JJ |
denotes |
bottom |
T10598 |
16146-16149 |
NN |
denotes |
row |
T10599 |
16149-16151 |
, |
denotes |
, |
T10600 |
16151-16154 |
CD |
denotes |
two |
T10601 |
16155-16160 |
JJ |
denotes |
right |
T10593 |
16161-16168 |
NNS |
denotes |
columns |
T10602 |
16168-16169 |
-RRB- |
denotes |
) |
T10603 |
16169-16170 |
. |
denotes |
. |
T10604 |
16170-16260 |
sentence |
denotes |
The perinuclear distribution of AQP2-F204V is consistent with an ER compartmentalization. |
T10605 |
16171-16174 |
DT |
denotes |
The |
T10607 |
16175-16186 |
JJ |
denotes |
perinuclear |
T10606 |
16187-16199 |
NN |
denotes |
distribution |
T10609 |
16200-16202 |
IN |
denotes |
of |
T10610 |
16203-16207 |
NN |
denotes |
AQP2 |
T10612 |
16207-16208 |
HYPH |
denotes |
- |
T10611 |
16208-16213 |
NN |
denotes |
F204V |
T10608 |
16214-16216 |
VBZ |
denotes |
is |
T10613 |
16217-16227 |
JJ |
denotes |
consistent |
T10614 |
16228-16232 |
IN |
denotes |
with |
T10615 |
16233-16235 |
DT |
denotes |
an |
T10617 |
16236-16238 |
NN |
denotes |
ER |
T10616 |
16239-16259 |
NN |
denotes |
compartmentalization |
T10618 |
16259-16260 |
. |
denotes |
. |
T10619 |
16260-16417 |
sentence |
denotes |
To test the idea that AQP2-F204V localizes to the ER, we co-stained cells transfected with Aqp2F204V (cDNA) for AQP2 and an ER marker, calnexin (Figure 4C). |
T10620 |
16261-16263 |
TO |
denotes |
To |
T10621 |
16264-16268 |
VB |
denotes |
test |
T10623 |
16269-16272 |
DT |
denotes |
the |
T10624 |
16273-16277 |
NN |
denotes |
idea |
T10625 |
16278-16282 |
IN |
denotes |
that |
T10627 |
16283-16287 |
NN |
denotes |
AQP2 |
T10629 |
16287-16288 |
HYPH |
denotes |
- |
T10628 |
16288-16293 |
NN |
denotes |
F204V |
T10626 |
16294-16303 |
VBZ |
denotes |
localizes |
T10630 |
16304-16306 |
IN |
denotes |
to |
T10631 |
16307-16310 |
DT |
denotes |
the |
T10632 |
16311-16313 |
NN |
denotes |
ER |
T10633 |
16313-16315 |
, |
denotes |
, |
T10634 |
16315-16317 |
PRP |
denotes |
we |
T10622 |
16318-16328 |
VBD |
denotes |
co-stained |
T10635 |
16329-16334 |
NNS |
denotes |
cells |
T10636 |
16335-16346 |
VBN |
denotes |
transfected |
T10637 |
16347-16351 |
IN |
denotes |
with |
T10638 |
16352-16361 |
NN |
denotes |
Aqp2F204V |
T10639 |
16362-16363 |
-LRB- |
denotes |
( |
T10640 |
16363-16367 |
NN |
denotes |
cDNA |
T10641 |
16367-16368 |
-RRB- |
denotes |
) |
T10642 |
16369-16372 |
IN |
denotes |
for |
T10643 |
16373-16377 |
NN |
denotes |
AQP2 |
T10644 |
16378-16381 |
CC |
denotes |
and |
T10645 |
16382-16384 |
DT |
denotes |
an |
T10647 |
16385-16387 |
NN |
denotes |
ER |
T10646 |
16388-16394 |
NN |
denotes |
marker |
T10648 |
16394-16396 |
, |
denotes |
, |
T10649 |
16396-16404 |
NN |
denotes |
calnexin |
T10650 |
16405-16406 |
-LRB- |
denotes |
( |
T10651 |
16406-16412 |
NN |
denotes |
Figure |
T10652 |
16413-16415 |
CD |
denotes |
4C |
T10653 |
16415-16416 |
-RRB- |
denotes |
) |
T10654 |
16416-16417 |
. |
denotes |
. |
T10655 |
16417-16560 |
sentence |
denotes |
Colocalization of calnexin with AQP2 was investigated directly, and it was found that 80% of all AQP2-F204V protein colocalized with calnexin. |
T10656 |
16418-16432 |
NN |
denotes |
Colocalization |
T10658 |
16433-16435 |
IN |
denotes |
of |
T10659 |
16436-16444 |
NN |
denotes |
calnexin |
T10660 |
16445-16449 |
IN |
denotes |
with |
T10661 |
16450-16454 |
NN |
denotes |
AQP2 |
T10662 |
16455-16458 |
VBD |
denotes |
was |
T10657 |
16459-16471 |
VBN |
denotes |
investigated |
T10663 |
16472-16480 |
RB |
denotes |
directly |
T10664 |
16480-16482 |
, |
denotes |
, |
T10665 |
16482-16485 |
CC |
denotes |
and |
T10666 |
16486-16488 |
PRP |
denotes |
it |
T10668 |
16489-16492 |
VBD |
denotes |
was |
T10667 |
16493-16498 |
VBN |
denotes |
found |
T10669 |
16499-16503 |
IN |
denotes |
that |
T10671 |
16504-16506 |
CD |
denotes |
80 |
T10672 |
16506-16507 |
NN |
denotes |
% |
T10673 |
16508-16510 |
IN |
denotes |
of |
T10674 |
16511-16514 |
DT |
denotes |
all |
T10676 |
16515-16519 |
NN |
denotes |
AQP2 |
T10678 |
16519-16520 |
HYPH |
denotes |
- |
T10677 |
16520-16525 |
NN |
denotes |
F204V |
T10675 |
16526-16533 |
NN |
denotes |
protein |
T10670 |
16534-16545 |
VBD |
denotes |
colocalized |
T10679 |
16546-16550 |
IN |
denotes |
with |
T10680 |
16551-16559 |
NN |
denotes |
calnexin |
T10681 |
16559-16560 |
. |
denotes |
. |
T10682 |
16560-16686 |
sentence |
denotes |
The remaining 20% appeared at the periphery of the ER, representing AQP2-F204V that had potentially progressed beyond the ER. |
T10683 |
16561-16564 |
DT |
denotes |
The |
T10685 |
16565-16574 |
VBG |
denotes |
remaining |
T10686 |
16575-16577 |
CD |
denotes |
20 |
T10684 |
16577-16578 |
NN |
denotes |
% |
T10687 |
16579-16587 |
VBD |
denotes |
appeared |
T10688 |
16588-16590 |
IN |
denotes |
at |
T10689 |
16591-16594 |
DT |
denotes |
the |
T10690 |
16595-16604 |
NN |
denotes |
periphery |
T10691 |
16605-16607 |
IN |
denotes |
of |
T10692 |
16608-16611 |
DT |
denotes |
the |
T10693 |
16612-16614 |
NN |
denotes |
ER |
T10694 |
16614-16616 |
, |
denotes |
, |
T10695 |
16616-16628 |
VBG |
denotes |
representing |
T10696 |
16629-16633 |
NN |
denotes |
AQP2 |
T10698 |
16633-16634 |
HYPH |
denotes |
- |
T10697 |
16634-16639 |
NN |
denotes |
F204V |
T10699 |
16640-16644 |
WDT |
denotes |
that |
T10701 |
16645-16648 |
VBD |
denotes |
had |
T10702 |
16649-16660 |
RB |
denotes |
potentially |
T10700 |
16661-16671 |
VBN |
denotes |
progressed |
T10703 |
16672-16678 |
IN |
denotes |
beyond |
T10704 |
16679-16682 |
DT |
denotes |
the |
T10705 |
16683-16685 |
NN |
denotes |
ER |
T10706 |
16685-16686 |
. |
denotes |
. |
T10707 |
16686-16823 |
sentence |
denotes |
This “ER escape” was consistent with the small proportion of mature, complex glycosylated, AQP2-F204V in mutant kidneys (see Figure 3A). |
T10708 |
16687-16691 |
DT |
denotes |
This |
T10710 |
16692-16693 |
`` |
denotes |
“ |
T10711 |
16693-16695 |
NN |
denotes |
ER |
T10709 |
16696-16702 |
NN |
denotes |
escape |
T10713 |
16702-16703 |
'' |
denotes |
” |
T10712 |
16704-16707 |
VBD |
denotes |
was |
T10714 |
16708-16718 |
JJ |
denotes |
consistent |
T10715 |
16719-16723 |
IN |
denotes |
with |
T10716 |
16724-16727 |
DT |
denotes |
the |
T10718 |
16728-16733 |
JJ |
denotes |
small |
T10717 |
16734-16744 |
NN |
denotes |
proportion |
T10719 |
16745-16747 |
IN |
denotes |
of |
T10720 |
16748-16754 |
JJ |
denotes |
mature |
T10722 |
16754-16756 |
, |
denotes |
, |
T10723 |
16756-16763 |
JJ |
denotes |
complex |
T10724 |
16764-16776 |
VBN |
denotes |
glycosylated |
T10725 |
16776-16778 |
, |
denotes |
, |
T10726 |
16778-16782 |
NN |
denotes |
AQP2 |
T10727 |
16782-16783 |
HYPH |
denotes |
- |
T10721 |
16783-16788 |
NN |
denotes |
F204V |
T10728 |
16789-16791 |
IN |
denotes |
in |
T10729 |
16792-16798 |
NN |
denotes |
mutant |
T10730 |
16799-16806 |
NNS |
denotes |
kidneys |
T10731 |
16807-16808 |
-LRB- |
denotes |
( |
T10732 |
16808-16811 |
VB |
denotes |
see |
T10733 |
16812-16818 |
NN |
denotes |
Figure |
T10734 |
16819-16821 |
CD |
denotes |
3A |
T10735 |
16821-16822 |
-RRB- |
denotes |
) |
T10736 |
16822-16823 |
. |
denotes |
. |
T10737 |
16823-16959 |
sentence |
denotes |
Animals heterozygous for the Aqp2F204V mutation were not affected in their urine production or urine osmolality (see Figure 1C and 1D). |
T10738 |
16824-16831 |
NNS |
denotes |
Animals |
T10740 |
16832-16844 |
JJ |
denotes |
heterozygous |
T10741 |
16845-16848 |
IN |
denotes |
for |
T10742 |
16849-16852 |
DT |
denotes |
the |
T10744 |
16853-16862 |
NN |
denotes |
Aqp2F204V |
T10743 |
16863-16871 |
NN |
denotes |
mutation |
T10745 |
16872-16876 |
VBD |
denotes |
were |
T10746 |
16877-16880 |
RB |
denotes |
not |
T10739 |
16881-16889 |
VBN |
denotes |
affected |
T10747 |
16890-16892 |
IN |
denotes |
in |
T10748 |
16893-16898 |
PRP$ |
denotes |
their |
T10750 |
16899-16904 |
NN |
denotes |
urine |
T10749 |
16905-16915 |
NN |
denotes |
production |
T10751 |
16916-16918 |
CC |
denotes |
or |
T10752 |
16919-16924 |
NN |
denotes |
urine |
T10753 |
16925-16935 |
NN |
denotes |
osmolality |
T10754 |
16936-16937 |
-LRB- |
denotes |
( |
T10755 |
16937-16940 |
VB |
denotes |
see |
T10756 |
16941-16947 |
NN |
denotes |
Figure |
T10757 |
16948-16950 |
CD |
denotes |
1C |
T10758 |
16951-16954 |
CC |
denotes |
and |
T10759 |
16955-16957 |
CD |
denotes |
1D |
T10760 |
16957-16958 |
-RRB- |
denotes |
) |
T10761 |
16958-16959 |
. |
denotes |
. |
T10762 |
16959-17130 |
sentence |
denotes |
It has also been shown that a recessive NDI allele, AQP2-R187C, does not interact with wild-type protein in oocytes [24], nor does it homo-oligomerize in MDCK cells [22]. |
T10763 |
16960-16962 |
PRP |
denotes |
It |
T10765 |
16963-16966 |
VBZ |
denotes |
has |
T10766 |
16967-16971 |
RB |
denotes |
also |
T10767 |
16972-16976 |
VBN |
denotes |
been |
T10764 |
16977-16982 |
VBN |
denotes |
shown |
T10768 |
16983-16987 |
IN |
denotes |
that |
T10770 |
16988-16989 |
DT |
denotes |
a |
T10772 |
16990-16999 |
JJ |
denotes |
recessive |
T10773 |
17000-17003 |
NN |
denotes |
NDI |
T10771 |
17004-17010 |
NN |
denotes |
allele |
T10774 |
17010-17012 |
, |
denotes |
, |
T10775 |
17012-17016 |
NN |
denotes |
AQP2 |
T10777 |
17016-17017 |
HYPH |
denotes |
- |
T10776 |
17017-17022 |
NN |
denotes |
R187C |
T10778 |
17022-17024 |
, |
denotes |
, |
T10779 |
17024-17028 |
VBZ |
denotes |
does |
T10780 |
17029-17032 |
RB |
denotes |
not |
T10769 |
17033-17041 |
VB |
denotes |
interact |
T10781 |
17042-17046 |
IN |
denotes |
with |
T10782 |
17047-17051 |
JJ |
denotes |
wild |
T10784 |
17051-17052 |
HYPH |
denotes |
- |
T10783 |
17052-17056 |
NN |
denotes |
type |
T10785 |
17057-17064 |
NN |
denotes |
protein |
T10786 |
17065-17067 |
IN |
denotes |
in |
T10787 |
17068-17075 |
NNS |
denotes |
oocytes |
T10788 |
17076-17077 |
-LRB- |
denotes |
[ |
T10789 |
17077-17079 |
CD |
denotes |
24 |
T10790 |
17079-17080 |
-RRB- |
denotes |
] |
T10791 |
17080-17082 |
, |
denotes |
, |
T10792 |
17082-17085 |
CC |
denotes |
nor |
T10793 |
17086-17090 |
VBZ |
denotes |
does |
T10795 |
17091-17093 |
PRP |
denotes |
it |
T10794 |
17094-17110 |
VB |
denotes |
homo-oligomerize |
T10796 |
17111-17113 |
IN |
denotes |
in |
T10797 |
17114-17118 |
NN |
denotes |
MDCK |
T10798 |
17119-17124 |
NNS |
denotes |
cells |
T10799 |
17125-17126 |
-LRB- |
denotes |
[ |
T10800 |
17126-17128 |
CD |
denotes |
22 |
T10801 |
17128-17129 |
-RRB- |
denotes |
] |
T10802 |
17129-17130 |
. |
denotes |
. |
T10803 |
17130-17238 |
sentence |
denotes |
Therefore, kidneys from heterozygous animals were examined for evidence of two populations of AQP2 protein. |
T10804 |
17131-17140 |
RB |
denotes |
Therefore |
T10806 |
17140-17142 |
, |
denotes |
, |
T10807 |
17142-17149 |
NNS |
denotes |
kidneys |
T10808 |
17150-17154 |
IN |
denotes |
from |
T10809 |
17155-17167 |
JJ |
denotes |
heterozygous |
T10810 |
17168-17175 |
NNS |
denotes |
animals |
T10811 |
17176-17180 |
VBD |
denotes |
were |
T10805 |
17181-17189 |
VBN |
denotes |
examined |
T10812 |
17190-17193 |
IN |
denotes |
for |
T10813 |
17194-17202 |
NN |
denotes |
evidence |
T10814 |
17203-17205 |
IN |
denotes |
of |
T10815 |
17206-17209 |
CD |
denotes |
two |
T10816 |
17210-17221 |
NNS |
denotes |
populations |
T10817 |
17222-17224 |
IN |
denotes |
of |
T10818 |
17225-17229 |
NN |
denotes |
AQP2 |
T10819 |
17230-17237 |
NN |
denotes |
protein |
T10820 |
17237-17238 |
. |
denotes |
. |
T10821 |
17238-17394 |
sentence |
denotes |
Surprisingly, immunohistochemical staining of kidney collecting ducts from Aqp2F204V/+ mice revealed a pattern remarkably similar to wild type (Figure 5A). |
T10822 |
17239-17251 |
RB |
denotes |
Surprisingly |
T10824 |
17251-17253 |
, |
denotes |
, |
T10825 |
17253-17272 |
JJ |
denotes |
immunohistochemical |
T10826 |
17273-17281 |
NN |
denotes |
staining |
T10827 |
17282-17284 |
IN |
denotes |
of |
T10828 |
17285-17291 |
NN |
denotes |
kidney |
T10830 |
17292-17302 |
VBG |
denotes |
collecting |
T10829 |
17303-17308 |
NNS |
denotes |
ducts |
T10831 |
17309-17313 |
IN |
denotes |
from |
T10832 |
17314-17323 |
NN |
denotes |
Aqp2F204V |
T10834 |
17323-17324 |
HYPH |
denotes |
/ |
T10835 |
17324-17325 |
SYM |
denotes |
+ |
T10833 |
17326-17330 |
NNS |
denotes |
mice |
T10823 |
17331-17339 |
VBD |
denotes |
revealed |
T10836 |
17340-17341 |
DT |
denotes |
a |
T10837 |
17342-17349 |
NN |
denotes |
pattern |
T10838 |
17350-17360 |
RB |
denotes |
remarkably |
T10839 |
17361-17368 |
JJ |
denotes |
similar |
T10840 |
17369-17371 |
IN |
denotes |
to |
T10841 |
17372-17376 |
JJ |
denotes |
wild |
T10842 |
17377-17381 |
NN |
denotes |
type |
T10843 |
17382-17383 |
-LRB- |
denotes |
( |
T10844 |
17383-17389 |
NN |
denotes |
Figure |
T10845 |
17390-17392 |
CD |
denotes |
5A |
T10846 |
17392-17393 |
-RRB- |
denotes |
) |
T10847 |
17393-17394 |
. |
denotes |
. |
T10848 |
17394-17474 |
sentence |
denotes |
AQP2 translocated completely to the apical cell surface upon dDAVP stimulation. |
T10849 |
17395-17399 |
NN |
denotes |
AQP2 |
T10850 |
17400-17412 |
VBD |
denotes |
translocated |
T10851 |
17413-17423 |
RB |
denotes |
completely |
T10852 |
17424-17426 |
IN |
denotes |
to |
T10853 |
17427-17430 |
DT |
denotes |
the |
T10855 |
17431-17437 |
JJ |
denotes |
apical |
T10856 |
17438-17442 |
NN |
denotes |
cell |
T10854 |
17443-17450 |
NN |
denotes |
surface |
T10857 |
17451-17455 |
IN |
denotes |
upon |
T10858 |
17456-17461 |
NN |
denotes |
dDAVP |
T10859 |
17462-17473 |
NN |
denotes |
stimulation |
T10860 |
17473-17474 |
. |
denotes |
. |
T10861 |
17474-17633 |
sentence |
denotes |
This wild-type staining pattern may simply reflect the fact that decreasing the amount of mutant protein by half makes it undetectable by immunocytochemistry. |
T10862 |
17475-17479 |
DT |
denotes |
This |
T10864 |
17480-17484 |
JJ |
denotes |
wild |
T10866 |
17484-17485 |
HYPH |
denotes |
- |
T10865 |
17485-17489 |
NN |
denotes |
type |
T10867 |
17490-17498 |
NN |
denotes |
staining |
T10863 |
17499-17506 |
NN |
denotes |
pattern |
T10869 |
17507-17510 |
MD |
denotes |
may |
T10870 |
17511-17517 |
RB |
denotes |
simply |
T10868 |
17518-17525 |
VB |
denotes |
reflect |
T10871 |
17526-17529 |
DT |
denotes |
the |
T10872 |
17530-17534 |
NN |
denotes |
fact |
T10873 |
17535-17539 |
IN |
denotes |
that |
T10875 |
17540-17550 |
VBG |
denotes |
decreasing |
T10876 |
17551-17554 |
DT |
denotes |
the |
T10877 |
17555-17561 |
NN |
denotes |
amount |
T10878 |
17562-17564 |
IN |
denotes |
of |
T10879 |
17565-17571 |
NN |
denotes |
mutant |
T10880 |
17572-17579 |
NN |
denotes |
protein |
T10881 |
17580-17582 |
IN |
denotes |
by |
T10882 |
17583-17587 |
NN |
denotes |
half |
T10874 |
17588-17593 |
VBZ |
denotes |
makes |
T10883 |
17594-17596 |
PRP |
denotes |
it |
T10884 |
17597-17609 |
JJ |
denotes |
undetectable |
T10885 |
17610-17612 |
IN |
denotes |
by |
T10886 |
17613-17632 |
NN |
denotes |
immunocytochemistry |
T10887 |
17632-17633 |
. |
denotes |
. |
T10888 |
17633-17732 |
sentence |
denotes |
Alternatively, the presence of wild-type protein may alter the localization of the mutant protein. |
T10889 |
17634-17647 |
RB |
denotes |
Alternatively |
T10891 |
17647-17649 |
, |
denotes |
, |
T10892 |
17649-17652 |
DT |
denotes |
the |
T10893 |
17653-17661 |
NN |
denotes |
presence |
T10894 |
17662-17664 |
IN |
denotes |
of |
T10895 |
17665-17669 |
JJ |
denotes |
wild |
T10897 |
17669-17670 |
HYPH |
denotes |
- |
T10896 |
17670-17674 |
NN |
denotes |
type |
T10898 |
17675-17682 |
NN |
denotes |
protein |
T10899 |
17683-17686 |
MD |
denotes |
may |
T10890 |
17687-17692 |
VB |
denotes |
alter |
T10900 |
17693-17696 |
DT |
denotes |
the |
T10901 |
17697-17709 |
NN |
denotes |
localization |
T10902 |
17710-17712 |
IN |
denotes |
of |
T10903 |
17713-17716 |
DT |
denotes |
the |
T10905 |
17717-17723 |
NN |
denotes |
mutant |
T10904 |
17724-17731 |
NN |
denotes |
protein |
T10906 |
17731-17732 |
. |
denotes |
. |
T10907 |
17732-17902 |
sentence |
denotes |
Indeed, Hendriks et al. proposed a “piggy-back” mechanism to explain the transport of nonglycosylated subunits of AQP2 to the cell surface by glycosylated subunits [22]. |
T10908 |
17733-17739 |
RB |
denotes |
Indeed |
T10910 |
17739-17741 |
, |
denotes |
, |
T10911 |
17741-17749 |
NNP |
denotes |
Hendriks |
T10912 |
17750-17752 |
FW |
denotes |
et |
T10913 |
17753-17756 |
FW |
denotes |
al. |
T10909 |
17757-17765 |
VBD |
denotes |
proposed |
T10914 |
17766-17767 |
DT |
denotes |
a |
T10916 |
17768-17769 |
`` |
denotes |
“ |
T10917 |
17769-17774 |
NN |
denotes |
piggy |
T10919 |
17774-17775 |
HYPH |
denotes |
- |
T10918 |
17775-17779 |
NN |
denotes |
back |
T10920 |
17779-17780 |
'' |
denotes |
” |
T10915 |
17781-17790 |
NN |
denotes |
mechanism |
T10921 |
17791-17793 |
TO |
denotes |
to |
T10922 |
17794-17801 |
VB |
denotes |
explain |
T10923 |
17802-17805 |
DT |
denotes |
the |
T10924 |
17806-17815 |
NN |
denotes |
transport |
T10925 |
17816-17818 |
IN |
denotes |
of |
T10926 |
17819-17834 |
JJ |
denotes |
nonglycosylated |
T10927 |
17835-17843 |
NNS |
denotes |
subunits |
T10928 |
17844-17846 |
IN |
denotes |
of |
T10929 |
17847-17851 |
NN |
denotes |
AQP2 |
T10930 |
17852-17854 |
IN |
denotes |
to |
T10931 |
17855-17858 |
DT |
denotes |
the |
T10933 |
17859-17863 |
NN |
denotes |
cell |
T10932 |
17864-17871 |
NN |
denotes |
surface |
T10934 |
17872-17874 |
IN |
denotes |
by |
T10935 |
17875-17887 |
VBN |
denotes |
glycosylated |
T10936 |
17888-17896 |
NNS |
denotes |
subunits |
T10937 |
17897-17898 |
-LRB- |
denotes |
[ |
T10938 |
17898-17900 |
CD |
denotes |
22 |
T10939 |
17900-17901 |
-RRB- |
denotes |
] |
T10940 |
17901-17902 |
. |
denotes |
. |
T10941 |
17902-18067 |
sentence |
denotes |
It has also been shown that wild-type AQP2 protein can rescue a translocation-defective mutant protein, AQP2-P262L, when the two are coexpressed in MDCK cells [25]. |
T10942 |
17903-17905 |
PRP |
denotes |
It |
T10944 |
17906-17909 |
VBZ |
denotes |
has |
T10945 |
17910-17914 |
RB |
denotes |
also |
T10946 |
17915-17919 |
VBN |
denotes |
been |
T10943 |
17920-17925 |
VBN |
denotes |
shown |
T10947 |
17926-17930 |
IN |
denotes |
that |
T10949 |
17931-17935 |
JJ |
denotes |
wild |
T10951 |
17935-17936 |
HYPH |
denotes |
- |
T10950 |
17936-17940 |
NN |
denotes |
type |
T10953 |
17941-17945 |
NN |
denotes |
AQP2 |
T10952 |
17946-17953 |
NN |
denotes |
protein |
T10954 |
17954-17957 |
MD |
denotes |
can |
T10948 |
17958-17964 |
VB |
denotes |
rescue |
T10955 |
17965-17966 |
DT |
denotes |
a |
T10957 |
17967-17980 |
NN |
denotes |
translocation |
T10959 |
17980-17981 |
HYPH |
denotes |
- |
T10958 |
17981-17990 |
JJ |
denotes |
defective |
T10960 |
17991-17997 |
NN |
denotes |
mutant |
T10956 |
17998-18005 |
NN |
denotes |
protein |
T10961 |
18005-18007 |
, |
denotes |
, |
T10962 |
18007-18011 |
NN |
denotes |
AQP2 |
T10964 |
18011-18012 |
HYPH |
denotes |
- |
T10963 |
18012-18017 |
NN |
denotes |
P262L |
T10965 |
18017-18019 |
, |
denotes |
, |
T10966 |
18019-18023 |
WRB |
denotes |
when |
T10968 |
18024-18027 |
DT |
denotes |
the |
T10969 |
18028-18031 |
CD |
denotes |
two |
T10970 |
18032-18035 |
VBP |
denotes |
are |
T10967 |
18036-18047 |
VBN |
denotes |
coexpressed |
T10971 |
18048-18050 |
IN |
denotes |
in |
T10972 |
18051-18055 |
NN |
denotes |
MDCK |
T10973 |
18056-18061 |
NNS |
denotes |
cells |
T10974 |
18062-18063 |
-LRB- |
denotes |
[ |
T10975 |
18063-18065 |
CD |
denotes |
25 |
T10976 |
18065-18066 |
-RRB- |
denotes |
] |
T10977 |
18066-18067 |
. |
denotes |
. |
T10978 |
18067-19830 |
sentence |
denotes |
Figure 5 AQP2-F204V Rescue in Heterozygous Mouse Collecting Ducts and in Cotransfected MDCK Cells
(A) In heterozygous animals, AQP2 localizes and responds to dDAVP normally. Immunohistochemistry was carried out on kidney sections from an Aqp2F204V/+ mouse, after injection with dDAVP. Kidney sections were sequentially immunostained for AQP2 (red) and the basolateral marker AQP3 (green).
(B) Mutant and wild-type AQP2 physically interact. MDCK cells stably expressing wild-type AQP2 were transiently transfected with GFP tagged wild-type AQP2, AQP2-F204V, or GFP alone. Solubilized membranes were immunoprecipitated with a GFP antibody. Total membranes and immunoprecipitates (GFP-IP) were Western blotted using an antibody against AQP2 (arrow) or AQP2-GFP fusions (arrowhead).
(C) Wild-type AQP2 rescues the localization defect of mutant AQP2. GFP fusions of either wild-type AQP2 (WT-GFP, top photomicrographs) or F204V AQP2 (F204V-GFP, bottom photomicrographs) were expressed in polarized MDCK stable cell lines expressing vector alone (vector, left photomicrographs) or AQP2-WT (right photomicrographs). Cells were stimulated with forskolin, processed for immunocytochemistry, and used to generate z-sectional images.
(D) Mutant AQP2 is present at the cell surface in cells coexpressing wild-type AQP2 (AQP2-WT). GFP fused to AQP2-F204V was expressed in MDCK cells expressing wild-type AQP2 or vector alone. Cells were stimulated with forskolin, and cell surface biotinylated proteins were precipitated then analyzed for the presence of wild-type AQP2 (arrow) and AQP2-F204V (arrowhead) by Western blot. In the collecting ducts from Aqp2F204V/+ mice, the wild type may rescue the mutant protein as suggested by the subcellular distribution of AQP2 protein. |
T10979 |
19678-19680 |
IN |
denotes |
In |
T10981 |
19681-19684 |
DT |
denotes |
the |
T10983 |
19685-19695 |
VBG |
denotes |
collecting |
T10982 |
19696-19701 |
NNS |
denotes |
ducts |
T10984 |
19702-19706 |
IN |
denotes |
from |
T10985 |
19707-19716 |
NN |
denotes |
Aqp2F204V |
T10987 |
19716-19717 |
HYPH |
denotes |
/ |
T10988 |
19717-19718 |
SYM |
denotes |
+ |
T10986 |
19719-19723 |
NNS |
denotes |
mice |
T10989 |
19723-19725 |
, |
denotes |
, |
T10990 |
19725-19728 |
DT |
denotes |
the |
T10992 |
19729-19733 |
JJ |
denotes |
wild |
T10991 |
19734-19738 |
NN |
denotes |
type |
T10993 |
19739-19742 |
MD |
denotes |
may |
T10980 |
19743-19749 |
VB |
denotes |
rescue |
T10994 |
19750-19753 |
DT |
denotes |
the |
T10996 |
19754-19760 |
NN |
denotes |
mutant |
T10995 |
19761-19768 |
NN |
denotes |
protein |
T10997 |
19769-19771 |
IN |
denotes |
as |
T10998 |
19772-19781 |
VBN |
denotes |
suggested |
T10999 |
19782-19784 |
IN |
denotes |
by |
T11000 |
19785-19788 |
DT |
denotes |
the |
T11002 |
19789-19800 |
JJ |
denotes |
subcellular |
T11001 |
19801-19813 |
NN |
denotes |
distribution |
T11003 |
19814-19816 |
IN |
denotes |
of |
T11004 |
19817-19821 |
NN |
denotes |
AQP2 |
T11005 |
19822-19829 |
NN |
denotes |
protein |
T11006 |
19829-19830 |
. |
denotes |
. |
T11007 |
19830-19961 |
sentence |
denotes |
To test this idea, we first looked for an interaction between mutant and wild-type proteins in transfected MDCK cells (Figure 5B). |
T11008 |
19831-19833 |
TO |
denotes |
To |
T11009 |
19834-19838 |
VB |
denotes |
test |
T11011 |
19839-19843 |
DT |
denotes |
this |
T11012 |
19844-19848 |
NN |
denotes |
idea |
T11013 |
19848-19850 |
, |
denotes |
, |
T11014 |
19850-19852 |
PRP |
denotes |
we |
T11015 |
19853-19858 |
RB |
denotes |
first |
T11010 |
19859-19865 |
VBD |
denotes |
looked |
T11016 |
19866-19869 |
IN |
denotes |
for |
T11017 |
19870-19872 |
DT |
denotes |
an |
T11018 |
19873-19884 |
NN |
denotes |
interaction |
T11019 |
19885-19892 |
IN |
denotes |
between |
T11020 |
19893-19899 |
NN |
denotes |
mutant |
T11022 |
19900-19903 |
CC |
denotes |
and |
T11023 |
19904-19908 |
JJ |
denotes |
wild |
T11025 |
19908-19909 |
HYPH |
denotes |
- |
T11024 |
19909-19913 |
NN |
denotes |
type |
T11021 |
19914-19922 |
NN |
denotes |
proteins |
T11026 |
19923-19925 |
IN |
denotes |
in |
T11027 |
19926-19937 |
VBN |
denotes |
transfected |
T11029 |
19938-19942 |
NN |
denotes |
MDCK |
T11028 |
19943-19948 |
NNS |
denotes |
cells |
T11030 |
19949-19950 |
-LRB- |
denotes |
( |
T11031 |
19950-19956 |
NN |
denotes |
Figure |
T11032 |
19957-19959 |
CD |
denotes |
5B |
T11033 |
19959-19960 |
-RRB- |
denotes |
) |
T11034 |
19960-19961 |
. |
denotes |
. |
T11035 |
19961-20127 |
sentence |
denotes |
MDCK cells stably expressing wild-type AQP2 were transiently transfected with GFP expression constructs encoding GFP-tagged wild-type AQP2, AQP2-F204V, or GFP alone. |
T11036 |
19962-19966 |
NN |
denotes |
MDCK |
T11037 |
19967-19972 |
NNS |
denotes |
cells |
T11039 |
19973-19979 |
RB |
denotes |
stably |
T11040 |
19980-19990 |
VBG |
denotes |
expressing |
T11041 |
19991-19995 |
JJ |
denotes |
wild |
T11043 |
19995-19996 |
HYPH |
denotes |
- |
T11042 |
19996-20000 |
NN |
denotes |
type |
T11044 |
20001-20005 |
NN |
denotes |
AQP2 |
T11045 |
20006-20010 |
VBD |
denotes |
were |
T11046 |
20011-20022 |
RB |
denotes |
transiently |
T11038 |
20023-20034 |
VBN |
denotes |
transfected |
T11047 |
20035-20039 |
IN |
denotes |
with |
T11048 |
20040-20043 |
NN |
denotes |
GFP |
T11050 |
20044-20054 |
NN |
denotes |
expression |
T11049 |
20055-20065 |
NNS |
denotes |
constructs |
T11051 |
20066-20074 |
VBG |
denotes |
encoding |
T11052 |
20075-20078 |
NN |
denotes |
GFP |
T11054 |
20078-20079 |
HYPH |
denotes |
- |
T11053 |
20079-20085 |
VBN |
denotes |
tagged |
T11056 |
20086-20090 |
JJ |
denotes |
wild |
T11058 |
20090-20091 |
HYPH |
denotes |
- |
T11057 |
20091-20095 |
NN |
denotes |
type |
T11055 |
20096-20100 |
NN |
denotes |
AQP2 |
T11059 |
20100-20102 |
, |
denotes |
, |
T11060 |
20102-20106 |
NN |
denotes |
AQP2 |
T11062 |
20106-20107 |
HYPH |
denotes |
- |
T11061 |
20107-20112 |
NN |
denotes |
F204V |
T11063 |
20112-20114 |
, |
denotes |
, |
T11064 |
20114-20116 |
CC |
denotes |
or |
T11065 |
20117-20120 |
NN |
denotes |
GFP |
T11066 |
20121-20126 |
RB |
denotes |
alone |
T11067 |
20126-20127 |
. |
denotes |
. |
T11068 |
20127-20377 |
sentence |
denotes |
Antibodies against GFP coimmunoprecipitated wild-type AQP2 when AQP2-GFP or AQP2-F204V-GFP was transiently transfected, but not when GFP by itself was transiently transfected into MDCK cells stably expressing wild-type AQP2 (Figure 5B, upper blots). |
T11069 |
20128-20138 |
NNS |
denotes |
Antibodies |
T11071 |
20139-20146 |
IN |
denotes |
against |
T11072 |
20147-20150 |
NN |
denotes |
GFP |
T11070 |
20151-20171 |
VBD |
denotes |
coimmunoprecipitated |
T11073 |
20172-20176 |
JJ |
denotes |
wild |
T11075 |
20176-20177 |
HYPH |
denotes |
- |
T11074 |
20177-20181 |
NN |
denotes |
type |
T11076 |
20182-20186 |
NN |
denotes |
AQP2 |
T11077 |
20187-20191 |
WRB |
denotes |
when |
T11079 |
20192-20196 |
NN |
denotes |
AQP2 |
T11081 |
20196-20197 |
HYPH |
denotes |
- |
T11080 |
20197-20200 |
NN |
denotes |
GFP |
T11082 |
20201-20203 |
CC |
denotes |
or |
T11083 |
20204-20208 |
NN |
denotes |
AQP2 |
T11085 |
20208-20209 |
HYPH |
denotes |
- |
T11086 |
20209-20214 |
NN |
denotes |
F204V |
T11087 |
20214-20215 |
HYPH |
denotes |
- |
T11084 |
20215-20218 |
NN |
denotes |
GFP |
T11088 |
20219-20222 |
VBD |
denotes |
was |
T11089 |
20223-20234 |
RB |
denotes |
transiently |
T11078 |
20235-20246 |
VBN |
denotes |
transfected |
T11090 |
20246-20248 |
, |
denotes |
, |
T11091 |
20248-20251 |
CC |
denotes |
but |
T11092 |
20252-20255 |
RB |
denotes |
not |
T11093 |
20256-20260 |
WRB |
denotes |
when |
T11095 |
20261-20264 |
NN |
denotes |
GFP |
T11096 |
20265-20267 |
IN |
denotes |
by |
T11097 |
20268-20274 |
PRP |
denotes |
itself |
T11098 |
20275-20278 |
VBD |
denotes |
was |
T11099 |
20279-20290 |
RB |
denotes |
transiently |
T11094 |
20291-20302 |
VBN |
denotes |
transfected |
T11100 |
20303-20307 |
IN |
denotes |
into |
T11101 |
20308-20312 |
NN |
denotes |
MDCK |
T11102 |
20313-20318 |
NNS |
denotes |
cells |
T11103 |
20319-20325 |
RB |
denotes |
stably |
T11104 |
20326-20336 |
VBG |
denotes |
expressing |
T11105 |
20337-20341 |
JJ |
denotes |
wild |
T11107 |
20341-20342 |
HYPH |
denotes |
- |
T11106 |
20342-20346 |
NN |
denotes |
type |
T11108 |
20347-20351 |
NN |
denotes |
AQP2 |
T11109 |
20352-20353 |
-LRB- |
denotes |
( |
T11111 |
20353-20359 |
NN |
denotes |
Figure |
T11112 |
20360-20362 |
CD |
denotes |
5B |
T11113 |
20362-20364 |
, |
denotes |
, |
T11114 |
20364-20369 |
JJ |
denotes |
upper |
T11110 |
20370-20375 |
NNS |
denotes |
blots |
T11115 |
20375-20376 |
-RRB- |
denotes |
) |
T11116 |
20376-20377 |
. |
denotes |
. |
T11117 |
20377-20507 |
sentence |
denotes |
Western blot of total membranes showed that wild-type AQP2 is equivalently expressed in all three cases (Figure 5B, lower blots). |
T11118 |
20378-20385 |
NNP |
denotes |
Western |
T11119 |
20386-20390 |
NN |
denotes |
blot |
T11121 |
20391-20393 |
IN |
denotes |
of |
T11122 |
20394-20399 |
JJ |
denotes |
total |
T11123 |
20400-20409 |
NNS |
denotes |
membranes |
T11120 |
20410-20416 |
VBD |
denotes |
showed |
T11124 |
20417-20421 |
IN |
denotes |
that |
T11126 |
20422-20426 |
JJ |
denotes |
wild |
T11128 |
20426-20427 |
HYPH |
denotes |
- |
T11127 |
20427-20431 |
NN |
denotes |
type |
T11129 |
20432-20436 |
NN |
denotes |
AQP2 |
T11130 |
20437-20439 |
VBZ |
denotes |
is |
T11131 |
20440-20452 |
RB |
denotes |
equivalently |
T11125 |
20453-20462 |
VBN |
denotes |
expressed |
T11132 |
20463-20465 |
IN |
denotes |
in |
T11133 |
20466-20469 |
DT |
denotes |
all |
T11135 |
20470-20475 |
CD |
denotes |
three |
T11134 |
20476-20481 |
NNS |
denotes |
cases |
T11136 |
20482-20483 |
-LRB- |
denotes |
( |
T11138 |
20483-20489 |
NN |
denotes |
Figure |
T11139 |
20490-20492 |
CD |
denotes |
5B |
T11140 |
20492-20494 |
, |
denotes |
, |
T11141 |
20494-20499 |
JJ |
denotes |
lower |
T11137 |
20500-20505 |
NNS |
denotes |
blots |
T11142 |
20505-20506 |
-RRB- |
denotes |
) |
T11143 |
20506-20507 |
. |
denotes |
. |
T11144 |
20507-20653 |
sentence |
denotes |
If wild-type and mutant proteins are indeed interacting in the cell, is this interaction sufficient to rescue the localization of mutant protein? |
T11145 |
20508-20510 |
IN |
denotes |
If |
T11147 |
20511-20515 |
JJ |
denotes |
wild |
T11149 |
20515-20516 |
HYPH |
denotes |
- |
T11148 |
20516-20520 |
NN |
denotes |
type |
T11151 |
20521-20524 |
CC |
denotes |
and |
T11152 |
20525-20531 |
NN |
denotes |
mutant |
T11150 |
20532-20540 |
NN |
denotes |
proteins |
T11153 |
20541-20544 |
VBP |
denotes |
are |
T11154 |
20545-20551 |
RB |
denotes |
indeed |
T11146 |
20552-20563 |
VBG |
denotes |
interacting |
T11156 |
20564-20566 |
IN |
denotes |
in |
T11157 |
20567-20570 |
DT |
denotes |
the |
T11158 |
20571-20575 |
NN |
denotes |
cell |
T11159 |
20575-20577 |
, |
denotes |
, |
T11155 |
20577-20579 |
VBZ |
denotes |
is |
T11160 |
20580-20584 |
DT |
denotes |
this |
T11161 |
20585-20596 |
NN |
denotes |
interaction |
T11162 |
20597-20607 |
JJ |
denotes |
sufficient |
T11163 |
20608-20610 |
TO |
denotes |
to |
T11164 |
20611-20617 |
VB |
denotes |
rescue |
T11165 |
20618-20621 |
DT |
denotes |
the |
T11166 |
20622-20634 |
NN |
denotes |
localization |
T11167 |
20635-20637 |
IN |
denotes |
of |
T11168 |
20638-20644 |
NN |
denotes |
mutant |
T11169 |
20645-20652 |
NN |
denotes |
protein |
T11170 |
20652-20653 |
. |
denotes |
? |
T11171 |
20653-20776 |
sentence |
denotes |
To answer this question, we used MDCK cells stably transfected with wild-type AQP2 expressing vector or with empty vector. |
T11172 |
20654-20656 |
TO |
denotes |
To |
T11173 |
20657-20663 |
VB |
denotes |
answer |
T11175 |
20664-20668 |
DT |
denotes |
this |
T11176 |
20669-20677 |
NN |
denotes |
question |
T11177 |
20677-20679 |
, |
denotes |
, |
T11178 |
20679-20681 |
PRP |
denotes |
we |
T11174 |
20682-20686 |
VBD |
denotes |
used |
T11179 |
20687-20691 |
NN |
denotes |
MDCK |
T11180 |
20692-20697 |
NNS |
denotes |
cells |
T11181 |
20698-20704 |
RB |
denotes |
stably |
T11182 |
20705-20716 |
VBN |
denotes |
transfected |
T11183 |
20717-20721 |
IN |
denotes |
with |
T11184 |
20722-20726 |
JJ |
denotes |
wild |
T11186 |
20726-20727 |
HYPH |
denotes |
- |
T11185 |
20727-20731 |
NN |
denotes |
type |
T11187 |
20732-20736 |
NN |
denotes |
AQP2 |
T11188 |
20737-20747 |
VBG |
denotes |
expressing |
T11189 |
20748-20754 |
NN |
denotes |
vector |
T11190 |
20755-20757 |
CC |
denotes |
or |
T11191 |
20758-20762 |
IN |
denotes |
with |
T11192 |
20763-20768 |
JJ |
denotes |
empty |
T11193 |
20769-20775 |
NN |
denotes |
vector |
T11194 |
20775-20776 |
. |
denotes |
. |
T11195 |
20776-20870 |
sentence |
denotes |
On top of these, we transiently transfected AQP2-GFP or AQP2-F204V-GFP expression constructs. |
T11196 |
20777-20779 |
IN |
denotes |
On |
T11198 |
20780-20783 |
NN |
denotes |
top |
T11199 |
20784-20786 |
IN |
denotes |
of |
T11200 |
20787-20792 |
DT |
denotes |
these |
T11201 |
20792-20794 |
, |
denotes |
, |
T11202 |
20794-20796 |
PRP |
denotes |
we |
T11203 |
20797-20808 |
RB |
denotes |
transiently |
T11197 |
20809-20820 |
VBD |
denotes |
transfected |
T11204 |
20821-20825 |
NN |
denotes |
AQP2 |
T11206 |
20825-20826 |
HYPH |
denotes |
- |
T11205 |
20826-20829 |
NN |
denotes |
GFP |
T11208 |
20830-20832 |
CC |
denotes |
or |
T11209 |
20833-20837 |
NN |
denotes |
AQP2 |
T11211 |
20837-20838 |
HYPH |
denotes |
- |
T11212 |
20838-20843 |
NN |
denotes |
F204V |
T11213 |
20843-20844 |
HYPH |
denotes |
- |
T11210 |
20844-20847 |
NN |
denotes |
GFP |
T11214 |
20848-20858 |
NN |
denotes |
expression |
T11207 |
20859-20869 |
NNS |
denotes |
constructs |
T11215 |
20869-20870 |
. |
denotes |
. |
T11216 |
20870-21086 |
sentence |
denotes |
AQP2-GFP localized to the apical surface upon forskolin stimulation whether it was transiently transfected into vector-only cells (Figure 5C, upper left images) or into wild-type AQP2 cells (Figure 5C, upper right). |
T11217 |
20871-20875 |
NN |
denotes |
AQP2 |
T11219 |
20875-20876 |
HYPH |
denotes |
- |
T11218 |
20876-20879 |
NN |
denotes |
GFP |
T11220 |
20880-20889 |
VBD |
denotes |
localized |
T11221 |
20890-20892 |
IN |
denotes |
to |
T11222 |
20893-20896 |
DT |
denotes |
the |
T11224 |
20897-20903 |
JJ |
denotes |
apical |
T11223 |
20904-20911 |
NN |
denotes |
surface |
T11225 |
20912-20916 |
IN |
denotes |
upon |
T11226 |
20917-20926 |
NN |
denotes |
forskolin |
T11227 |
20927-20938 |
NN |
denotes |
stimulation |
T11228 |
20939-20946 |
IN |
denotes |
whether |
T11230 |
20947-20949 |
PRP |
denotes |
it |
T11231 |
20950-20953 |
VBD |
denotes |
was |
T11232 |
20954-20965 |
RB |
denotes |
transiently |
T11229 |
20966-20977 |
VBN |
denotes |
transfected |
T11233 |
20978-20982 |
IN |
denotes |
into |
T11234 |
20983-20989 |
NN |
denotes |
vector |
T11236 |
20989-20990 |
HYPH |
denotes |
- |
T11235 |
20990-20994 |
JJ |
denotes |
only |
T11237 |
20995-21000 |
NNS |
denotes |
cells |
T11238 |
21001-21002 |
-LRB- |
denotes |
( |
T11240 |
21002-21008 |
NN |
denotes |
Figure |
T11241 |
21009-21011 |
CD |
denotes |
5C |
T11242 |
21011-21013 |
, |
denotes |
, |
T11243 |
21013-21018 |
JJ |
denotes |
upper |
T11244 |
21019-21023 |
JJ |
denotes |
left |
T11239 |
21024-21030 |
NNS |
denotes |
images |
T11245 |
21030-21031 |
-RRB- |
denotes |
) |
T11246 |
21032-21034 |
CC |
denotes |
or |
T11247 |
21035-21039 |
IN |
denotes |
into |
T11248 |
21040-21044 |
JJ |
denotes |
wild |
T11250 |
21044-21045 |
HYPH |
denotes |
- |
T11249 |
21045-21049 |
NN |
denotes |
type |
T11252 |
21050-21054 |
NN |
denotes |
AQP2 |
T11251 |
21055-21060 |
NNS |
denotes |
cells |
T11253 |
21061-21062 |
-LRB- |
denotes |
( |
T11254 |
21062-21068 |
NN |
denotes |
Figure |
T11255 |
21069-21071 |
CD |
denotes |
5C |
T11256 |
21071-21073 |
, |
denotes |
, |
T11257 |
21073-21078 |
JJ |
denotes |
upper |
T11258 |
21079-21084 |
JJ |
denotes |
right |
T11259 |
21084-21085 |
-RRB- |
denotes |
) |
T11260 |
21085-21086 |
. |
denotes |
. |
T11261 |
21086-21242 |
sentence |
denotes |
AQP2-F204V-GFP, when expressed by transient transfection into vector only cells, showed a diffuse cytoplasmic distribution pattern (Figure 5C, lower left). |
T11262 |
21087-21091 |
NN |
denotes |
AQP2 |
T11264 |
21091-21092 |
HYPH |
denotes |
- |
T11265 |
21092-21097 |
NN |
denotes |
F204V |
T11266 |
21097-21098 |
HYPH |
denotes |
- |
T11263 |
21098-21101 |
NN |
denotes |
GFP |
T11268 |
21101-21103 |
, |
denotes |
, |
T11269 |
21103-21107 |
WRB |
denotes |
when |
T11270 |
21108-21117 |
VBN |
denotes |
expressed |
T11271 |
21118-21120 |
IN |
denotes |
by |
T11272 |
21121-21130 |
JJ |
denotes |
transient |
T11273 |
21131-21143 |
NN |
denotes |
transfection |
T11274 |
21144-21148 |
IN |
denotes |
into |
T11275 |
21149-21155 |
NN |
denotes |
vector |
T11276 |
21156-21160 |
JJ |
denotes |
only |
T11277 |
21161-21166 |
NNS |
denotes |
cells |
T11278 |
21166-21168 |
, |
denotes |
, |
T11267 |
21168-21174 |
VBD |
denotes |
showed |
T11279 |
21175-21176 |
DT |
denotes |
a |
T11281 |
21177-21184 |
JJ |
denotes |
diffuse |
T11282 |
21185-21196 |
JJ |
denotes |
cytoplasmic |
T11283 |
21197-21209 |
NN |
denotes |
distribution |
T11280 |
21210-21217 |
NN |
denotes |
pattern |
T11284 |
21218-21219 |
-LRB- |
denotes |
( |
T11286 |
21219-21225 |
NN |
denotes |
Figure |
T11287 |
21226-21228 |
CD |
denotes |
5C |
T11288 |
21228-21230 |
, |
denotes |
, |
T11289 |
21230-21235 |
JJ |
denotes |
lower |
T11285 |
21236-21240 |
JJ |
denotes |
left |
T11290 |
21240-21241 |
-RRB- |
denotes |
) |
T11291 |
21241-21242 |
. |
denotes |
. |
T11292 |
21242-21398 |
sentence |
denotes |
When expressed in wild-type AQP2 cells, however, AQP2-F204V-GFP localized to the apical surface to varying degrees (Figure 5C, lower right images [i–iii]). |
T11293 |
21243-21247 |
WRB |
denotes |
When |
T11294 |
21248-21257 |
VBN |
denotes |
expressed |
T11296 |
21258-21260 |
IN |
denotes |
in |
T11297 |
21261-21265 |
JJ |
denotes |
wild |
T11299 |
21265-21266 |
HYPH |
denotes |
- |
T11298 |
21266-21270 |
NN |
denotes |
type |
T11301 |
21271-21275 |
NN |
denotes |
AQP2 |
T11300 |
21276-21281 |
NNS |
denotes |
cells |
T11302 |
21281-21283 |
, |
denotes |
, |
T11303 |
21283-21290 |
RB |
denotes |
however |
T11304 |
21290-21292 |
, |
denotes |
, |
T11305 |
21292-21296 |
NN |
denotes |
AQP2 |
T11307 |
21296-21297 |
HYPH |
denotes |
- |
T11308 |
21297-21302 |
NN |
denotes |
F204V |
T11309 |
21302-21303 |
HYPH |
denotes |
- |
T11306 |
21303-21306 |
NN |
denotes |
GFP |
T11295 |
21307-21316 |
VBD |
denotes |
localized |
T11310 |
21317-21319 |
IN |
denotes |
to |
T11311 |
21320-21323 |
DT |
denotes |
the |
T11313 |
21324-21330 |
JJ |
denotes |
apical |
T11312 |
21331-21338 |
NN |
denotes |
surface |
T11314 |
21339-21341 |
IN |
denotes |
to |
T11315 |
21342-21349 |
VBG |
denotes |
varying |
T11316 |
21350-21357 |
NNS |
denotes |
degrees |
T11317 |
21358-21359 |
-LRB- |
denotes |
( |
T11319 |
21359-21365 |
NN |
denotes |
Figure |
T11320 |
21366-21368 |
CD |
denotes |
5C |
T11321 |
21368-21370 |
, |
denotes |
, |
T11322 |
21370-21375 |
JJ |
denotes |
lower |
T11323 |
21376-21381 |
JJ |
denotes |
right |
T11318 |
21382-21388 |
NNS |
denotes |
images |
T11324 |
21389-21390 |
-LRB- |
denotes |
[ |
T11325 |
21390-21391 |
CD |
denotes |
i |
T11326 |
21391-21392 |
SYM |
denotes |
– |
T11327 |
21392-21395 |
CD |
denotes |
iii |
T11328 |
21395-21396 |
-RRB- |
denotes |
] |
T11329 |
21396-21397 |
-RRB- |
denotes |
) |
T11330 |
21397-21398 |
. |
denotes |
. |
T11331 |
21398-21480 |
sentence |
denotes |
The lower right images of Figure 5C shows three cells from a single transfection. |
T11332 |
21399-21402 |
DT |
denotes |
The |
T11334 |
21403-21408 |
JJ |
denotes |
lower |
T11335 |
21409-21414 |
JJ |
denotes |
right |
T11333 |
21415-21421 |
NNS |
denotes |
images |
T11337 |
21422-21424 |
IN |
denotes |
of |
T11338 |
21425-21431 |
NN |
denotes |
Figure |
T11339 |
21432-21434 |
CD |
denotes |
5C |
T11336 |
21435-21440 |
VBZ |
denotes |
shows |
T11340 |
21441-21446 |
CD |
denotes |
three |
T11341 |
21447-21452 |
NNS |
denotes |
cells |
T11342 |
21453-21457 |
IN |
denotes |
from |
T11343 |
21458-21459 |
DT |
denotes |
a |
T11345 |
21460-21466 |
JJ |
denotes |
single |
T11344 |
21467-21479 |
NN |
denotes |
transfection |
T11346 |
21479-21480 |
. |
denotes |
. |
T11347 |
21480-21628 |
sentence |
denotes |
The first is a nontransfected cell that shows the localization of the stably expressing wild-type AQP2, which is apical upon forskolin stimulation. |
T11348 |
21481-21484 |
DT |
denotes |
The |
T11349 |
21485-21490 |
JJ |
denotes |
first |
T11350 |
21491-21493 |
VBZ |
denotes |
is |
T11351 |
21494-21495 |
DT |
denotes |
a |
T11353 |
21496-21510 |
JJ |
denotes |
nontransfected |
T11352 |
21511-21515 |
NN |
denotes |
cell |
T11354 |
21516-21520 |
WDT |
denotes |
that |
T11355 |
21521-21526 |
VBZ |
denotes |
shows |
T11356 |
21527-21530 |
DT |
denotes |
the |
T11357 |
21531-21543 |
NN |
denotes |
localization |
T11358 |
21544-21546 |
IN |
denotes |
of |
T11359 |
21547-21550 |
DT |
denotes |
the |
T11361 |
21551-21557 |
RB |
denotes |
stably |
T11362 |
21558-21568 |
VBG |
denotes |
expressing |
T11363 |
21569-21573 |
JJ |
denotes |
wild |
T11365 |
21573-21574 |
HYPH |
denotes |
- |
T11364 |
21574-21578 |
NN |
denotes |
type |
T11360 |
21579-21583 |
NN |
denotes |
AQP2 |
T11366 |
21583-21585 |
, |
denotes |
, |
T11367 |
21585-21590 |
WDT |
denotes |
which |
T11368 |
21591-21593 |
VBZ |
denotes |
is |
T11369 |
21594-21600 |
JJ |
denotes |
apical |
T11370 |
21601-21605 |
IN |
denotes |
upon |
T11371 |
21606-21615 |
NN |
denotes |
forskolin |
T11372 |
21616-21627 |
NN |
denotes |
stimulation |
T11373 |
21627-21628 |
. |
denotes |
. |
T11374 |
21628-21725 |
sentence |
denotes |
The next two show expression of both the stable wild-type AQP2 and the transient AQP2-F204V-GFP. |
T11375 |
21629-21632 |
DT |
denotes |
The |
T11377 |
21633-21637 |
JJ |
denotes |
next |
T11376 |
21638-21641 |
CD |
denotes |
two |
T11378 |
21642-21646 |
VBP |
denotes |
show |
T11379 |
21647-21657 |
NN |
denotes |
expression |
T11380 |
21658-21660 |
IN |
denotes |
of |
T11381 |
21661-21665 |
CC |
denotes |
both |
T11383 |
21666-21669 |
DT |
denotes |
the |
T11384 |
21670-21676 |
JJ |
denotes |
stable |
T11385 |
21677-21681 |
JJ |
denotes |
wild |
T11387 |
21681-21682 |
HYPH |
denotes |
- |
T11386 |
21682-21686 |
NN |
denotes |
type |
T11382 |
21687-21691 |
NN |
denotes |
AQP2 |
T11388 |
21692-21695 |
CC |
denotes |
and |
T11389 |
21696-21699 |
DT |
denotes |
the |
T11391 |
21700-21709 |
JJ |
denotes |
transient |
T11392 |
21710-21714 |
NN |
denotes |
AQP2 |
T11393 |
21714-21715 |
HYPH |
denotes |
- |
T11394 |
21715-21720 |
NN |
denotes |
F204V |
T11395 |
21720-21721 |
HYPH |
denotes |
- |
T11390 |
21721-21724 |
NN |
denotes |
GFP |
T11396 |
21724-21725 |
. |
denotes |
. |
T11397 |
21725-21858 |
sentence |
denotes |
In cell (ii), localization of wild-type AQP2 was indistinguishable from AQP2-F204V-GFP; both were apical upon forskolin stimulation. |
T11398 |
21726-21728 |
IN |
denotes |
In |
T11400 |
21729-21733 |
NN |
denotes |
cell |
T11401 |
21734-21735 |
-LRB- |
denotes |
( |
T11402 |
21735-21737 |
CD |
denotes |
ii |
T11403 |
21737-21738 |
-RRB- |
denotes |
) |
T11404 |
21738-21740 |
, |
denotes |
, |
T11405 |
21740-21752 |
NN |
denotes |
localization |
T11406 |
21753-21755 |
IN |
denotes |
of |
T11407 |
21756-21760 |
JJ |
denotes |
wild |
T11409 |
21760-21761 |
HYPH |
denotes |
- |
T11408 |
21761-21765 |
NN |
denotes |
type |
T11410 |
21766-21770 |
NN |
denotes |
AQP2 |
T11399 |
21771-21774 |
VBD |
denotes |
was |
T11412 |
21775-21792 |
JJ |
denotes |
indistinguishable |
T11413 |
21793-21797 |
IN |
denotes |
from |
T11414 |
21798-21802 |
NN |
denotes |
AQP2 |
T11416 |
21802-21803 |
HYPH |
denotes |
- |
T11417 |
21803-21808 |
NN |
denotes |
F204V |
T11418 |
21808-21809 |
HYPH |
denotes |
- |
T11415 |
21809-21812 |
NN |
denotes |
GFP |
T11419 |
21812-21813 |
: |
denotes |
; |
T11420 |
21814-21818 |
DT |
denotes |
both |
T11411 |
21819-21823 |
VBD |
denotes |
were |
T11421 |
21824-21830 |
JJ |
denotes |
apical |
T11422 |
21831-21835 |
IN |
denotes |
upon |
T11423 |
21836-21845 |
NN |
denotes |
forskolin |
T11424 |
21846-21857 |
NN |
denotes |
stimulation |
T11425 |
21857-21858 |
. |
denotes |
. |
T11426 |
21858-21963 |
sentence |
denotes |
Although the effect was subtle in cell (iii), AQP2-F204V-GFP was partly localized to the apical surface. |
T11427 |
21859-21867 |
IN |
denotes |
Although |
T11429 |
21868-21871 |
DT |
denotes |
the |
T11430 |
21872-21878 |
NN |
denotes |
effect |
T11428 |
21879-21882 |
VBD |
denotes |
was |
T11432 |
21883-21889 |
JJ |
denotes |
subtle |
T11433 |
21890-21892 |
IN |
denotes |
in |
T11434 |
21893-21897 |
NN |
denotes |
cell |
T11435 |
21898-21899 |
-LRB- |
denotes |
( |
T11436 |
21899-21902 |
CD |
denotes |
iii |
T11437 |
21902-21903 |
-RRB- |
denotes |
) |
T11438 |
21903-21905 |
, |
denotes |
, |
T11439 |
21905-21909 |
NN |
denotes |
AQP2 |
T11441 |
21909-21910 |
HYPH |
denotes |
- |
T11442 |
21910-21915 |
NN |
denotes |
F204V |
T11443 |
21915-21916 |
HYPH |
denotes |
- |
T11440 |
21916-21919 |
NN |
denotes |
GFP |
T11444 |
21920-21923 |
VBD |
denotes |
was |
T11445 |
21924-21930 |
RB |
denotes |
partly |
T11431 |
21931-21940 |
VBN |
denotes |
localized |
T11446 |
21941-21943 |
IN |
denotes |
to |
T11447 |
21944-21947 |
DT |
denotes |
the |
T11449 |
21948-21954 |
JJ |
denotes |
apical |
T11448 |
21955-21962 |
NN |
denotes |
surface |
T11450 |
21962-21963 |
. |
denotes |
. |
T11451 |
21963-22073 |
sentence |
denotes |
Generally, the localization of AQP2-F204V-GFP was clearly more apical when wild-type AQP2 was also expressed. |
T11452 |
21964-21973 |
RB |
denotes |
Generally |
T11454 |
21973-21975 |
, |
denotes |
, |
T11455 |
21975-21978 |
DT |
denotes |
the |
T11456 |
21979-21991 |
NN |
denotes |
localization |
T11457 |
21992-21994 |
IN |
denotes |
of |
T11458 |
21995-21999 |
NN |
denotes |
AQP2 |
T11460 |
21999-22000 |
HYPH |
denotes |
- |
T11461 |
22000-22005 |
NN |
denotes |
F204V |
T11462 |
22005-22006 |
HYPH |
denotes |
- |
T11459 |
22006-22009 |
NN |
denotes |
GFP |
T11453 |
22010-22013 |
VBD |
denotes |
was |
T11463 |
22014-22021 |
RB |
denotes |
clearly |
T11464 |
22022-22026 |
RBR |
denotes |
more |
T11465 |
22027-22033 |
JJ |
denotes |
apical |
T11466 |
22034-22038 |
WRB |
denotes |
when |
T11468 |
22039-22043 |
JJ |
denotes |
wild |
T11470 |
22043-22044 |
HYPH |
denotes |
- |
T11469 |
22044-22048 |
NN |
denotes |
type |
T11471 |
22049-22053 |
NN |
denotes |
AQP2 |
T11472 |
22054-22057 |
VBD |
denotes |
was |
T11473 |
22058-22062 |
RB |
denotes |
also |
T11467 |
22063-22072 |
VBN |
denotes |
expressed |
T11474 |
22072-22073 |
. |
denotes |
. |
T11475 |
22073-22306 |
sentence |
denotes |
To confirm these results biochemically, we transfected the same cell lines (wild-type AQP2 or vector) with F204V-GFP, biotinylated surface proteins after forskolin stimulation, and precipitated the biotinylated proteins (Figure 5D). |
T11476 |
22074-22076 |
TO |
denotes |
To |
T11477 |
22077-22084 |
VB |
denotes |
confirm |
T11479 |
22085-22090 |
DT |
denotes |
these |
T11480 |
22091-22098 |
NNS |
denotes |
results |
T11481 |
22099-22112 |
RB |
denotes |
biochemically |
T11482 |
22112-22114 |
, |
denotes |
, |
T11483 |
22114-22116 |
PRP |
denotes |
we |
T11478 |
22117-22128 |
VBD |
denotes |
transfected |
T11484 |
22129-22132 |
DT |
denotes |
the |
T11486 |
22133-22137 |
JJ |
denotes |
same |
T11487 |
22138-22142 |
NN |
denotes |
cell |
T11485 |
22143-22148 |
NNS |
denotes |
lines |
T11488 |
22149-22150 |
-LRB- |
denotes |
( |
T11489 |
22150-22154 |
JJ |
denotes |
wild |
T11491 |
22154-22155 |
HYPH |
denotes |
- |
T11490 |
22155-22159 |
NN |
denotes |
type |
T11492 |
22160-22164 |
NN |
denotes |
AQP2 |
T11493 |
22165-22167 |
CC |
denotes |
or |
T11494 |
22168-22174 |
NN |
denotes |
vector |
T11495 |
22174-22175 |
-RRB- |
denotes |
) |
T11496 |
22176-22180 |
IN |
denotes |
with |
T11497 |
22181-22186 |
NN |
denotes |
F204V |
T11499 |
22186-22187 |
HYPH |
denotes |
- |
T11498 |
22187-22190 |
NN |
denotes |
GFP |
T11500 |
22190-22192 |
, |
denotes |
, |
T11501 |
22192-22204 |
VBD |
denotes |
biotinylated |
T11502 |
22205-22212 |
NN |
denotes |
surface |
T11503 |
22213-22221 |
NN |
denotes |
proteins |
T11504 |
22222-22227 |
IN |
denotes |
after |
T11505 |
22228-22237 |
NN |
denotes |
forskolin |
T11506 |
22238-22249 |
NN |
denotes |
stimulation |
T11507 |
22249-22251 |
, |
denotes |
, |
T11508 |
22251-22254 |
CC |
denotes |
and |
T11509 |
22255-22267 |
VBD |
denotes |
precipitated |
T11510 |
22268-22271 |
DT |
denotes |
the |
T11512 |
22272-22284 |
VBN |
denotes |
biotinylated |
T11511 |
22285-22293 |
NN |
denotes |
proteins |
T11513 |
22294-22295 |
-LRB- |
denotes |
( |
T11514 |
22295-22301 |
NN |
denotes |
Figure |
T11515 |
22302-22304 |
CD |
denotes |
5D |
T11516 |
22304-22305 |
-RRB- |
denotes |
) |
T11517 |
22305-22306 |
. |
denotes |
. |
T11518 |
22306-22499 |
sentence |
denotes |
AQP2-F204V-GFP is expressed approximately equally in both cell lines (Figure 5D, total cells), but is biotinylated only when wild-type AQP2 is also expressed (Figure 5D, surface biotinylated). |
T11519 |
22307-22311 |
NN |
denotes |
AQP2 |
T11521 |
22311-22312 |
HYPH |
denotes |
- |
T11522 |
22312-22317 |
NN |
denotes |
F204V |
T11523 |
22317-22318 |
HYPH |
denotes |
- |
T11520 |
22318-22321 |
NN |
denotes |
GFP |
T11525 |
22322-22324 |
VBZ |
denotes |
is |
T11524 |
22325-22334 |
VBN |
denotes |
expressed |
T11526 |
22335-22348 |
RB |
denotes |
approximately |
T11527 |
22349-22356 |
RB |
denotes |
equally |
T11528 |
22357-22359 |
IN |
denotes |
in |
T11529 |
22360-22364 |
DT |
denotes |
both |
T11531 |
22365-22369 |
NN |
denotes |
cell |
T11530 |
22370-22375 |
NNS |
denotes |
lines |
T11532 |
22376-22377 |
-LRB- |
denotes |
( |
T11534 |
22377-22383 |
NN |
denotes |
Figure |
T11535 |
22384-22386 |
CD |
denotes |
5D |
T11536 |
22386-22388 |
, |
denotes |
, |
T11537 |
22388-22393 |
JJ |
denotes |
total |
T11533 |
22394-22399 |
NNS |
denotes |
cells |
T11538 |
22399-22400 |
-RRB- |
denotes |
) |
T11539 |
22400-22402 |
, |
denotes |
, |
T11540 |
22402-22405 |
CC |
denotes |
but |
T11541 |
22406-22408 |
VBZ |
denotes |
is |
T11542 |
22409-22421 |
VBN |
denotes |
biotinylated |
T11543 |
22422-22426 |
RB |
denotes |
only |
T11545 |
22427-22431 |
WRB |
denotes |
when |
T11546 |
22432-22436 |
JJ |
denotes |
wild |
T11548 |
22436-22437 |
HYPH |
denotes |
- |
T11547 |
22437-22441 |
NN |
denotes |
type |
T11549 |
22442-22446 |
NN |
denotes |
AQP2 |
T11550 |
22447-22449 |
VBZ |
denotes |
is |
T11551 |
22450-22454 |
RB |
denotes |
also |
T11544 |
22455-22464 |
VBN |
denotes |
expressed |
T11552 |
22465-22466 |
-LRB- |
denotes |
( |
T11553 |
22466-22472 |
NN |
denotes |
Figure |
T11554 |
22473-22475 |
CD |
denotes |
5D |
T11555 |
22475-22477 |
, |
denotes |
, |
T11556 |
22477-22484 |
NN |
denotes |
surface |
T11557 |
22485-22497 |
VBN |
denotes |
biotinylated |
T11558 |
22497-22498 |
-RRB- |
denotes |
) |
T11559 |
22498-22499 |
. |
denotes |
. |
T11560 |
22499-22684 |
sentence |
denotes |
Since only cell surface proteins are accessible to biotin, these results indicate that AQP2-F204V is transported to the cell surface when wild-type AQP2 is present, but not on its own. |
T11561 |
22500-22505 |
IN |
denotes |
Since |
T11563 |
22506-22510 |
RB |
denotes |
only |
T11565 |
22511-22515 |
NN |
denotes |
cell |
T11566 |
22516-22523 |
NN |
denotes |
surface |
T11564 |
22524-22532 |
NN |
denotes |
proteins |
T11562 |
22533-22536 |
VBP |
denotes |
are |
T11568 |
22537-22547 |
JJ |
denotes |
accessible |
T11569 |
22548-22550 |
IN |
denotes |
to |
T11570 |
22551-22557 |
NN |
denotes |
biotin |
T11571 |
22557-22559 |
, |
denotes |
, |
T11572 |
22559-22564 |
DT |
denotes |
these |
T11573 |
22565-22572 |
NNS |
denotes |
results |
T11567 |
22573-22581 |
VBP |
denotes |
indicate |
T11574 |
22582-22586 |
IN |
denotes |
that |
T11576 |
22587-22591 |
NN |
denotes |
AQP2 |
T11578 |
22591-22592 |
HYPH |
denotes |
- |
T11577 |
22592-22597 |
NN |
denotes |
F204V |
T11579 |
22598-22600 |
VBZ |
denotes |
is |
T11575 |
22601-22612 |
VBN |
denotes |
transported |
T11580 |
22613-22615 |
IN |
denotes |
to |
T11581 |
22616-22619 |
DT |
denotes |
the |
T11583 |
22620-22624 |
NN |
denotes |
cell |
T11582 |
22625-22632 |
NN |
denotes |
surface |
T11584 |
22633-22637 |
WRB |
denotes |
when |
T11586 |
22638-22642 |
JJ |
denotes |
wild |
T11588 |
22642-22643 |
HYPH |
denotes |
- |
T11587 |
22643-22647 |
NN |
denotes |
type |
T11589 |
22648-22652 |
NN |
denotes |
AQP2 |
T11585 |
22653-22655 |
VBZ |
denotes |
is |
T11590 |
22656-22663 |
JJ |
denotes |
present |
T11591 |
22663-22665 |
, |
denotes |
, |
T11592 |
22665-22668 |
CC |
denotes |
but |
T11593 |
22669-22672 |
RB |
denotes |
not |
T11594 |
22673-22675 |
IN |
denotes |
on |
T11595 |
22676-22679 |
PRP$ |
denotes |
its |
T11596 |
22680-22683 |
JJ |
denotes |
own |
T11597 |
22683-22684 |
. |
denotes |
. |
T14172 |
22697-22705 |
NN |
denotes |
Aqp2F204 |
T14174 |
22705-22706 |
HYPH |
denotes |
/ |
T14173 |
22706-22711 |
NN |
denotes |
F204V |
T14175 |
22712-22716 |
NNS |
denotes |
mice |
T14176 |
22717-22720 |
VBP |
denotes |
are |
T14177 |
22721-22727 |
JJ |
denotes |
viable |
T14178 |
22728-22731 |
CC |
denotes |
and |
T14179 |
22732-22736 |
VBP |
denotes |
grow |
T14180 |
22737-22740 |
CC |
denotes |
and |
T14181 |
22741-22750 |
VBP |
denotes |
reproduce |
T14182 |
22751-22759 |
RB |
denotes |
normally |
T14183 |
22759-22760 |
. |
denotes |
. |
T14184 |
22760-22959 |
sentence |
denotes |
They are, however, severely defective in their ability to concentrate urine, leading to increased urine output and water intake, thus making them the first mouse model of NDI to survive to maturity. |
T14185 |
22761-22765 |
PRP |
denotes |
They |
T14186 |
22766-22769 |
VBP |
denotes |
are |
T14187 |
22769-22771 |
, |
denotes |
, |
T14188 |
22771-22778 |
RB |
denotes |
however |
T14189 |
22778-22780 |
, |
denotes |
, |
T14190 |
22780-22788 |
RB |
denotes |
severely |
T14191 |
22789-22798 |
JJ |
denotes |
defective |
T14192 |
22799-22801 |
IN |
denotes |
in |
T14193 |
22802-22807 |
PRP$ |
denotes |
their |
T14194 |
22808-22815 |
NN |
denotes |
ability |
T14195 |
22816-22818 |
TO |
denotes |
to |
T14196 |
22819-22830 |
VB |
denotes |
concentrate |
T14197 |
22831-22836 |
NN |
denotes |
urine |
T14198 |
22836-22838 |
, |
denotes |
, |
T14199 |
22838-22845 |
VBG |
denotes |
leading |
T14200 |
22846-22848 |
IN |
denotes |
to |
T14201 |
22849-22858 |
VBN |
denotes |
increased |
T14203 |
22859-22864 |
NN |
denotes |
urine |
T14202 |
22865-22871 |
NN |
denotes |
output |
T14204 |
22872-22875 |
CC |
denotes |
and |
T14205 |
22876-22881 |
NN |
denotes |
water |
T14206 |
22882-22888 |
NN |
denotes |
intake |
T14207 |
22888-22890 |
, |
denotes |
, |
T14208 |
22890-22894 |
RB |
denotes |
thus |
T14209 |
22895-22901 |
VBG |
denotes |
making |
T14210 |
22902-22906 |
PRP |
denotes |
them |
T14212 |
22907-22910 |
DT |
denotes |
the |
T14213 |
22911-22916 |
JJ |
denotes |
first |
T14214 |
22917-22922 |
NN |
denotes |
mouse |
T14211 |
22923-22928 |
NN |
denotes |
model |
T14215 |
22929-22931 |
IN |
denotes |
of |
T14216 |
22932-22935 |
NN |
denotes |
NDI |
T14217 |
22936-22938 |
TO |
denotes |
to |
T14218 |
22939-22946 |
VB |
denotes |
survive |
T14219 |
22947-22949 |
IN |
denotes |
to |
T14220 |
22950-22958 |
NN |
denotes |
maturity |
T14221 |
22958-22959 |
. |
denotes |
. |
T14222 |
22959-23015 |
sentence |
denotes |
In humans, NDI is caused by mutations in Avpr2 or Aqp2. |
T14223 |
22960-22962 |
IN |
denotes |
In |
T14225 |
22963-22969 |
NNS |
denotes |
humans |
T14226 |
22969-22971 |
, |
denotes |
, |
T14227 |
22971-22974 |
NN |
denotes |
NDI |
T14228 |
22975-22977 |
VBZ |
denotes |
is |
T14224 |
22978-22984 |
VBN |
denotes |
caused |
T14229 |
22985-22987 |
IN |
denotes |
by |
T14230 |
22988-22997 |
NNS |
denotes |
mutations |
T14231 |
22998-23000 |
IN |
denotes |
in |
T14232 |
23001-23006 |
NN |
denotes |
Avpr2 |
T14233 |
23007-23009 |
CC |
denotes |
or |
T14234 |
23010-23014 |
NN |
denotes |
Aqp2 |
T14235 |
23014-23015 |
. |
denotes |
. |
T14236 |
23015-23210 |
sentence |
denotes |
Knockout of the X-linked Avpr2 gene in mice [15] gave an NDI-like phenotype in male, hemizygous neonates, but the phenotype could not be assessed in adults as the mice died within 1 wk of birth. |
T14237 |
23016-23024 |
NN |
denotes |
Knockout |
T14239 |
23025-23027 |
IN |
denotes |
of |
T14240 |
23028-23031 |
DT |
denotes |
the |
T14242 |
23032-23033 |
NN |
denotes |
X |
T14244 |
23033-23034 |
HYPH |
denotes |
- |
T14243 |
23034-23040 |
VBN |
denotes |
linked |
T14245 |
23041-23046 |
NN |
denotes |
Avpr2 |
T14241 |
23047-23051 |
NN |
denotes |
gene |
T14246 |
23052-23054 |
IN |
denotes |
in |
T14247 |
23055-23059 |
NNS |
denotes |
mice |
T14248 |
23060-23061 |
-LRB- |
denotes |
[ |
T14249 |
23061-23063 |
CD |
denotes |
15 |
T14250 |
23063-23064 |
-RRB- |
denotes |
] |
T14238 |
23065-23069 |
VBD |
denotes |
gave |
T14251 |
23070-23072 |
DT |
denotes |
an |
T14253 |
23073-23076 |
NN |
denotes |
NDI |
T14255 |
23076-23077 |
HYPH |
denotes |
- |
T14254 |
23077-23081 |
JJ |
denotes |
like |
T14252 |
23082-23091 |
NN |
denotes |
phenotype |
T14256 |
23092-23094 |
IN |
denotes |
in |
T14257 |
23095-23099 |
JJ |
denotes |
male |
T14259 |
23099-23101 |
, |
denotes |
, |
T14260 |
23101-23111 |
JJ |
denotes |
hemizygous |
T14258 |
23112-23120 |
NNS |
denotes |
neonates |
T14261 |
23120-23122 |
, |
denotes |
, |
T14262 |
23122-23125 |
CC |
denotes |
but |
T14263 |
23126-23129 |
DT |
denotes |
the |
T14264 |
23130-23139 |
NN |
denotes |
phenotype |
T14266 |
23140-23145 |
MD |
denotes |
could |
T14267 |
23146-23149 |
RB |
denotes |
not |
T14268 |
23150-23152 |
VB |
denotes |
be |
T14265 |
23153-23161 |
VBN |
denotes |
assessed |
T14269 |
23162-23164 |
IN |
denotes |
in |
T14270 |
23165-23171 |
NNS |
denotes |
adults |
T14271 |
23172-23174 |
IN |
denotes |
as |
T14273 |
23175-23178 |
DT |
denotes |
the |
T14274 |
23179-23183 |
NNS |
denotes |
mice |
T14272 |
23184-23188 |
VBD |
denotes |
died |
T14275 |
23189-23195 |
IN |
denotes |
within |
T14276 |
23196-23197 |
CD |
denotes |
1 |
T14277 |
23198-23200 |
NN |
denotes |
wk |
T14278 |
23201-23203 |
IN |
denotes |
of |
T14279 |
23204-23209 |
NN |
denotes |
birth |
T14280 |
23209-23210 |
. |
denotes |
. |
T14281 |
23210-23345 |
sentence |
denotes |
The adult heterozygous females showed a mild tendency toward increased urinary output and water intake and decreased urine osmolality. |
T14282 |
23211-23214 |
DT |
denotes |
The |
T14284 |
23215-23220 |
JJ |
denotes |
adult |
T14285 |
23221-23233 |
JJ |
denotes |
heterozygous |
T14283 |
23234-23241 |
NNS |
denotes |
females |
T14286 |
23242-23248 |
VBD |
denotes |
showed |
T14287 |
23249-23250 |
DT |
denotes |
a |
T14289 |
23251-23255 |
JJ |
denotes |
mild |
T14288 |
23256-23264 |
NN |
denotes |
tendency |
T14290 |
23265-23271 |
IN |
denotes |
toward |
T14291 |
23272-23281 |
VBN |
denotes |
increased |
T14293 |
23282-23289 |
JJ |
denotes |
urinary |
T14292 |
23290-23296 |
NN |
denotes |
output |
T14294 |
23297-23300 |
CC |
denotes |
and |
T14295 |
23301-23306 |
NN |
denotes |
water |
T14296 |
23307-23313 |
NN |
denotes |
intake |
T14297 |
23314-23317 |
CC |
denotes |
and |
T14298 |
23318-23327 |
VBN |
denotes |
decreased |
T14300 |
23328-23333 |
NN |
denotes |
urine |
T14299 |
23334-23344 |
NN |
denotes |
osmolality |
T14301 |
23344-23345 |
. |
denotes |
. |
T14302 |
23345-23400 |
sentence |
denotes |
Knockout of the mouse Aqp2 gene has not been reported. |
T14303 |
23346-23354 |
NN |
denotes |
Knockout |
T14305 |
23355-23357 |
IN |
denotes |
of |
T14306 |
23358-23361 |
DT |
denotes |
the |
T14308 |
23362-23367 |
NN |
denotes |
mouse |
T14309 |
23368-23372 |
NN |
denotes |
Aqp2 |
T14307 |
23373-23377 |
NN |
denotes |
gene |
T14310 |
23378-23381 |
VBZ |
denotes |
has |
T14311 |
23382-23385 |
RB |
denotes |
not |
T14312 |
23386-23390 |
VBN |
denotes |
been |
T14304 |
23391-23399 |
VBN |
denotes |
reported |
T14313 |
23399-23400 |
. |
denotes |
. |
T14314 |
23400-23485 |
sentence |
denotes |
A knock-in of a human disease-causing mutation (T126M), however, has been made [18]. |
T14315 |
23401-23402 |
DT |
denotes |
A |
T14317 |
23403-23408 |
NN |
denotes |
knock |
T14318 |
23408-23409 |
HYPH |
denotes |
- |
T14316 |
23409-23411 |
NN |
denotes |
in |
T14320 |
23412-23414 |
IN |
denotes |
of |
T14321 |
23415-23416 |
DT |
denotes |
a |
T14323 |
23417-23422 |
JJ |
denotes |
human |
T14324 |
23423-23430 |
NN |
denotes |
disease |
T14326 |
23430-23431 |
HYPH |
denotes |
- |
T14325 |
23431-23438 |
VBG |
denotes |
causing |
T14322 |
23439-23447 |
NN |
denotes |
mutation |
T14327 |
23448-23449 |
-LRB- |
denotes |
( |
T14328 |
23449-23454 |
NN |
denotes |
T126M |
T14329 |
23454-23455 |
-RRB- |
denotes |
) |
T14330 |
23455-23457 |
, |
denotes |
, |
T14331 |
23457-23464 |
RB |
denotes |
however |
T14332 |
23464-23466 |
, |
denotes |
, |
T14333 |
23466-23469 |
VBZ |
denotes |
has |
T14334 |
23470-23474 |
VBN |
denotes |
been |
T14319 |
23475-23479 |
VBN |
denotes |
made |
T14335 |
23480-23481 |
-LRB- |
denotes |
[ |
T14336 |
23481-23483 |
CD |
denotes |
18 |
T14337 |
23483-23484 |
-RRB- |
denotes |
] |
T14338 |
23484-23485 |
. |
denotes |
. |
T14339 |
23485-23594 |
sentence |
denotes |
These mice have a severe urine-concentrating defect resulting in dehydration and death within 1 wk of birth. |
T14340 |
23486-23491 |
DT |
denotes |
These |
T14341 |
23492-23496 |
NNS |
denotes |
mice |
T14342 |
23497-23501 |
VBP |
denotes |
have |
T14343 |
23502-23503 |
DT |
denotes |
a |
T14345 |
23504-23510 |
JJ |
denotes |
severe |
T14346 |
23511-23516 |
NN |
denotes |
urine |
T14348 |
23516-23517 |
HYPH |
denotes |
- |
T14347 |
23517-23530 |
VBG |
denotes |
concentrating |
T14344 |
23531-23537 |
NN |
denotes |
defect |
T14349 |
23538-23547 |
VBG |
denotes |
resulting |
T14350 |
23548-23550 |
IN |
denotes |
in |
T14351 |
23551-23562 |
NN |
denotes |
dehydration |
T14352 |
23563-23566 |
CC |
denotes |
and |
T14353 |
23567-23572 |
NN |
denotes |
death |
T14354 |
23573-23579 |
IN |
denotes |
within |
T14355 |
23580-23581 |
CD |
denotes |
1 |
T14356 |
23582-23584 |
NN |
denotes |
wk |
T14357 |
23585-23587 |
IN |
denotes |
of |
T14358 |
23588-23593 |
NN |
denotes |
birth |
T14359 |
23593-23594 |
. |
denotes |
. |
T14360 |
23594-23670 |
sentence |
denotes |
Curiously, AQP2-T126M does localize properly in at least a subset of cells. |
T14361 |
23595-23604 |
RB |
denotes |
Curiously |
T14363 |
23604-23606 |
, |
denotes |
, |
T14364 |
23606-23610 |
NN |
denotes |
AQP2 |
T14366 |
23610-23611 |
HYPH |
denotes |
- |
T14365 |
23611-23616 |
NN |
denotes |
T126M |
T14367 |
23617-23621 |
VBZ |
denotes |
does |
T14362 |
23622-23630 |
VB |
denotes |
localize |
T14368 |
23631-23639 |
RB |
denotes |
properly |
T14369 |
23640-23642 |
IN |
denotes |
in |
T14370 |
23643-23645 |
RB |
denotes |
at |
T14371 |
23646-23651 |
RBS |
denotes |
least |
T14373 |
23652-23653 |
DT |
denotes |
a |
T14372 |
23654-23660 |
NN |
denotes |
subset |
T14374 |
23661-23663 |
IN |
denotes |
of |
T14375 |
23664-23669 |
NNS |
denotes |
cells |
T14376 |
23669-23670 |
. |
denotes |
. |
T14377 |
23670-23795 |
sentence |
denotes |
The grossly abnormal collecting duct morphology makes it impossible to pinpoint the molecular defect in these knock-in mice. |
T14378 |
23671-23674 |
DT |
denotes |
The |
T14380 |
23675-23682 |
RB |
denotes |
grossly |
T14381 |
23683-23691 |
JJ |
denotes |
abnormal |
T14382 |
23692-23702 |
VBG |
denotes |
collecting |
T14383 |
23703-23707 |
NN |
denotes |
duct |
T14379 |
23708-23718 |
NN |
denotes |
morphology |
T14384 |
23719-23724 |
VBZ |
denotes |
makes |
T14385 |
23725-23727 |
PRP |
denotes |
it |
T14386 |
23728-23738 |
JJ |
denotes |
impossible |
T14387 |
23739-23741 |
TO |
denotes |
to |
T14388 |
23742-23750 |
VB |
denotes |
pinpoint |
T14389 |
23751-23754 |
DT |
denotes |
the |
T14391 |
23755-23764 |
JJ |
denotes |
molecular |
T14390 |
23765-23771 |
NN |
denotes |
defect |
T14392 |
23772-23774 |
IN |
denotes |
in |
T14393 |
23775-23780 |
DT |
denotes |
these |
T14395 |
23781-23786 |
VB |
denotes |
knock |
T14396 |
23786-23787 |
HYPH |
denotes |
- |
T14397 |
23787-23789 |
RP |
denotes |
in |
T14394 |
23790-23794 |
NNS |
denotes |
mice |
T14398 |
23794-23795 |
. |
denotes |
. |
T14399 |
23795-23865 |
sentence |
denotes |
The T126M knock-in clearly shows that Aqp2 is an essential gene [18]. |
T14400 |
23796-23799 |
DT |
denotes |
The |
T14402 |
23800-23805 |
NN |
denotes |
T126M |
T14403 |
23806-23811 |
NN |
denotes |
knock |
T14404 |
23811-23812 |
HYPH |
denotes |
- |
T14401 |
23812-23814 |
NN |
denotes |
in |
T14406 |
23815-23822 |
RB |
denotes |
clearly |
T14405 |
23823-23828 |
VBZ |
denotes |
shows |
T14407 |
23829-23833 |
IN |
denotes |
that |
T14409 |
23834-23838 |
NN |
denotes |
Aqp2 |
T14408 |
23839-23841 |
VBZ |
denotes |
is |
T14410 |
23842-23844 |
DT |
denotes |
an |
T14412 |
23845-23854 |
JJ |
denotes |
essential |
T14411 |
23855-23859 |
NN |
denotes |
gene |
T14413 |
23860-23861 |
-LRB- |
denotes |
[ |
T14414 |
23861-23863 |
CD |
denotes |
18 |
T14415 |
23863-23864 |
-RRB- |
denotes |
] |
T14416 |
23864-23865 |
. |
denotes |
. |
T14417 |
23865-24043 |
sentence |
denotes |
The fact that our mice survive shows either that AQP2-F204V possesses some residual water transporting ability or that there are AVP-independent pathways for water reabsorption. |
T14418 |
23866-23869 |
DT |
denotes |
The |
T14419 |
23870-23874 |
NN |
denotes |
fact |
T14421 |
23875-23879 |
IN |
denotes |
that |
T14423 |
23880-23883 |
PRP$ |
denotes |
our |
T14424 |
23884-23888 |
NNS |
denotes |
mice |
T14422 |
23889-23896 |
VBP |
denotes |
survive |
T14420 |
23897-23902 |
VBZ |
denotes |
shows |
T14425 |
23903-23909 |
CC |
denotes |
either |
T14427 |
23910-23914 |
IN |
denotes |
that |
T14428 |
23915-23919 |
NN |
denotes |
AQP2 |
T14430 |
23919-23920 |
HYPH |
denotes |
- |
T14429 |
23920-23925 |
NN |
denotes |
F204V |
T14426 |
23926-23935 |
VBZ |
denotes |
possesses |
T14431 |
23936-23940 |
DT |
denotes |
some |
T14433 |
23941-23949 |
JJ |
denotes |
residual |
T14434 |
23950-23955 |
NN |
denotes |
water |
T14435 |
23956-23968 |
VBG |
denotes |
transporting |
T14432 |
23969-23976 |
NN |
denotes |
ability |
T14436 |
23977-23979 |
CC |
denotes |
or |
T14437 |
23980-23984 |
IN |
denotes |
that |
T14439 |
23985-23990 |
EX |
denotes |
there |
T14438 |
23991-23994 |
VBP |
denotes |
are |
T14440 |
23995-23998 |
NN |
denotes |
AVP |
T14442 |
23998-23999 |
HYPH |
denotes |
- |
T14441 |
23999-24010 |
JJ |
denotes |
independent |
T14443 |
24011-24019 |
NNS |
denotes |
pathways |
T14444 |
24020-24023 |
IN |
denotes |
for |
T14445 |
24024-24029 |
NN |
denotes |
water |
T14446 |
24030-24042 |
NN |
denotes |
reabsorption |
T14447 |
24042-24043 |
. |
denotes |
. |
T14448 |
24043-24201 |
sentence |
denotes |
Residual activity of AQP2-F204V is likely, as mutant animals show some small response to dDAVP, although dDAVP-stimulated urine osmolality remains quite low. |
T14449 |
24044-24052 |
JJ |
denotes |
Residual |
T14450 |
24053-24061 |
NN |
denotes |
activity |
T14452 |
24062-24064 |
IN |
denotes |
of |
T14453 |
24065-24069 |
NN |
denotes |
AQP2 |
T14455 |
24069-24070 |
HYPH |
denotes |
- |
T14454 |
24070-24075 |
NN |
denotes |
F204V |
T14451 |
24076-24078 |
VBZ |
denotes |
is |
T14456 |
24079-24085 |
JJ |
denotes |
likely |
T14457 |
24085-24087 |
, |
denotes |
, |
T14458 |
24087-24089 |
IN |
denotes |
as |
T14460 |
24090-24096 |
NN |
denotes |
mutant |
T14461 |
24097-24104 |
NNS |
denotes |
animals |
T14459 |
24105-24109 |
VBP |
denotes |
show |
T14462 |
24110-24114 |
DT |
denotes |
some |
T14464 |
24115-24120 |
JJ |
denotes |
small |
T14463 |
24121-24129 |
NN |
denotes |
response |
T14465 |
24130-24132 |
IN |
denotes |
to |
T14466 |
24133-24138 |
NN |
denotes |
dDAVP |
T14467 |
24138-24140 |
, |
denotes |
, |
T14468 |
24140-24148 |
IN |
denotes |
although |
T14470 |
24149-24154 |
NN |
denotes |
dDAVP |
T14472 |
24154-24155 |
HYPH |
denotes |
- |
T14471 |
24155-24165 |
VBN |
denotes |
stimulated |
T14474 |
24166-24171 |
NN |
denotes |
urine |
T14473 |
24172-24182 |
NN |
denotes |
osmolality |
T14469 |
24183-24190 |
VBZ |
denotes |
remains |
T14475 |
24191-24196 |
RB |
denotes |
quite |
T14476 |
24197-24200 |
JJ |
denotes |
low |
T14477 |
24200-24201 |
. |
denotes |
. |
T14478 |
24201-24365 |
sentence |
denotes |
Immunostaining of kidney shows that AQP2-F204V does not efficiently transport water, because it fails to localize to the apical cell surface after dDAVP treatment. |
T14479 |
24202-24216 |
NN |
denotes |
Immunostaining |
T14481 |
24217-24219 |
IN |
denotes |
of |
T14482 |
24220-24226 |
NN |
denotes |
kidney |
T14480 |
24227-24232 |
VBZ |
denotes |
shows |
T14483 |
24233-24237 |
IN |
denotes |
that |
T14485 |
24238-24242 |
NN |
denotes |
AQP2 |
T14487 |
24242-24243 |
HYPH |
denotes |
- |
T14486 |
24243-24248 |
NN |
denotes |
F204V |
T14488 |
24249-24253 |
VBZ |
denotes |
does |
T14489 |
24254-24257 |
RB |
denotes |
not |
T14490 |
24258-24269 |
RB |
denotes |
efficiently |
T14484 |
24270-24279 |
VB |
denotes |
transport |
T14491 |
24280-24285 |
NN |
denotes |
water |
T14492 |
24285-24287 |
, |
denotes |
, |
T14493 |
24287-24294 |
IN |
denotes |
because |
T14495 |
24295-24297 |
PRP |
denotes |
it |
T14494 |
24298-24303 |
VBZ |
denotes |
fails |
T14496 |
24304-24306 |
TO |
denotes |
to |
T14497 |
24307-24315 |
VB |
denotes |
localize |
T14498 |
24316-24318 |
IN |
denotes |
to |
T14499 |
24319-24322 |
DT |
denotes |
the |
T14501 |
24323-24329 |
JJ |
denotes |
apical |
T14502 |
24330-24334 |
NN |
denotes |
cell |
T14500 |
24335-24342 |
NN |
denotes |
surface |
T14503 |
24343-24348 |
IN |
denotes |
after |
T14504 |
24349-24354 |
NN |
denotes |
dDAVP |
T14505 |
24355-24364 |
NN |
denotes |
treatment |
T14506 |
24364-24365 |
. |
denotes |
. |
T14507 |
24365-24500 |
sentence |
denotes |
Some residual activity of AQP2 would imply that some small, undetectable portion of the mutant protein is getting to the cell surface. |
T14508 |
24366-24370 |
DT |
denotes |
Some |
T14510 |
24371-24379 |
JJ |
denotes |
residual |
T14509 |
24380-24388 |
NN |
denotes |
activity |
T14512 |
24389-24391 |
IN |
denotes |
of |
T14513 |
24392-24396 |
NN |
denotes |
AQP2 |
T14514 |
24397-24402 |
MD |
denotes |
would |
T14511 |
24403-24408 |
VB |
denotes |
imply |
T14515 |
24409-24413 |
IN |
denotes |
that |
T14517 |
24414-24418 |
DT |
denotes |
some |
T14519 |
24419-24424 |
JJ |
denotes |
small |
T14520 |
24424-24426 |
, |
denotes |
, |
T14521 |
24426-24438 |
JJ |
denotes |
undetectable |
T14518 |
24439-24446 |
NN |
denotes |
portion |
T14522 |
24447-24449 |
IN |
denotes |
of |
T14523 |
24450-24453 |
DT |
denotes |
the |
T14525 |
24454-24460 |
NN |
denotes |
mutant |
T14524 |
24461-24468 |
NN |
denotes |
protein |
T14526 |
24469-24471 |
VBZ |
denotes |
is |
T14516 |
24472-24479 |
VBG |
denotes |
getting |
T14527 |
24480-24482 |
IN |
denotes |
to |
T14528 |
24483-24486 |
DT |
denotes |
the |
T14530 |
24487-24491 |
NN |
denotes |
cell |
T14529 |
24492-24499 |
NN |
denotes |
surface |
T14531 |
24499-24500 |
. |
denotes |
. |
T14532 |
24500-24663 |
sentence |
denotes |
The surface biotinylation experiment (Figure 5D) suggests that no mutant protein gets to the surface, but this does not necessarily reflect the situation in vivo. |
T14533 |
24501-24504 |
DT |
denotes |
The |
T14535 |
24505-24512 |
NN |
denotes |
surface |
T14536 |
24513-24526 |
NN |
denotes |
biotinylation |
T14534 |
24527-24537 |
NN |
denotes |
experiment |
T14538 |
24538-24539 |
-LRB- |
denotes |
( |
T14539 |
24539-24545 |
NN |
denotes |
Figure |
T14540 |
24546-24548 |
CD |
denotes |
5D |
T14541 |
24548-24549 |
-RRB- |
denotes |
) |
T14537 |
24550-24558 |
VBZ |
denotes |
suggests |
T14542 |
24559-24563 |
IN |
denotes |
that |
T14544 |
24564-24566 |
DT |
denotes |
no |
T14546 |
24567-24573 |
NN |
denotes |
mutant |
T14545 |
24574-24581 |
NN |
denotes |
protein |
T14543 |
24582-24586 |
VBZ |
denotes |
gets |
T14547 |
24587-24589 |
IN |
denotes |
to |
T14548 |
24590-24593 |
DT |
denotes |
the |
T14549 |
24594-24601 |
NN |
denotes |
surface |
T14550 |
24601-24603 |
, |
denotes |
, |
T14551 |
24603-24606 |
CC |
denotes |
but |
T14552 |
24607-24611 |
DT |
denotes |
this |
T14554 |
24612-24616 |
VBZ |
denotes |
does |
T14555 |
24617-24620 |
RB |
denotes |
not |
T14556 |
24621-24632 |
RB |
denotes |
necessarily |
T14553 |
24633-24640 |
VB |
denotes |
reflect |
T14557 |
24641-24644 |
DT |
denotes |
the |
T14558 |
24645-24654 |
NN |
denotes |
situation |
T14559 |
24655-24657 |
FW |
denotes |
in |
T14560 |
24658-24662 |
FW |
denotes |
vivo |
T14561 |
24662-24663 |
. |
denotes |
. |
T14562 |
24663-24855 |
sentence |
denotes |
While this small fraction of protein may not be detectable by immunofluorescence, Western blotting shows that some mutant protein does progress beyond the ER (35–45 kDa species in Figure 3A). |
T14563 |
24664-24669 |
IN |
denotes |
While |
T14565 |
24670-24674 |
DT |
denotes |
this |
T14567 |
24675-24680 |
JJ |
denotes |
small |
T14566 |
24681-24689 |
NN |
denotes |
fraction |
T14568 |
24690-24692 |
IN |
denotes |
of |
T14569 |
24693-24700 |
NN |
denotes |
protein |
T14570 |
24701-24704 |
MD |
denotes |
may |
T14571 |
24705-24708 |
RB |
denotes |
not |
T14564 |
24709-24711 |
VB |
denotes |
be |
T14573 |
24712-24722 |
JJ |
denotes |
detectable |
T14574 |
24723-24725 |
IN |
denotes |
by |
T14575 |
24726-24744 |
NN |
denotes |
immunofluorescence |
T14576 |
24744-24746 |
, |
denotes |
, |
T14577 |
24746-24753 |
NNP |
denotes |
Western |
T14578 |
24754-24762 |
NN |
denotes |
blotting |
T14572 |
24763-24768 |
VBZ |
denotes |
shows |
T14579 |
24769-24773 |
IN |
denotes |
that |
T14581 |
24774-24778 |
DT |
denotes |
some |
T14583 |
24779-24785 |
NN |
denotes |
mutant |
T14582 |
24786-24793 |
NN |
denotes |
protein |
T14584 |
24794-24798 |
VBZ |
denotes |
does |
T14580 |
24799-24807 |
VB |
denotes |
progress |
T14585 |
24808-24814 |
IN |
denotes |
beyond |
T14586 |
24815-24818 |
DT |
denotes |
the |
T14587 |
24819-24821 |
NN |
denotes |
ER |
T14588 |
24822-24823 |
-LRB- |
denotes |
( |
T14590 |
24823-24825 |
CD |
denotes |
35 |
T14592 |
24825-24826 |
SYM |
denotes |
– |
T14591 |
24826-24828 |
CD |
denotes |
45 |
T14593 |
24829-24832 |
NN |
denotes |
kDa |
T14589 |
24833-24840 |
NNS |
denotes |
species |
T14594 |
24841-24843 |
IN |
denotes |
in |
T14595 |
24844-24850 |
NN |
denotes |
Figure |
T14596 |
24851-24853 |
CD |
denotes |
3A |
T14597 |
24853-24854 |
-RRB- |
denotes |
) |
T14598 |
24854-24855 |
. |
denotes |
. |
T14599 |
24855-25044 |
sentence |
denotes |
Compared to wild-type, mutant protein is enriched in the high-mannose, core-glycosylated form (31 kDa) and deficient in nonglycosylated (29 kDa) and complex glycosylated (35–45 kDa) forms. |
T14600 |
24856-24864 |
VBN |
denotes |
Compared |
T14602 |
24865-24867 |
IN |
denotes |
to |
T14603 |
24868-24872 |
JJ |
denotes |
wild |
T14605 |
24872-24873 |
HYPH |
denotes |
- |
T14604 |
24873-24877 |
NN |
denotes |
type |
T14606 |
24877-24879 |
, |
denotes |
, |
T14607 |
24879-24885 |
NN |
denotes |
mutant |
T14608 |
24886-24893 |
NN |
denotes |
protein |
T14601 |
24894-24896 |
VBZ |
denotes |
is |
T14609 |
24897-24905 |
VBN |
denotes |
enriched |
T14610 |
24906-24908 |
IN |
denotes |
in |
T14611 |
24909-24912 |
DT |
denotes |
the |
T14613 |
24913-24917 |
JJ |
denotes |
high |
T14615 |
24917-24918 |
HYPH |
denotes |
- |
T14614 |
24918-24925 |
NN |
denotes |
mannose |
T14616 |
24925-24927 |
, |
denotes |
, |
T14617 |
24927-24931 |
NN |
denotes |
core |
T14619 |
24931-24932 |
HYPH |
denotes |
- |
T14618 |
24932-24944 |
VBN |
denotes |
glycosylated |
T14612 |
24945-24949 |
NN |
denotes |
form |
T14620 |
24950-24951 |
-LRB- |
denotes |
( |
T14622 |
24951-24953 |
CD |
denotes |
31 |
T14621 |
24954-24957 |
NN |
denotes |
kDa |
T14623 |
24957-24958 |
-RRB- |
denotes |
) |
T14624 |
24959-24962 |
CC |
denotes |
and |
T14625 |
24963-24972 |
JJ |
denotes |
deficient |
T14626 |
24973-24975 |
IN |
denotes |
in |
T14627 |
24976-24991 |
JJ |
denotes |
nonglycosylated |
T14629 |
24992-24993 |
-LRB- |
denotes |
( |
T14631 |
24993-24995 |
CD |
denotes |
29 |
T14630 |
24996-24999 |
NN |
denotes |
kDa |
T14632 |
24999-25000 |
-RRB- |
denotes |
) |
T14633 |
25001-25004 |
CC |
denotes |
and |
T14634 |
25005-25012 |
JJ |
denotes |
complex |
T14635 |
25013-25025 |
JJ |
denotes |
glycosylated |
T14636 |
25026-25027 |
-LRB- |
denotes |
( |
T14638 |
25027-25029 |
CD |
denotes |
35 |
T14640 |
25029-25030 |
SYM |
denotes |
– |
T14639 |
25030-25032 |
CD |
denotes |
45 |
T14637 |
25033-25036 |
NN |
denotes |
kDa |
T14641 |
25036-25037 |
-RRB- |
denotes |
) |
T14628 |
25038-25043 |
NNS |
denotes |
forms |
T14642 |
25043-25044 |
. |
denotes |
. |
T14643 |
25044-25223 |
sentence |
denotes |
The presence of a reduced but detectable amount of protein in the 35–45 kDa range indicates that mutant protein is transported out of the ER, but with greatly reduced efficiency. |
T14644 |
25045-25048 |
DT |
denotes |
The |
T14645 |
25049-25057 |
NN |
denotes |
presence |
T14647 |
25058-25060 |
IN |
denotes |
of |
T14648 |
25061-25062 |
DT |
denotes |
a |
T14650 |
25063-25070 |
VBN |
denotes |
reduced |
T14651 |
25071-25074 |
CC |
denotes |
but |
T14652 |
25075-25085 |
JJ |
denotes |
detectable |
T14649 |
25086-25092 |
NN |
denotes |
amount |
T14653 |
25093-25095 |
IN |
denotes |
of |
T14654 |
25096-25103 |
NN |
denotes |
protein |
T14655 |
25104-25106 |
IN |
denotes |
in |
T14656 |
25107-25110 |
DT |
denotes |
the |
T14658 |
25111-25113 |
CD |
denotes |
35 |
T14660 |
25113-25114 |
SYM |
denotes |
– |
T14659 |
25114-25116 |
CD |
denotes |
45 |
T14661 |
25117-25120 |
NN |
denotes |
kDa |
T14657 |
25121-25126 |
NN |
denotes |
range |
T14646 |
25127-25136 |
VBZ |
denotes |
indicates |
T14662 |
25137-25141 |
IN |
denotes |
that |
T14664 |
25142-25148 |
NN |
denotes |
mutant |
T14665 |
25149-25156 |
NN |
denotes |
protein |
T14666 |
25157-25159 |
VBZ |
denotes |
is |
T14663 |
25160-25171 |
VBN |
denotes |
transported |
T14667 |
25172-25175 |
IN |
denotes |
out |
T14668 |
25176-25178 |
IN |
denotes |
of |
T14669 |
25179-25182 |
DT |
denotes |
the |
T14670 |
25183-25185 |
NN |
denotes |
ER |
T14671 |
25185-25187 |
, |
denotes |
, |
T14672 |
25187-25190 |
CC |
denotes |
but |
T14673 |
25191-25195 |
IN |
denotes |
with |
T14674 |
25196-25203 |
RB |
denotes |
greatly |
T14675 |
25204-25211 |
VBN |
denotes |
reduced |
T14676 |
25212-25222 |
NN |
denotes |
efficiency |
T14677 |
25222-25223 |
. |
denotes |
. |
T14678 |
25223-25408 |
sentence |
denotes |
Colocalization of AQP2-F204V with the ER protein calnexin in transfected MDCK cells shows that, while most of the mutant protein is trapped in the ER, some does progress beyond the ER. |
T14679 |
25224-25238 |
NN |
denotes |
Colocalization |
T14681 |
25239-25241 |
IN |
denotes |
of |
T14682 |
25242-25246 |
NN |
denotes |
AQP2 |
T14684 |
25246-25247 |
HYPH |
denotes |
- |
T14683 |
25247-25252 |
NN |
denotes |
F204V |
T14685 |
25253-25257 |
IN |
denotes |
with |
T14686 |
25258-25261 |
DT |
denotes |
the |
T14688 |
25262-25264 |
NN |
denotes |
ER |
T14687 |
25265-25272 |
NN |
denotes |
protein |
T14689 |
25273-25281 |
NN |
denotes |
calnexin |
T14690 |
25282-25284 |
IN |
denotes |
in |
T14691 |
25285-25296 |
VBN |
denotes |
transfected |
T14693 |
25297-25301 |
NN |
denotes |
MDCK |
T14692 |
25302-25307 |
NNS |
denotes |
cells |
T14680 |
25308-25313 |
VBZ |
denotes |
shows |
T14694 |
25314-25318 |
IN |
denotes |
that |
T14696 |
25318-25320 |
, |
denotes |
, |
T14697 |
25320-25325 |
IN |
denotes |
while |
T14699 |
25326-25330 |
JJS |
denotes |
most |
T14700 |
25331-25333 |
IN |
denotes |
of |
T14701 |
25334-25337 |
DT |
denotes |
the |
T14703 |
25338-25344 |
NN |
denotes |
mutant |
T14702 |
25345-25352 |
NN |
denotes |
protein |
T14704 |
25353-25355 |
VBZ |
denotes |
is |
T14698 |
25356-25363 |
VBN |
denotes |
trapped |
T14705 |
25364-25366 |
IN |
denotes |
in |
T14706 |
25367-25370 |
DT |
denotes |
the |
T14707 |
25371-25373 |
NN |
denotes |
ER |
T14708 |
25373-25375 |
, |
denotes |
, |
T14709 |
25375-25379 |
DT |
denotes |
some |
T14710 |
25380-25384 |
VBZ |
denotes |
does |
T14695 |
25385-25393 |
VB |
denotes |
progress |
T14711 |
25394-25400 |
IN |
denotes |
beyond |
T14712 |
25401-25404 |
DT |
denotes |
the |
T14713 |
25405-25407 |
NN |
denotes |
ER |
T14714 |
25407-25408 |
. |
denotes |
. |
T14715 |
25408-25726 |
sentence |
denotes |
Diminished response to dDAVP, diminished abundance of mature glycosylated protein in mutant animals, and the transport of a fraction of mutant protein beyond the ER in MDCK cells are all consistent with the notion that AQP2-F204V misfolding is limited and that it may retain some residual water transporting activity. |
T14716 |
25409-25419 |
VBN |
denotes |
Diminished |
T14717 |
25420-25428 |
NN |
denotes |
response |
T14719 |
25429-25431 |
IN |
denotes |
to |
T14720 |
25432-25437 |
NN |
denotes |
dDAVP |
T14721 |
25437-25439 |
, |
denotes |
, |
T14722 |
25439-25449 |
VBN |
denotes |
diminished |
T14723 |
25450-25459 |
NN |
denotes |
abundance |
T14724 |
25460-25462 |
IN |
denotes |
of |
T14725 |
25463-25469 |
JJ |
denotes |
mature |
T14727 |
25470-25482 |
VBN |
denotes |
glycosylated |
T14726 |
25483-25490 |
NN |
denotes |
protein |
T14728 |
25491-25493 |
IN |
denotes |
in |
T14729 |
25494-25500 |
NN |
denotes |
mutant |
T14730 |
25501-25508 |
NNS |
denotes |
animals |
T14731 |
25508-25510 |
, |
denotes |
, |
T14732 |
25510-25513 |
CC |
denotes |
and |
T14733 |
25514-25517 |
DT |
denotes |
the |
T14734 |
25518-25527 |
NN |
denotes |
transport |
T14735 |
25528-25530 |
IN |
denotes |
of |
T14736 |
25531-25532 |
DT |
denotes |
a |
T14737 |
25533-25541 |
NN |
denotes |
fraction |
T14738 |
25542-25544 |
IN |
denotes |
of |
T14739 |
25545-25551 |
NN |
denotes |
mutant |
T14740 |
25552-25559 |
NN |
denotes |
protein |
T14741 |
25560-25566 |
IN |
denotes |
beyond |
T14742 |
25567-25570 |
DT |
denotes |
the |
T14743 |
25571-25573 |
NN |
denotes |
ER |
T14744 |
25574-25576 |
IN |
denotes |
in |
T14745 |
25577-25581 |
NN |
denotes |
MDCK |
T14746 |
25582-25587 |
NNS |
denotes |
cells |
T14718 |
25588-25591 |
VBP |
denotes |
are |
T14747 |
25592-25595 |
RB |
denotes |
all |
T14748 |
25596-25606 |
JJ |
denotes |
consistent |
T14749 |
25607-25611 |
IN |
denotes |
with |
T14750 |
25612-25615 |
DT |
denotes |
the |
T14751 |
25616-25622 |
NN |
denotes |
notion |
T14752 |
25623-25627 |
IN |
denotes |
that |
T14754 |
25628-25632 |
NN |
denotes |
AQP2 |
T14756 |
25632-25633 |
HYPH |
denotes |
- |
T14755 |
25633-25638 |
NN |
denotes |
F204V |
T14757 |
25639-25649 |
NN |
denotes |
misfolding |
T14753 |
25650-25652 |
VBZ |
denotes |
is |
T14758 |
25653-25660 |
JJ |
denotes |
limited |
T14759 |
25661-25664 |
CC |
denotes |
and |
T14760 |
25665-25669 |
IN |
denotes |
that |
T14762 |
25670-25672 |
PRP |
denotes |
it |
T14763 |
25673-25676 |
MD |
denotes |
may |
T14761 |
25677-25683 |
VB |
denotes |
retain |
T14764 |
25684-25688 |
DT |
denotes |
some |
T14766 |
25689-25697 |
JJ |
denotes |
residual |
T14767 |
25698-25703 |
NN |
denotes |
water |
T14768 |
25704-25716 |
VBG |
denotes |
transporting |
T14765 |
25717-25725 |
NN |
denotes |
activity |
T14769 |
25725-25726 |
. |
denotes |
. |
T14770 |
25726-25821 |
sentence |
denotes |
Evidently this residual activity is sufficient for the viability and growth of mutant animals. |
T14771 |
25727-25736 |
RB |
denotes |
Evidently |
T14773 |
25737-25741 |
DT |
denotes |
this |
T14775 |
25742-25750 |
JJ |
denotes |
residual |
T14774 |
25751-25759 |
NN |
denotes |
activity |
T14772 |
25760-25762 |
VBZ |
denotes |
is |
T14776 |
25763-25773 |
JJ |
denotes |
sufficient |
T14777 |
25774-25777 |
IN |
denotes |
for |
T14778 |
25778-25781 |
DT |
denotes |
the |
T14779 |
25782-25791 |
NN |
denotes |
viability |
T14780 |
25792-25795 |
CC |
denotes |
and |
T14781 |
25796-25802 |
NN |
denotes |
growth |
T14782 |
25803-25805 |
IN |
denotes |
of |
T14783 |
25806-25812 |
NN |
denotes |
mutant |
T14784 |
25813-25820 |
NNS |
denotes |
animals |
T14785 |
25820-25821 |
. |
denotes |
. |
T14786 |
25821-25943 |
sentence |
denotes |
Reduced efficiency in exiting the ER may explain why AQP2-F204V is enriched in the 31 kDa high-mannose glycosylated form. |
T14787 |
25822-25829 |
VBN |
denotes |
Reduced |
T14788 |
25830-25840 |
NN |
denotes |
efficiency |
T14790 |
25841-25843 |
IN |
denotes |
in |
T14791 |
25844-25851 |
VBG |
denotes |
exiting |
T14792 |
25852-25855 |
DT |
denotes |
the |
T14793 |
25856-25858 |
NN |
denotes |
ER |
T14794 |
25859-25862 |
MD |
denotes |
may |
T14789 |
25863-25870 |
VB |
denotes |
explain |
T14795 |
25871-25874 |
WRB |
denotes |
why |
T14797 |
25875-25879 |
NN |
denotes |
AQP2 |
T14799 |
25879-25880 |
HYPH |
denotes |
- |
T14798 |
25880-25885 |
NN |
denotes |
F204V |
T14800 |
25886-25888 |
VBZ |
denotes |
is |
T14796 |
25889-25897 |
VBN |
denotes |
enriched |
T14801 |
25898-25900 |
IN |
denotes |
in |
T14802 |
25901-25904 |
DT |
denotes |
the |
T14804 |
25905-25907 |
CD |
denotes |
31 |
T14805 |
25908-25911 |
NN |
denotes |
kDa |
T14806 |
25912-25916 |
JJ |
denotes |
high |
T14808 |
25916-25917 |
HYPH |
denotes |
- |
T14807 |
25917-25924 |
NN |
denotes |
mannose |
T14809 |
25925-25937 |
VBN |
denotes |
glycosylated |
T14803 |
25938-25942 |
NN |
denotes |
form |
T14810 |
25942-25943 |
. |
denotes |
. |
T14811 |
25943-26066 |
sentence |
denotes |
The high-mannose core oligosaccharide is added in the ER and is later modified and elaborated in the Golgi apparatus [26]. |
T14812 |
25944-25947 |
DT |
denotes |
The |
T14814 |
25948-25952 |
JJ |
denotes |
high |
T14816 |
25952-25953 |
HYPH |
denotes |
- |
T14815 |
25953-25960 |
NN |
denotes |
mannose |
T14817 |
25961-25965 |
NN |
denotes |
core |
T14813 |
25966-25981 |
NN |
denotes |
oligosaccharide |
T14819 |
25982-25984 |
VBZ |
denotes |
is |
T14818 |
25985-25990 |
VBN |
denotes |
added |
T14820 |
25991-25993 |
IN |
denotes |
in |
T14821 |
25994-25997 |
DT |
denotes |
the |
T14822 |
25998-26000 |
NN |
denotes |
ER |
T14823 |
26001-26004 |
CC |
denotes |
and |
T14824 |
26005-26007 |
VBZ |
denotes |
is |
T14826 |
26008-26013 |
RB |
denotes |
later |
T14825 |
26014-26022 |
VBN |
denotes |
modified |
T14827 |
26023-26026 |
CC |
denotes |
and |
T14828 |
26027-26037 |
VBN |
denotes |
elaborated |
T14829 |
26038-26040 |
IN |
denotes |
in |
T14830 |
26041-26044 |
DT |
denotes |
the |
T14832 |
26045-26050 |
NN |
denotes |
Golgi |
T14831 |
26051-26060 |
NN |
denotes |
apparatus |
T14833 |
26061-26062 |
-LRB- |
denotes |
[ |
T14834 |
26062-26064 |
CD |
denotes |
26 |
T14835 |
26064-26065 |
-RRB- |
denotes |
] |
T14836 |
26065-26066 |
. |
denotes |
. |
T14837 |
26066-26227 |
sentence |
denotes |
The increase in the high-mannose glycosylated form of AQP2-F204V may simply reflect its prolonged presence in the ER and exposure to oligosaccharyl transferase. |
T14838 |
26067-26070 |
DT |
denotes |
The |
T14839 |
26071-26079 |
NN |
denotes |
increase |
T14841 |
26080-26082 |
IN |
denotes |
in |
T14842 |
26083-26086 |
DT |
denotes |
the |
T14844 |
26087-26091 |
JJ |
denotes |
high |
T14846 |
26091-26092 |
HYPH |
denotes |
- |
T14845 |
26092-26099 |
NN |
denotes |
mannose |
T14847 |
26100-26112 |
VBN |
denotes |
glycosylated |
T14843 |
26113-26117 |
NN |
denotes |
form |
T14848 |
26118-26120 |
IN |
denotes |
of |
T14849 |
26121-26125 |
NN |
denotes |
AQP2 |
T14851 |
26125-26126 |
HYPH |
denotes |
- |
T14850 |
26126-26131 |
NN |
denotes |
F204V |
T14852 |
26132-26135 |
MD |
denotes |
may |
T14853 |
26136-26142 |
RB |
denotes |
simply |
T14840 |
26143-26150 |
VB |
denotes |
reflect |
T14854 |
26151-26154 |
PRP$ |
denotes |
its |
T14856 |
26155-26164 |
JJ |
denotes |
prolonged |
T14855 |
26165-26173 |
NN |
denotes |
presence |
T14857 |
26174-26176 |
IN |
denotes |
in |
T14858 |
26177-26180 |
DT |
denotes |
the |
T14859 |
26181-26183 |
NN |
denotes |
ER |
T14860 |
26184-26187 |
CC |
denotes |
and |
T14861 |
26188-26196 |
NN |
denotes |
exposure |
T14862 |
26197-26199 |
IN |
denotes |
to |
T14863 |
26200-26214 |
NN |
denotes |
oligosaccharyl |
T14864 |
26215-26226 |
NN |
denotes |
transferase |
T14865 |
26226-26227 |
. |
denotes |
. |
T14866 |
26227-26397 |
sentence |
denotes |
While improper localization of AQP2 explains the phenotype of homozygous mutant mice, the complete lack of a phenotype in heterozygous mice is more difficult to explain. |
T14867 |
26228-26233 |
IN |
denotes |
While |
T14869 |
26234-26242 |
JJ |
denotes |
improper |
T14870 |
26243-26255 |
NN |
denotes |
localization |
T14871 |
26256-26258 |
IN |
denotes |
of |
T14872 |
26259-26263 |
NN |
denotes |
AQP2 |
T14868 |
26264-26272 |
VBZ |
denotes |
explains |
T14874 |
26273-26276 |
DT |
denotes |
the |
T14875 |
26277-26286 |
NN |
denotes |
phenotype |
T14876 |
26287-26289 |
IN |
denotes |
of |
T14877 |
26290-26300 |
JJ |
denotes |
homozygous |
T14879 |
26301-26307 |
NN |
denotes |
mutant |
T14878 |
26308-26312 |
NNS |
denotes |
mice |
T14880 |
26312-26314 |
, |
denotes |
, |
T14881 |
26314-26317 |
DT |
denotes |
the |
T14883 |
26318-26326 |
JJ |
denotes |
complete |
T14882 |
26327-26331 |
NN |
denotes |
lack |
T14884 |
26332-26334 |
IN |
denotes |
of |
T14885 |
26335-26336 |
DT |
denotes |
a |
T14886 |
26337-26346 |
NN |
denotes |
phenotype |
T14887 |
26347-26349 |
IN |
denotes |
in |
T14888 |
26350-26362 |
JJ |
denotes |
heterozygous |
T14889 |
26363-26367 |
NNS |
denotes |
mice |
T14873 |
26368-26370 |
VBZ |
denotes |
is |
T14890 |
26371-26375 |
RBR |
denotes |
more |
T14891 |
26376-26385 |
JJ |
denotes |
difficult |
T14892 |
26386-26388 |
TO |
denotes |
to |
T14893 |
26389-26396 |
VB |
denotes |
explain |
T14894 |
26396-26397 |
. |
denotes |
. |
T14895 |
26397-26554 |
sentence |
denotes |
Physiologically, heterozygous mice have no symptoms (see Figure 1C), and they are indistinguishable from wild type on immunostaining of kidneys (Figure 5A). |
T14896 |
26398-26413 |
RB |
denotes |
Physiologically |
T14898 |
26413-26415 |
, |
denotes |
, |
T14899 |
26415-26427 |
JJ |
denotes |
heterozygous |
T14900 |
26428-26432 |
NNS |
denotes |
mice |
T14897 |
26433-26437 |
VBP |
denotes |
have |
T14901 |
26438-26440 |
DT |
denotes |
no |
T14902 |
26441-26449 |
NNS |
denotes |
symptoms |
T14903 |
26450-26451 |
-LRB- |
denotes |
( |
T14904 |
26451-26454 |
VB |
denotes |
see |
T14905 |
26455-26461 |
NN |
denotes |
Figure |
T14906 |
26462-26464 |
CD |
denotes |
1C |
T14907 |
26464-26465 |
-RRB- |
denotes |
) |
T14908 |
26465-26467 |
, |
denotes |
, |
T14909 |
26467-26470 |
CC |
denotes |
and |
T14910 |
26471-26475 |
PRP |
denotes |
they |
T14911 |
26476-26479 |
VBP |
denotes |
are |
T14912 |
26480-26497 |
JJ |
denotes |
indistinguishable |
T14913 |
26498-26502 |
IN |
denotes |
from |
T14914 |
26503-26507 |
JJ |
denotes |
wild |
T14915 |
26508-26512 |
NN |
denotes |
type |
T14916 |
26513-26515 |
IN |
denotes |
on |
T14917 |
26516-26530 |
NN |
denotes |
immunostaining |
T14918 |
26531-26533 |
IN |
denotes |
of |
T14919 |
26534-26541 |
NNS |
denotes |
kidneys |
T14920 |
26542-26543 |
-LRB- |
denotes |
( |
T14921 |
26543-26549 |
NN |
denotes |
Figure |
T14922 |
26550-26552 |
CD |
denotes |
5A |
T14923 |
26552-26553 |
-RRB- |
denotes |
) |
T14924 |
26553-26554 |
. |
denotes |
. |
T14925 |
26554-26716 |
sentence |
denotes |
The presence of 50% of the normal amount of wild-type protein may explain the lack of symptoms, but it cannot explain the lack of any ER-retained mutant protein. |
T14926 |
26555-26558 |
DT |
denotes |
The |
T14927 |
26559-26567 |
NN |
denotes |
presence |
T14929 |
26568-26570 |
IN |
denotes |
of |
T14930 |
26571-26573 |
CD |
denotes |
50 |
T14931 |
26573-26574 |
NN |
denotes |
% |
T14932 |
26575-26577 |
IN |
denotes |
of |
T14933 |
26578-26581 |
DT |
denotes |
the |
T14935 |
26582-26588 |
JJ |
denotes |
normal |
T14934 |
26589-26595 |
NN |
denotes |
amount |
T14936 |
26596-26598 |
IN |
denotes |
of |
T14937 |
26599-26603 |
JJ |
denotes |
wild |
T14939 |
26603-26604 |
HYPH |
denotes |
- |
T14938 |
26604-26608 |
NN |
denotes |
type |
T14940 |
26609-26616 |
NN |
denotes |
protein |
T14941 |
26617-26620 |
MD |
denotes |
may |
T14928 |
26621-26628 |
VB |
denotes |
explain |
T14942 |
26629-26632 |
DT |
denotes |
the |
T14943 |
26633-26637 |
NN |
denotes |
lack |
T14944 |
26638-26640 |
IN |
denotes |
of |
T14945 |
26641-26649 |
NNS |
denotes |
symptoms |
T14946 |
26649-26651 |
, |
denotes |
, |
T14947 |
26651-26654 |
CC |
denotes |
but |
T14948 |
26655-26657 |
PRP |
denotes |
it |
T14950 |
26658-26661 |
MD |
denotes |
can |
T14951 |
26661-26664 |
RB |
denotes |
not |
T14949 |
26665-26672 |
VB |
denotes |
explain |
T14952 |
26673-26676 |
DT |
denotes |
the |
T14953 |
26677-26681 |
NN |
denotes |
lack |
T14954 |
26682-26684 |
IN |
denotes |
of |
T14955 |
26685-26688 |
DT |
denotes |
any |
T14957 |
26689-26691 |
NN |
denotes |
ER |
T14959 |
26691-26692 |
HYPH |
denotes |
- |
T14958 |
26692-26700 |
VBN |
denotes |
retained |
T14960 |
26701-26707 |
NN |
denotes |
mutant |
T14956 |
26708-26715 |
NN |
denotes |
protein |
T14961 |
26715-26716 |
. |
denotes |
. |
T14962 |
26716-26841 |
sentence |
denotes |
Rather, the phenotype of the Aqp2F204V/+ animals suggests that the mutant protein is being rescued by the wild-type protein. |
T14963 |
26717-26723 |
RB |
denotes |
Rather |
T14965 |
26723-26725 |
, |
denotes |
, |
T14966 |
26725-26728 |
DT |
denotes |
the |
T14967 |
26729-26738 |
NN |
denotes |
phenotype |
T14968 |
26739-26741 |
IN |
denotes |
of |
T14969 |
26742-26745 |
DT |
denotes |
the |
T14971 |
26746-26755 |
NN |
denotes |
Aqp2F204V |
T14972 |
26755-26756 |
HYPH |
denotes |
/ |
T14973 |
26756-26757 |
SYM |
denotes |
+ |
T14970 |
26758-26765 |
NNS |
denotes |
animals |
T14964 |
26766-26774 |
VBZ |
denotes |
suggests |
T14974 |
26775-26779 |
IN |
denotes |
that |
T14976 |
26780-26783 |
DT |
denotes |
the |
T14978 |
26784-26790 |
NN |
denotes |
mutant |
T14977 |
26791-26798 |
NN |
denotes |
protein |
T14979 |
26799-26801 |
VBZ |
denotes |
is |
T14980 |
26802-26807 |
VBG |
denotes |
being |
T14975 |
26808-26815 |
VBN |
denotes |
rescued |
T14981 |
26816-26818 |
IN |
denotes |
by |
T14982 |
26819-26822 |
DT |
denotes |
the |
T14984 |
26823-26827 |
JJ |
denotes |
wild |
T14986 |
26827-26828 |
HYPH |
denotes |
- |
T14985 |
26828-26832 |
NN |
denotes |
type |
T14983 |
26833-26840 |
NN |
denotes |
protein |
T14987 |
26840-26841 |
. |
denotes |
. |
T14988 |
26841-27071 |
sentence |
denotes |
Indeed, de Mattia et al. (26) have demonstrated that one recessive allele of Aqp2, P262L, does not properly translocate when expressed by itself in MDCK cells, but that in the presence of wild-type protein, it localizes normally. |
T14989 |
26842-26848 |
RB |
denotes |
Indeed |
T14991 |
26848-26850 |
, |
denotes |
, |
T14992 |
26850-26852 |
NNP |
denotes |
de |
T14993 |
26853-26859 |
NNP |
denotes |
Mattia |
T14994 |
26860-26862 |
FW |
denotes |
et |
T14995 |
26863-26866 |
FW |
denotes |
al. |
T14996 |
26867-26868 |
-LRB- |
denotes |
( |
T14997 |
26868-26870 |
CD |
denotes |
26 |
T14998 |
26870-26871 |
-RRB- |
denotes |
) |
T14999 |
26872-26876 |
VBP |
denotes |
have |
T14990 |
26877-26889 |
VBN |
denotes |
demonstrated |
T15000 |
26890-26894 |
IN |
denotes |
that |
T15002 |
26895-26898 |
CD |
denotes |
one |
T15004 |
26899-26908 |
JJ |
denotes |
recessive |
T15003 |
26909-26915 |
NN |
denotes |
allele |
T15005 |
26916-26918 |
IN |
denotes |
of |
T15006 |
26919-26923 |
NN |
denotes |
Aqp2 |
T15007 |
26923-26925 |
, |
denotes |
, |
T15008 |
26925-26930 |
NN |
denotes |
P262L |
T15009 |
26930-26932 |
, |
denotes |
, |
T15010 |
26932-26936 |
VBZ |
denotes |
does |
T15011 |
26937-26940 |
RB |
denotes |
not |
T15012 |
26941-26949 |
RB |
denotes |
properly |
T15001 |
26950-26961 |
VB |
denotes |
translocate |
T15013 |
26962-26966 |
WRB |
denotes |
when |
T15014 |
26967-26976 |
VBN |
denotes |
expressed |
T15015 |
26977-26979 |
IN |
denotes |
by |
T15016 |
26980-26986 |
PRP |
denotes |
itself |
T15017 |
26987-26989 |
IN |
denotes |
in |
T15018 |
26990-26994 |
NN |
denotes |
MDCK |
T15019 |
26995-27000 |
NNS |
denotes |
cells |
T15020 |
27000-27002 |
, |
denotes |
, |
T15021 |
27002-27005 |
CC |
denotes |
but |
T15022 |
27006-27010 |
IN |
denotes |
that |
T15024 |
27011-27013 |
IN |
denotes |
in |
T15025 |
27014-27017 |
DT |
denotes |
the |
T15026 |
27018-27026 |
NN |
denotes |
presence |
T15027 |
27027-27029 |
IN |
denotes |
of |
T15028 |
27030-27034 |
JJ |
denotes |
wild |
T15030 |
27034-27035 |
HYPH |
denotes |
- |
T15029 |
27035-27039 |
NN |
denotes |
type |
T15031 |
27040-27047 |
NN |
denotes |
protein |
T15032 |
27047-27049 |
, |
denotes |
, |
T15033 |
27049-27051 |
PRP |
denotes |
it |
T15023 |
27052-27061 |
VBZ |
denotes |
localizes |
T15034 |
27062-27070 |
RB |
denotes |
normally |
T15035 |
27070-27071 |
. |
denotes |
. |
T15036 |
27071-27136 |
sentence |
denotes |
The same mechanism seems to apply in vivo with Aqp2F204V/+ mice. |
T15037 |
27072-27075 |
DT |
denotes |
The |
T15039 |
27076-27080 |
JJ |
denotes |
same |
T15038 |
27081-27090 |
NN |
denotes |
mechanism |
T15040 |
27091-27096 |
VBZ |
denotes |
seems |
T15041 |
27097-27099 |
TO |
denotes |
to |
T15042 |
27100-27105 |
VB |
denotes |
apply |
T15043 |
27106-27108 |
FW |
denotes |
in |
T15044 |
27109-27113 |
FW |
denotes |
vivo |
T15045 |
27114-27118 |
IN |
denotes |
with |
T15046 |
27119-27128 |
NN |
denotes |
Aqp2F204V |
T15048 |
27128-27129 |
HYPH |
denotes |
/ |
T15049 |
27129-27130 |
SYM |
denotes |
+ |
T15047 |
27131-27135 |
NNS |
denotes |
mice |
T15050 |
27135-27136 |
. |
denotes |
. |
T15051 |
27136-27335 |
sentence |
denotes |
In support of this, AQP2-F204V can interact with wild-type AQP2 (Figure 5B), and when coexpressed with wild-type protein, AQP2-F204V can reach the cell surface (Figure 5C bottom right panel and 5D). |
T15052 |
27137-27139 |
IN |
denotes |
In |
T15054 |
27140-27147 |
NN |
denotes |
support |
T15055 |
27148-27150 |
IN |
denotes |
of |
T15056 |
27151-27155 |
DT |
denotes |
this |
T15057 |
27155-27157 |
, |
denotes |
, |
T15058 |
27157-27161 |
NN |
denotes |
AQP2 |
T15060 |
27161-27162 |
HYPH |
denotes |
- |
T15059 |
27162-27167 |
NN |
denotes |
F204V |
T15061 |
27168-27171 |
MD |
denotes |
can |
T15053 |
27172-27180 |
VB |
denotes |
interact |
T15062 |
27181-27185 |
IN |
denotes |
with |
T15063 |
27186-27190 |
JJ |
denotes |
wild |
T15065 |
27190-27191 |
HYPH |
denotes |
- |
T15064 |
27191-27195 |
NN |
denotes |
type |
T15066 |
27196-27200 |
NN |
denotes |
AQP2 |
T15067 |
27201-27202 |
-LRB- |
denotes |
( |
T15068 |
27202-27208 |
NN |
denotes |
Figure |
T15069 |
27209-27211 |
CD |
denotes |
5B |
T15070 |
27211-27212 |
-RRB- |
denotes |
) |
T15071 |
27212-27214 |
, |
denotes |
, |
T15072 |
27214-27217 |
CC |
denotes |
and |
T15073 |
27218-27222 |
WRB |
denotes |
when |
T15074 |
27223-27234 |
VBN |
denotes |
coexpressed |
T15076 |
27235-27239 |
IN |
denotes |
with |
T15077 |
27240-27244 |
JJ |
denotes |
wild |
T15079 |
27244-27245 |
HYPH |
denotes |
- |
T15078 |
27245-27249 |
NN |
denotes |
type |
T15080 |
27250-27257 |
NN |
denotes |
protein |
T15081 |
27257-27259 |
, |
denotes |
, |
T15082 |
27259-27263 |
NN |
denotes |
AQP2 |
T15084 |
27263-27264 |
HYPH |
denotes |
- |
T15083 |
27264-27269 |
NN |
denotes |
F204V |
T15085 |
27270-27273 |
MD |
denotes |
can |
T15075 |
27274-27279 |
VB |
denotes |
reach |
T15086 |
27280-27283 |
DT |
denotes |
the |
T15088 |
27284-27288 |
NN |
denotes |
cell |
T15087 |
27289-27296 |
NN |
denotes |
surface |
T15089 |
27297-27298 |
-LRB- |
denotes |
( |
T15091 |
27298-27304 |
NN |
denotes |
Figure |
T15092 |
27305-27307 |
CD |
denotes |
5C |
T15093 |
27308-27314 |
NN |
denotes |
bottom |
T15094 |
27315-27320 |
JJ |
denotes |
right |
T15090 |
27321-27326 |
NN |
denotes |
panel |
T15095 |
27327-27330 |
CC |
denotes |
and |
T15096 |
27331-27333 |
CD |
denotes |
5D |
T15097 |
27333-27334 |
-RRB- |
denotes |
) |
T15098 |
27334-27335 |
. |
denotes |
. |
T15099 |
27335-27637 |
sentence |
denotes |
Although it has been demonstrated that a recessive allele (encoding AQP2-R187C) of NDI fails to interact with wild-type AQP2 [6], here we show that AQP2-F204V does interact with the wild-type protein, presumably as part of heterotetramers, and represents a rescuable allele, both in vitro and in vivo. |
T15100 |
27336-27344 |
IN |
denotes |
Although |
T15102 |
27345-27347 |
PRP |
denotes |
it |
T15103 |
27348-27351 |
VBZ |
denotes |
has |
T15104 |
27352-27356 |
VBN |
denotes |
been |
T15101 |
27357-27369 |
VBN |
denotes |
demonstrated |
T15106 |
27370-27374 |
IN |
denotes |
that |
T15108 |
27375-27376 |
DT |
denotes |
a |
T15110 |
27377-27386 |
JJ |
denotes |
recessive |
T15109 |
27387-27393 |
NN |
denotes |
allele |
T15111 |
27394-27395 |
-LRB- |
denotes |
( |
T15112 |
27395-27403 |
VBG |
denotes |
encoding |
T15113 |
27404-27408 |
NN |
denotes |
AQP2 |
T15115 |
27408-27409 |
HYPH |
denotes |
- |
T15114 |
27409-27414 |
NN |
denotes |
R187C |
T15116 |
27414-27415 |
-RRB- |
denotes |
) |
T15117 |
27416-27418 |
IN |
denotes |
of |
T15118 |
27419-27422 |
NN |
denotes |
NDI |
T15107 |
27423-27428 |
VBZ |
denotes |
fails |
T15119 |
27429-27431 |
TO |
denotes |
to |
T15120 |
27432-27440 |
VB |
denotes |
interact |
T15121 |
27441-27445 |
IN |
denotes |
with |
T15122 |
27446-27450 |
JJ |
denotes |
wild |
T15124 |
27450-27451 |
HYPH |
denotes |
- |
T15123 |
27451-27455 |
NN |
denotes |
type |
T15125 |
27456-27460 |
NN |
denotes |
AQP2 |
T15126 |
27461-27462 |
-LRB- |
denotes |
[ |
T15127 |
27462-27463 |
CD |
denotes |
6 |
T15128 |
27463-27464 |
-RRB- |
denotes |
] |
T15129 |
27464-27466 |
, |
denotes |
, |
T15130 |
27466-27470 |
RB |
denotes |
here |
T15131 |
27471-27473 |
PRP |
denotes |
we |
T15105 |
27474-27478 |
VBP |
denotes |
show |
T15132 |
27479-27483 |
IN |
denotes |
that |
T15134 |
27484-27488 |
NN |
denotes |
AQP2 |
T15136 |
27488-27489 |
HYPH |
denotes |
- |
T15135 |
27489-27494 |
NN |
denotes |
F204V |
T15137 |
27495-27499 |
VBZ |
denotes |
does |
T15133 |
27500-27508 |
VB |
denotes |
interact |
T15138 |
27509-27513 |
IN |
denotes |
with |
T15139 |
27514-27517 |
DT |
denotes |
the |
T15141 |
27518-27522 |
JJ |
denotes |
wild |
T15143 |
27522-27523 |
HYPH |
denotes |
- |
T15142 |
27523-27527 |
NN |
denotes |
type |
T15140 |
27528-27535 |
NN |
denotes |
protein |
T15144 |
27535-27537 |
, |
denotes |
, |
T15145 |
27537-27547 |
RB |
denotes |
presumably |
T15146 |
27548-27550 |
IN |
denotes |
as |
T15147 |
27551-27555 |
NN |
denotes |
part |
T15148 |
27556-27558 |
IN |
denotes |
of |
T15149 |
27559-27574 |
NNS |
denotes |
heterotetramers |
T15150 |
27574-27576 |
, |
denotes |
, |
T15151 |
27576-27579 |
CC |
denotes |
and |
T15152 |
27580-27590 |
VBZ |
denotes |
represents |
T15153 |
27591-27592 |
DT |
denotes |
a |
T15155 |
27593-27602 |
JJ |
denotes |
rescuable |
T15154 |
27603-27609 |
NN |
denotes |
allele |
T15156 |
27609-27611 |
, |
denotes |
, |
T15157 |
27611-27615 |
CC |
denotes |
both |
T15159 |
27616-27618 |
FW |
denotes |
in |
T15158 |
27619-27624 |
FW |
denotes |
vitro |
T15160 |
27625-27628 |
CC |
denotes |
and |
T15161 |
27629-27631 |
FW |
denotes |
in |
T15162 |
27632-27636 |
FW |
denotes |
vivo |
T15163 |
27636-27637 |
. |
denotes |
. |
T15164 |
27637-27871 |
sentence |
denotes |
Immunostaining the kidneys of homozygous Aqp2F204V/F204V mice shows that the mutant-expressing collecting duct cells can not mediate water reabsorption, because it fails to insert into the apical plasma membrane in response to dDAVP. |
T15165 |
27638-27652 |
VBG |
denotes |
Immunostaining |
T15167 |
27653-27656 |
DT |
denotes |
the |
T15168 |
27657-27664 |
NNS |
denotes |
kidneys |
T15169 |
27665-27667 |
IN |
denotes |
of |
T15170 |
27668-27678 |
JJ |
denotes |
homozygous |
T15172 |
27679-27688 |
NN |
denotes |
Aqp2F204V |
T15174 |
27688-27689 |
HYPH |
denotes |
/ |
T15173 |
27689-27694 |
NN |
denotes |
F204V |
T15171 |
27695-27699 |
NNS |
denotes |
mice |
T15166 |
27700-27705 |
VBZ |
denotes |
shows |
T15175 |
27706-27710 |
IN |
denotes |
that |
T15177 |
27711-27714 |
DT |
denotes |
the |
T15179 |
27715-27721 |
NN |
denotes |
mutant |
T15181 |
27721-27722 |
HYPH |
denotes |
- |
T15180 |
27722-27732 |
VBG |
denotes |
expressing |
T15182 |
27733-27743 |
VBG |
denotes |
collecting |
T15183 |
27744-27748 |
NN |
denotes |
duct |
T15178 |
27749-27754 |
NNS |
denotes |
cells |
T15184 |
27755-27758 |
MD |
denotes |
can |
T15185 |
27759-27762 |
RB |
denotes |
not |
T15176 |
27763-27770 |
VB |
denotes |
mediate |
T15186 |
27771-27776 |
NN |
denotes |
water |
T15187 |
27777-27789 |
NN |
denotes |
reabsorption |
T15188 |
27789-27791 |
, |
denotes |
, |
T15189 |
27791-27798 |
IN |
denotes |
because |
T15191 |
27799-27801 |
PRP |
denotes |
it |
T15190 |
27802-27807 |
VBZ |
denotes |
fails |
T15192 |
27808-27810 |
TO |
denotes |
to |
T15193 |
27811-27817 |
VB |
denotes |
insert |
T15194 |
27818-27822 |
IN |
denotes |
into |
T15195 |
27823-27826 |
DT |
denotes |
the |
T15197 |
27827-27833 |
JJ |
denotes |
apical |
T15198 |
27834-27840 |
NN |
denotes |
plasma |
T15196 |
27841-27849 |
NN |
denotes |
membrane |
T15199 |
27850-27852 |
IN |
denotes |
in |
T15200 |
27853-27861 |
NN |
denotes |
response |
T15201 |
27862-27864 |
IN |
denotes |
to |
T15202 |
27865-27870 |
NN |
denotes |
dDAVP |
T15203 |
27870-27871 |
. |
denotes |
. |
T15204 |
27871-27998 |
sentence |
denotes |
This is this first in vivo proof of a long-standing hypothesis that comes from in vitro studies with recessive Aqp2 mutations. |
T15205 |
27872-27876 |
DT |
denotes |
This |
T15206 |
27877-27879 |
VBZ |
denotes |
is |
T15207 |
27880-27884 |
DT |
denotes |
this |
T15209 |
27885-27890 |
JJ |
denotes |
first |
T15210 |
27891-27893 |
FW |
denotes |
in |
T15211 |
27894-27898 |
FW |
denotes |
vivo |
T15208 |
27899-27904 |
NN |
denotes |
proof |
T15212 |
27905-27907 |
IN |
denotes |
of |
T15213 |
27908-27909 |
DT |
denotes |
a |
T15215 |
27910-27914 |
JJ |
denotes |
long |
T15217 |
27914-27915 |
HYPH |
denotes |
- |
T15216 |
27915-27923 |
VBG |
denotes |
standing |
T15214 |
27924-27934 |
NN |
denotes |
hypothesis |
T15218 |
27935-27939 |
WDT |
denotes |
that |
T15219 |
27940-27945 |
VBZ |
denotes |
comes |
T15220 |
27946-27950 |
IN |
denotes |
from |
T15221 |
27951-27953 |
FW |
denotes |
in |
T15222 |
27954-27959 |
FW |
denotes |
vitro |
T15223 |
27960-27967 |
NNS |
denotes |
studies |
T15224 |
27968-27972 |
IN |
denotes |
with |
T15225 |
27973-27982 |
JJ |
denotes |
recessive |
T15227 |
27983-27987 |
NN |
denotes |
Aqp2 |
T15226 |
27988-27997 |
NNS |
denotes |
mutations |
T15228 |
27997-27998 |
. |
denotes |
. |
T15229 |
27998-28217 |
sentence |
denotes |
Transfection into MDCK cells of any of several Aqp2 mutations corresponding to recessive human alleles shows abnormal subcellular localization [25], [27] and failure to appropriately translocate to the plasma membrane. |
T15230 |
27999-28011 |
NN |
denotes |
Transfection |
T15232 |
28012-28016 |
IN |
denotes |
into |
T15233 |
28017-28021 |
NN |
denotes |
MDCK |
T15234 |
28022-28027 |
NNS |
denotes |
cells |
T15235 |
28028-28030 |
IN |
denotes |
of |
T15236 |
28031-28034 |
DT |
denotes |
any |
T15237 |
28035-28037 |
IN |
denotes |
of |
T15238 |
28038-28045 |
JJ |
denotes |
several |
T15240 |
28046-28050 |
NN |
denotes |
Aqp2 |
T15239 |
28051-28060 |
NNS |
denotes |
mutations |
T15241 |
28061-28074 |
VBG |
denotes |
corresponding |
T15242 |
28075-28077 |
IN |
denotes |
to |
T15243 |
28078-28087 |
JJ |
denotes |
recessive |
T15245 |
28088-28093 |
JJ |
denotes |
human |
T15244 |
28094-28101 |
NNS |
denotes |
alleles |
T15231 |
28102-28107 |
VBZ |
denotes |
shows |
T15246 |
28108-28116 |
JJ |
denotes |
abnormal |
T15248 |
28117-28128 |
JJ |
denotes |
subcellular |
T15247 |
28129-28141 |
NN |
denotes |
localization |
T15249 |
28142-28143 |
-LRB- |
denotes |
[ |
T15250 |
28143-28145 |
CD |
denotes |
25 |
T15251 |
28145-28146 |
-RRB- |
denotes |
] |
T15252 |
28146-28148 |
, |
denotes |
, |
T15253 |
28148-28149 |
-LRB- |
denotes |
[ |
T15254 |
28149-28151 |
CD |
denotes |
27 |
T15255 |
28151-28152 |
-RRB- |
denotes |
] |
T15256 |
28153-28156 |
CC |
denotes |
and |
T15257 |
28157-28164 |
NN |
denotes |
failure |
T15258 |
28165-28167 |
TO |
denotes |
to |
T15260 |
28168-28181 |
RB |
denotes |
appropriately |
T15259 |
28182-28193 |
VB |
denotes |
translocate |
T15261 |
28194-28196 |
IN |
denotes |
to |
T15262 |
28197-28200 |
DT |
denotes |
the |
T15264 |
28201-28207 |
NN |
denotes |
plasma |
T15263 |
28208-28216 |
NN |
denotes |
membrane |
T15265 |
28216-28217 |
. |
denotes |
. |
T15266 |
28217-28364 |
sentence |
denotes |
Thus, misfolding, retention in the ER, and failure to translocate in response to dDAVP were proposed as the mechanism for autosomal recessive NDI. |
T15267 |
28218-28222 |
RB |
denotes |
Thus |
T15269 |
28222-28224 |
, |
denotes |
, |
T15270 |
28224-28234 |
NN |
denotes |
misfolding |
T15271 |
28234-28236 |
, |
denotes |
, |
T15272 |
28236-28245 |
NN |
denotes |
retention |
T15273 |
28246-28248 |
IN |
denotes |
in |
T15274 |
28249-28252 |
DT |
denotes |
the |
T15275 |
28253-28255 |
NN |
denotes |
ER |
T15276 |
28255-28257 |
, |
denotes |
, |
T15277 |
28257-28260 |
CC |
denotes |
and |
T15278 |
28261-28268 |
NN |
denotes |
failure |
T15279 |
28269-28271 |
TO |
denotes |
to |
T15280 |
28272-28283 |
VB |
denotes |
translocate |
T15281 |
28284-28286 |
IN |
denotes |
in |
T15282 |
28287-28295 |
NN |
denotes |
response |
T15283 |
28296-28298 |
IN |
denotes |
to |
T15284 |
28299-28304 |
NN |
denotes |
dDAVP |
T15285 |
28305-28309 |
VBD |
denotes |
were |
T15268 |
28310-28318 |
VBN |
denotes |
proposed |
T15286 |
28319-28321 |
IN |
denotes |
as |
T15287 |
28322-28325 |
DT |
denotes |
the |
T15288 |
28326-28335 |
NN |
denotes |
mechanism |
T15289 |
28336-28339 |
IN |
denotes |
for |
T15290 |
28340-28349 |
JJ |
denotes |
autosomal |
T15292 |
28350-28359 |
JJ |
denotes |
recessive |
T15291 |
28360-28363 |
NN |
denotes |
NDI |
T15293 |
28363-28364 |
. |
denotes |
. |
T15294 |
28364-28452 |
sentence |
denotes |
Here we not only prove this hypothesis but also establish a useful model for human NDI. |
T15295 |
28365-28369 |
RB |
denotes |
Here |
T15297 |
28370-28372 |
PRP |
denotes |
we |
T15298 |
28373-28376 |
RB |
denotes |
not |
T15299 |
28377-28381 |
RB |
denotes |
only |
T15296 |
28382-28387 |
VB |
denotes |
prove |
T15300 |
28388-28392 |
DT |
denotes |
this |
T15301 |
28393-28403 |
NN |
denotes |
hypothesis |
T15302 |
28404-28407 |
CC |
denotes |
but |
T15303 |
28408-28412 |
RB |
denotes |
also |
T15304 |
28413-28422 |
VB |
denotes |
establish |
T15305 |
28423-28424 |
DT |
denotes |
a |
T15307 |
28425-28431 |
JJ |
denotes |
useful |
T15306 |
28432-28437 |
NN |
denotes |
model |
T15308 |
28438-28441 |
IN |
denotes |
for |
T15309 |
28442-28447 |
JJ |
denotes |
human |
T15310 |
28448-28451 |
NN |
denotes |
NDI |
T15311 |
28451-28452 |
. |
denotes |
. |
T15312 |
28452-28638 |
sentence |
denotes |
This mouse model of NDI based on an Aqp2 allele that can be rescued provides the opportunity to test therapies, including gene therapy, that may promote proper subcellular localization. |
T15313 |
28453-28457 |
DT |
denotes |
This |
T15315 |
28458-28463 |
NN |
denotes |
mouse |
T15314 |
28464-28469 |
NN |
denotes |
model |
T15317 |
28470-28472 |
IN |
denotes |
of |
T15318 |
28473-28476 |
NN |
denotes |
NDI |
T15319 |
28477-28482 |
VBN |
denotes |
based |
T15320 |
28483-28485 |
IN |
denotes |
on |
T15321 |
28486-28488 |
DT |
denotes |
an |
T15323 |
28489-28493 |
NN |
denotes |
Aqp2 |
T15322 |
28494-28500 |
NN |
denotes |
allele |
T15324 |
28501-28505 |
WDT |
denotes |
that |
T15326 |
28506-28509 |
MD |
denotes |
can |
T15327 |
28510-28512 |
VB |
denotes |
be |
T15325 |
28513-28520 |
VBN |
denotes |
rescued |
T15316 |
28521-28529 |
VBZ |
denotes |
provides |
T15328 |
28530-28533 |
DT |
denotes |
the |
T15329 |
28534-28545 |
NN |
denotes |
opportunity |
T15330 |
28546-28548 |
TO |
denotes |
to |
T15331 |
28549-28553 |
VB |
denotes |
test |
T15332 |
28554-28563 |
NNS |
denotes |
therapies |
T15333 |
28563-28565 |
, |
denotes |
, |
T15334 |
28565-28574 |
VBG |
denotes |
including |
T15335 |
28575-28579 |
NN |
denotes |
gene |
T15336 |
28580-28587 |
NN |
denotes |
therapy |
T15337 |
28587-28589 |
, |
denotes |
, |
T15338 |
28589-28593 |
WDT |
denotes |
that |
T15340 |
28594-28597 |
MD |
denotes |
may |
T15339 |
28598-28605 |
VB |
denotes |
promote |
T15341 |
28606-28612 |
JJ |
denotes |
proper |
T15343 |
28613-28624 |
JJ |
denotes |
subcellular |
T15342 |
28625-28637 |
NN |
denotes |
localization |
T15344 |
28637-28638 |
. |
denotes |
. |
T15507 |
28663-28673 |
NN |
denotes |
Generation |
T15508 |
28674-28676 |
IN |
denotes |
of |
T15509 |
28677-28680 |
NN |
denotes |
ENU |
T15510 |
28681-28685 |
NNS |
denotes |
mice |
T15511 |
28686-28689 |
CC |
denotes |
and |
T15512 |
28690-28697 |
NN |
denotes |
housing |
T15513 |
28697-28698 |
. |
denotes |
. |
T15514 |
28698-28761 |
sentence |
denotes |
ENU mutagenized C57BL/6 mice were generated as described [19]. |
T15515 |
28699-28702 |
NN |
denotes |
ENU |
T15517 |
28703-28714 |
VBN |
denotes |
mutagenized |
T15518 |
28715-28720 |
NN |
denotes |
C57BL |
T15519 |
28720-28721 |
HYPH |
denotes |
/ |
T15520 |
28721-28722 |
CD |
denotes |
6 |
T15516 |
28723-28727 |
NNS |
denotes |
mice |
T15522 |
28728-28732 |
VBD |
denotes |
were |
T15521 |
28733-28742 |
VBN |
denotes |
generated |
T15523 |
28743-28745 |
IN |
denotes |
as |
T15524 |
28746-28755 |
VBN |
denotes |
described |
T15525 |
28756-28757 |
-LRB- |
denotes |
[ |
T15526 |
28757-28759 |
CD |
denotes |
19 |
T15527 |
28759-28760 |
-RRB- |
denotes |
] |
T15528 |
28760-28761 |
. |
denotes |
. |
T15529 |
28761-28977 |
sentence |
denotes |
Mice were maintained by backcrossing affected animals to C57BL/6 and housed in the Genomics Institute of the Novartis Research Foundation Specific Pathogen Free animal facility (La Jolla, California, United States). |
T15530 |
28762-28766 |
NNS |
denotes |
Mice |
T15532 |
28767-28771 |
VBD |
denotes |
were |
T15531 |
28772-28782 |
VBN |
denotes |
maintained |
T15533 |
28783-28785 |
IN |
denotes |
by |
T15534 |
28786-28798 |
VBG |
denotes |
backcrossing |
T15535 |
28799-28807 |
VBN |
denotes |
affected |
T15536 |
28808-28815 |
NNS |
denotes |
animals |
T15537 |
28816-28818 |
IN |
denotes |
to |
T15538 |
28819-28824 |
NN |
denotes |
C57BL |
T15539 |
28824-28825 |
HYPH |
denotes |
/ |
T15540 |
28825-28826 |
CD |
denotes |
6 |
T15541 |
28827-28830 |
CC |
denotes |
and |
T15542 |
28831-28837 |
VBN |
denotes |
housed |
T15543 |
28838-28840 |
IN |
denotes |
in |
T15544 |
28841-28844 |
DT |
denotes |
the |
T15546 |
28845-28853 |
NNP |
denotes |
Genomics |
T15545 |
28854-28863 |
NNP |
denotes |
Institute |
T15547 |
28864-28866 |
IN |
denotes |
of |
T15548 |
28867-28870 |
DT |
denotes |
the |
T15550 |
28871-28879 |
NNP |
denotes |
Novartis |
T15552 |
28880-28888 |
NNP |
denotes |
Research |
T15551 |
28889-28899 |
NNP |
denotes |
Foundation |
T15553 |
28900-28908 |
NNP |
denotes |
Specific |
T15554 |
28909-28917 |
NNP |
denotes |
Pathogen |
T15555 |
28918-28922 |
NNP |
denotes |
Free |
T15556 |
28923-28929 |
NNP |
denotes |
animal |
T15549 |
28930-28938 |
NNP |
denotes |
facility |
T15557 |
28939-28940 |
-LRB- |
denotes |
( |
T15559 |
28940-28942 |
NNP |
denotes |
La |
T15558 |
28943-28948 |
NNP |
denotes |
Jolla |
T15560 |
28948-28950 |
, |
denotes |
, |
T15561 |
28950-28960 |
NNP |
denotes |
California |
T15562 |
28960-28962 |
, |
denotes |
, |
T15563 |
28962-28968 |
NNP |
denotes |
United |
T15564 |
28969-28975 |
NNP |
denotes |
States |
T15565 |
28975-28976 |
-RRB- |
denotes |
) |
T15566 |
28976-28977 |
. |
denotes |
. |
T15567 |
28977-29113 |
sentence |
denotes |
All procedures were approved by the Genomics Institute of the Novartis Research Foundation Institutional Animal Care and Use Committee. |
T15568 |
28978-28981 |
DT |
denotes |
All |
T15569 |
28982-28992 |
NNS |
denotes |
procedures |
T15571 |
28993-28997 |
VBD |
denotes |
were |
T15570 |
28998-29006 |
VBN |
denotes |
approved |
T15572 |
29007-29009 |
IN |
denotes |
by |
T15573 |
29010-29013 |
DT |
denotes |
the |
T15575 |
29014-29022 |
NNP |
denotes |
Genomics |
T15574 |
29023-29032 |
NNP |
denotes |
Institute |
T15576 |
29033-29035 |
IN |
denotes |
of |
T15577 |
29036-29039 |
DT |
denotes |
the |
T15579 |
29040-29048 |
NNP |
denotes |
Novartis |
T15581 |
29049-29057 |
NNP |
denotes |
Research |
T15580 |
29058-29068 |
NNP |
denotes |
Foundation |
T15582 |
29069-29082 |
NNP |
denotes |
Institutional |
T15583 |
29083-29089 |
NNP |
denotes |
Animal |
T15584 |
29090-29094 |
NNP |
denotes |
Care |
T15585 |
29095-29098 |
CC |
denotes |
and |
T15586 |
29099-29102 |
NNP |
denotes |
Use |
T15578 |
29103-29112 |
NNP |
denotes |
Committee |
T15587 |
29112-29113 |
. |
denotes |
. |
T15900 |
29115-29125 |
NNS |
denotes |
Constructs |
T15901 |
29125-29126 |
. |
denotes |
. |
T15902 |
29126-29328 |
sentence |
denotes |
The complete coding sequence of mouse AQP2 from an IMAGE clone was digested from the pCMV⋅SPORT6 plasmid with EcoRI and NotI and ligated into pcDNA3.1 (Invitrogen, Carlsbad, California, United States). |
T15903 |
29127-29130 |
DT |
denotes |
The |
T15905 |
29131-29139 |
JJ |
denotes |
complete |
T15906 |
29140-29146 |
NN |
denotes |
coding |
T15904 |
29147-29155 |
NN |
denotes |
sequence |
T15908 |
29156-29158 |
IN |
denotes |
of |
T15909 |
29159-29164 |
NN |
denotes |
mouse |
T15910 |
29165-29169 |
NN |
denotes |
AQP2 |
T15911 |
29170-29174 |
IN |
denotes |
from |
T15912 |
29175-29177 |
DT |
denotes |
an |
T15914 |
29178-29183 |
NN |
denotes |
IMAGE |
T15913 |
29184-29189 |
NN |
denotes |
clone |
T15915 |
29190-29193 |
VBD |
denotes |
was |
T15907 |
29194-29202 |
VBN |
denotes |
digested |
T15916 |
29203-29207 |
IN |
denotes |
from |
T15917 |
29208-29211 |
DT |
denotes |
the |
T15919 |
29212-29223 |
NN |
denotes |
pCMV⋅SPORT6 |
T15918 |
29224-29231 |
NN |
denotes |
plasmid |
T15920 |
29232-29236 |
IN |
denotes |
with |
T15921 |
29237-29242 |
NN |
denotes |
EcoRI |
T15922 |
29243-29246 |
CC |
denotes |
and |
T15923 |
29247-29251 |
NN |
denotes |
NotI |
T15924 |
29252-29255 |
CC |
denotes |
and |
T15925 |
29256-29263 |
VBN |
denotes |
ligated |
T15926 |
29264-29268 |
IN |
denotes |
into |
T15927 |
29269-29277 |
NN |
denotes |
pcDNA3.1 |
T15928 |
29278-29279 |
-LRB- |
denotes |
( |
T15929 |
29279-29289 |
NNP |
denotes |
Invitrogen |
T15930 |
29289-29291 |
, |
denotes |
, |
T15931 |
29291-29299 |
NNP |
denotes |
Carlsbad |
T15932 |
29299-29301 |
, |
denotes |
, |
T15933 |
29301-29311 |
NNP |
denotes |
California |
T15934 |
29311-29313 |
, |
denotes |
, |
T15935 |
29313-29319 |
NNP |
denotes |
United |
T15936 |
29320-29326 |
NNP |
denotes |
States |
T15937 |
29326-29327 |
-RRB- |
denotes |
) |
T15938 |
29327-29328 |
. |
denotes |
. |
T15939 |
29328-29582 |
sentence |
denotes |
The F204V mutation was introduced by site-directed mutagenesis (Stratagene, La Jolla, California, United States), using the sense oligonucleotide 5′-GATGATCACTGGGTCGTCTGGATCGGACCCC-3′, and antisense oligonucleotide 5′-GGGGTCCGATCCAGACGACCCAGTGATCATC-3′. |
T15940 |
29329-29332 |
DT |
denotes |
The |
T15942 |
29333-29338 |
NN |
denotes |
F204V |
T15941 |
29339-29347 |
NN |
denotes |
mutation |
T15944 |
29348-29351 |
VBD |
denotes |
was |
T15943 |
29352-29362 |
VBN |
denotes |
introduced |
T15945 |
29363-29365 |
IN |
denotes |
by |
T15946 |
29366-29370 |
NN |
denotes |
site |
T15948 |
29370-29371 |
HYPH |
denotes |
- |
T15947 |
29371-29379 |
JJ |
denotes |
directed |
T15949 |
29380-29391 |
NN |
denotes |
mutagenesis |
T15950 |
29392-29393 |
-LRB- |
denotes |
( |
T15951 |
29393-29403 |
NNP |
denotes |
Stratagene |
T15952 |
29403-29405 |
, |
denotes |
, |
T15953 |
29405-29407 |
NNP |
denotes |
La |
T15954 |
29408-29413 |
NNP |
denotes |
Jolla |
T15955 |
29413-29415 |
, |
denotes |
, |
T15956 |
29415-29425 |
NNP |
denotes |
California |
T15957 |
29425-29427 |
, |
denotes |
, |
T15958 |
29427-29433 |
NNP |
denotes |
United |
T15959 |
29434-29440 |
NNP |
denotes |
States |
T15960 |
29440-29441 |
-RRB- |
denotes |
) |
T15961 |
29441-29443 |
, |
denotes |
, |
T15962 |
29443-29448 |
VBG |
denotes |
using |
T15963 |
29449-29452 |
DT |
denotes |
the |
T15965 |
29453-29458 |
NN |
denotes |
sense |
T15964 |
29459-29474 |
NN |
denotes |
oligonucleotide |
T15966 |
29475-29476 |
CD |
denotes |
5 |
T15968 |
29476-29477 |
SYM |
denotes |
′ |
T15969 |
29477-29478 |
HYPH |
denotes |
- |
T15967 |
29478-29509 |
NN |
denotes |
GATGATCACTGGGTCGTCTGGATCGGACCCC |
T15970 |
29509-29510 |
HYPH |
denotes |
- |
T15971 |
29510-29511 |
CD |
denotes |
3 |
T15972 |
29511-29512 |
SYM |
denotes |
′ |
T15973 |
29512-29514 |
, |
denotes |
, |
T15974 |
29514-29517 |
CC |
denotes |
and |
T15975 |
29518-29527 |
JJ |
denotes |
antisense |
T15976 |
29528-29543 |
NN |
denotes |
oligonucleotide |
T15977 |
29544-29545 |
CD |
denotes |
5 |
T15979 |
29545-29546 |
SYM |
denotes |
′ |
T15980 |
29546-29547 |
HYPH |
denotes |
- |
T15978 |
29547-29578 |
NN |
denotes |
GGGGTCCGATCCAGACGACCCAGTGATCATC |
T15981 |
29578-29579 |
HYPH |
denotes |
- |
T15982 |
29579-29580 |
CD |
denotes |
3 |
T15983 |
29580-29581 |
SYM |
denotes |
′ |
T15984 |
29581-29582 |
. |
denotes |
. |
T15985 |
29582-29771 |
sentence |
denotes |
To generate GFP fusions of AQP2, the pCMV⋅SPORT6 AQP2 construct was used in a PCR reaction with the primers Sp6 and 5′-GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG-3′ to remove the stop codon of AQP2. |
T15986 |
29583-29585 |
TO |
denotes |
To |
T15987 |
29586-29594 |
VB |
denotes |
generate |
T15989 |
29595-29598 |
NN |
denotes |
GFP |
T15990 |
29599-29606 |
NNS |
denotes |
fusions |
T15991 |
29607-29609 |
IN |
denotes |
of |
T15992 |
29610-29614 |
NN |
denotes |
AQP2 |
T15993 |
29614-29616 |
, |
denotes |
, |
T15994 |
29616-29619 |
DT |
denotes |
the |
T15996 |
29620-29631 |
NN |
denotes |
pCMV⋅SPORT6 |
T15997 |
29632-29636 |
NN |
denotes |
AQP2 |
T15995 |
29637-29646 |
NN |
denotes |
construct |
T15998 |
29647-29650 |
VBD |
denotes |
was |
T15988 |
29651-29655 |
VBN |
denotes |
used |
T15999 |
29656-29658 |
IN |
denotes |
in |
T16000 |
29659-29660 |
DT |
denotes |
a |
T16002 |
29661-29664 |
NN |
denotes |
PCR |
T16001 |
29665-29673 |
NN |
denotes |
reaction |
T16003 |
29674-29678 |
IN |
denotes |
with |
T16004 |
29679-29682 |
DT |
denotes |
the |
T16006 |
29683-29690 |
NNS |
denotes |
primers |
T16005 |
29691-29694 |
NN |
denotes |
Sp6 |
T16007 |
29695-29698 |
CC |
denotes |
and |
T16008 |
29699-29700 |
CD |
denotes |
5 |
T16010 |
29700-29701 |
SYM |
denotes |
′ |
T16011 |
29701-29702 |
HYPH |
denotes |
- |
T16009 |
29702-29734 |
NN |
denotes |
GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
T16012 |
29734-29735 |
HYPH |
denotes |
- |
T16013 |
29735-29736 |
CD |
denotes |
3 |
T16014 |
29736-29737 |
SYM |
denotes |
′ |
T16015 |
29738-29740 |
TO |
denotes |
to |
T16016 |
29741-29747 |
VB |
denotes |
remove |
T16017 |
29748-29751 |
DT |
denotes |
the |
T16019 |
29752-29756 |
NN |
denotes |
stop |
T16018 |
29757-29762 |
NN |
denotes |
codon |
T16020 |
29763-29765 |
IN |
denotes |
of |
T16021 |
29766-29770 |
NN |
denotes |
AQP2 |
T16022 |
29770-29771 |
. |
denotes |
. |
T16023 |
29771-29898 |
sentence |
denotes |
The product was digested with KpnI and BamHI and ligated into pEGFP-N2 (BD Biosciences, San Diego, California, United States). |
T16024 |
29772-29775 |
DT |
denotes |
The |
T16025 |
29776-29783 |
NN |
denotes |
product |
T16027 |
29784-29787 |
VBD |
denotes |
was |
T16026 |
29788-29796 |
VBN |
denotes |
digested |
T16028 |
29797-29801 |
IN |
denotes |
with |
T16029 |
29802-29806 |
NN |
denotes |
KpnI |
T16030 |
29807-29810 |
CC |
denotes |
and |
T16031 |
29811-29816 |
NN |
denotes |
BamHI |
T16032 |
29817-29820 |
CC |
denotes |
and |
T16033 |
29821-29828 |
VBN |
denotes |
ligated |
T16034 |
29829-29833 |
IN |
denotes |
into |
T16035 |
29834-29839 |
NN |
denotes |
pEGFP |
T16037 |
29839-29840 |
HYPH |
denotes |
- |
T16036 |
29840-29842 |
NN |
denotes |
N2 |
T16038 |
29843-29844 |
-LRB- |
denotes |
( |
T16040 |
29844-29846 |
NN |
denotes |
BD |
T16039 |
29847-29858 |
NNP |
denotes |
Biosciences |
T16041 |
29858-29860 |
, |
denotes |
, |
T16042 |
29860-29863 |
NNP |
denotes |
San |
T16043 |
29864-29869 |
NNP |
denotes |
Diego |
T16044 |
29869-29871 |
, |
denotes |
, |
T16045 |
29871-29881 |
NNP |
denotes |
California |
T16046 |
29881-29883 |
, |
denotes |
, |
T16047 |
29883-29889 |
NNP |
denotes |
United |
T16048 |
29890-29896 |
NNP |
denotes |
States |
T16049 |
29896-29897 |
-RRB- |
denotes |
) |
T16050 |
29897-29898 |
. |
denotes |
. |
T16051 |
29898-29975 |
sentence |
denotes |
The F204V mutation was introduced using the same mutagenic oligonucleotides. |
T16052 |
29899-29902 |
DT |
denotes |
The |
T16054 |
29903-29908 |
NN |
denotes |
F204V |
T16053 |
29909-29917 |
NN |
denotes |
mutation |
T16056 |
29918-29921 |
VBD |
denotes |
was |
T16055 |
29922-29932 |
VBN |
denotes |
introduced |
T16057 |
29933-29938 |
VBG |
denotes |
using |
T16058 |
29939-29942 |
DT |
denotes |
the |
T16060 |
29943-29947 |
JJ |
denotes |
same |
T16061 |
29948-29957 |
JJ |
denotes |
mutagenic |
T16059 |
29958-29974 |
NNS |
denotes |
oligonucleotides |
T16062 |
29974-29975 |
. |
denotes |
. |
T16399 |
29977-29981 |
NN |
denotes |
Cell |
T16400 |
29982-29989 |
NN |
denotes |
culture |
T16401 |
29990-29993 |
CC |
denotes |
and |
T16402 |
29994-30004 |
NN |
denotes |
generation |
T16403 |
30005-30007 |
IN |
denotes |
of |
T16404 |
30008-30014 |
JJ |
denotes |
stable |
T16406 |
30015-30019 |
NN |
denotes |
cell |
T16405 |
30020-30025 |
NNS |
denotes |
lines |
T16407 |
30025-30026 |
. |
denotes |
. |
T16408 |
30026-30278 |
sentence |
denotes |
MDCK cells (CCL-34; ATCC, Manassas, Virginia, United States) were cultured in DMEM (Sigma-Aldrich, St. Louis, Missouri, United States) supplemented with 10% FBS (Sigma-Aldrich), 100 U/ml of penicillin, and 100 μg/ml of streptomycin at 37 °C in 5% CO2. |
T16409 |
30027-30031 |
NN |
denotes |
MDCK |
T16410 |
30032-30037 |
NNS |
denotes |
cells |
T16412 |
30038-30039 |
-LRB- |
denotes |
( |
T16414 |
30039-30042 |
NN |
denotes |
CCL |
T16415 |
30042-30043 |
HYPH |
denotes |
- |
T16416 |
30043-30045 |
CD |
denotes |
34 |
T16417 |
30045-30046 |
: |
denotes |
; |
T16413 |
30047-30051 |
NN |
denotes |
ATCC |
T16418 |
30051-30053 |
, |
denotes |
, |
T16419 |
30053-30061 |
NNP |
denotes |
Manassas |
T16420 |
30061-30063 |
, |
denotes |
, |
T16421 |
30063-30071 |
NNP |
denotes |
Virginia |
T16422 |
30071-30073 |
, |
denotes |
, |
T16423 |
30073-30079 |
NNP |
denotes |
United |
T16424 |
30080-30086 |
NNP |
denotes |
States |
T16425 |
30086-30087 |
-RRB- |
denotes |
) |
T16426 |
30088-30092 |
VBD |
denotes |
were |
T16411 |
30093-30101 |
VBN |
denotes |
cultured |
T16427 |
30102-30104 |
IN |
denotes |
in |
T16428 |
30105-30109 |
NN |
denotes |
DMEM |
T16429 |
30110-30111 |
-LRB- |
denotes |
( |
T16431 |
30111-30116 |
NNP |
denotes |
Sigma |
T16432 |
30116-30117 |
HYPH |
denotes |
- |
T16430 |
30117-30124 |
NNP |
denotes |
Aldrich |
T16433 |
30124-30126 |
, |
denotes |
, |
T16434 |
30126-30129 |
NNP |
denotes |
St. |
T16435 |
30130-30135 |
NNP |
denotes |
Louis |
T16436 |
30135-30137 |
, |
denotes |
, |
T16437 |
30137-30145 |
NNP |
denotes |
Missouri |
T16438 |
30145-30147 |
, |
denotes |
, |
T16439 |
30147-30153 |
NNP |
denotes |
United |
T16440 |
30154-30160 |
NNP |
denotes |
States |
T16441 |
30160-30161 |
-RRB- |
denotes |
) |
T16442 |
30162-30174 |
VBN |
denotes |
supplemented |
T16443 |
30175-30179 |
IN |
denotes |
with |
T16444 |
30180-30182 |
CD |
denotes |
10 |
T16445 |
30182-30183 |
NN |
denotes |
% |
T16446 |
30184-30187 |
NN |
denotes |
FBS |
T16447 |
30188-30189 |
-LRB- |
denotes |
( |
T16449 |
30189-30194 |
NNP |
denotes |
Sigma |
T16450 |
30194-30195 |
HYPH |
denotes |
- |
T16448 |
30195-30202 |
NNP |
denotes |
Aldrich |
T16451 |
30202-30203 |
-RRB- |
denotes |
) |
T16452 |
30203-30205 |
, |
denotes |
, |
T16453 |
30205-30208 |
CD |
denotes |
100 |
T16454 |
30209-30210 |
NN |
denotes |
U |
T16455 |
30210-30211 |
SYM |
denotes |
/ |
T16456 |
30211-30213 |
NN |
denotes |
ml |
T16457 |
30214-30216 |
IN |
denotes |
of |
T16458 |
30217-30227 |
NN |
denotes |
penicillin |
T16459 |
30227-30229 |
, |
denotes |
, |
T16460 |
30229-30232 |
CC |
denotes |
and |
T16461 |
30233-30236 |
CD |
denotes |
100 |
T16462 |
30237-30239 |
NN |
denotes |
μg |
T16463 |
30239-30240 |
SYM |
denotes |
/ |
T16464 |
30240-30242 |
NN |
denotes |
ml |
T16465 |
30243-30245 |
IN |
denotes |
of |
T16466 |
30246-30258 |
NN |
denotes |
streptomycin |
T16467 |
30259-30261 |
IN |
denotes |
at |
T16468 |
30262-30264 |
CD |
denotes |
37 |
T16469 |
30265-30267 |
NN |
denotes |
°C |
T16470 |
30268-30270 |
IN |
denotes |
in |
T16471 |
30271-30272 |
CD |
denotes |
5 |
T16472 |
30272-30273 |
NN |
denotes |
% |
T16473 |
30274-30277 |
NN |
denotes |
CO2 |
T16474 |
30277-30278 |
. |
denotes |
. |
T16475 |
30278-30518 |
sentence |
denotes |
To generate stable MDCK cell lines, cells were transfected using Lipofectamine 2000 (Invitrogen) and the pcDNA3.1 expression constructs (containing wild-type AQP2, AQP2-F204V, or no insert) and selected with 900 μg/ml G418 (Sigma-Aldrich). |
T16476 |
30279-30281 |
TO |
denotes |
To |
T16477 |
30282-30290 |
VB |
denotes |
generate |
T16479 |
30291-30297 |
JJ |
denotes |
stable |
T16481 |
30298-30302 |
NN |
denotes |
MDCK |
T16482 |
30303-30307 |
NN |
denotes |
cell |
T16480 |
30308-30313 |
NNS |
denotes |
lines |
T16483 |
30313-30315 |
, |
denotes |
, |
T16484 |
30315-30320 |
NNS |
denotes |
cells |
T16485 |
30321-30325 |
VBD |
denotes |
were |
T16478 |
30326-30337 |
VBN |
denotes |
transfected |
T16486 |
30338-30343 |
VBG |
denotes |
using |
T16487 |
30344-30357 |
NN |
denotes |
Lipofectamine |
T16488 |
30358-30362 |
CD |
denotes |
2000 |
T16489 |
30363-30364 |
-LRB- |
denotes |
( |
T16490 |
30364-30374 |
NNP |
denotes |
Invitrogen |
T16491 |
30374-30375 |
-RRB- |
denotes |
) |
T16492 |
30376-30379 |
CC |
denotes |
and |
T16493 |
30380-30383 |
DT |
denotes |
the |
T16495 |
30384-30392 |
NN |
denotes |
pcDNA3.1 |
T16496 |
30393-30403 |
NN |
denotes |
expression |
T16494 |
30404-30414 |
NNS |
denotes |
constructs |
T16497 |
30415-30416 |
-LRB- |
denotes |
( |
T16498 |
30416-30426 |
VBG |
denotes |
containing |
T16499 |
30427-30431 |
JJ |
denotes |
wild |
T16501 |
30431-30432 |
HYPH |
denotes |
- |
T16500 |
30432-30436 |
NN |
denotes |
type |
T16502 |
30437-30441 |
NN |
denotes |
AQP2 |
T16503 |
30441-30443 |
, |
denotes |
, |
T16504 |
30443-30447 |
NN |
denotes |
AQP2 |
T16506 |
30447-30448 |
HYPH |
denotes |
- |
T16505 |
30448-30453 |
NN |
denotes |
F204V |
T16507 |
30453-30455 |
, |
denotes |
, |
T16508 |
30455-30457 |
CC |
denotes |
or |
T16509 |
30458-30460 |
DT |
denotes |
no |
T16510 |
30461-30467 |
NN |
denotes |
insert |
T16511 |
30467-30468 |
-RRB- |
denotes |
) |
T16512 |
30469-30472 |
CC |
denotes |
and |
T16513 |
30473-30481 |
VBN |
denotes |
selected |
T16514 |
30482-30486 |
IN |
denotes |
with |
T16515 |
30487-30490 |
CD |
denotes |
900 |
T16516 |
30491-30493 |
NN |
denotes |
μg |
T16518 |
30493-30494 |
SYM |
denotes |
/ |
T16519 |
30494-30496 |
NN |
denotes |
ml |
T16517 |
30497-30501 |
NN |
denotes |
G418 |
T16520 |
30502-30503 |
-LRB- |
denotes |
( |
T16522 |
30503-30508 |
NNP |
denotes |
Sigma |
T16523 |
30508-30509 |
HYPH |
denotes |
- |
T16521 |
30509-30516 |
NNP |
denotes |
Aldrich |
T16524 |
30516-30517 |
-RRB- |
denotes |
) |
T16525 |
30517-30518 |
. |
denotes |
. |
T16526 |
30518-30564 |
sentence |
denotes |
Individual colonies were expanded 14 d later. |
T16527 |
30519-30529 |
JJ |
denotes |
Individual |
T16528 |
30530-30538 |
NNS |
denotes |
colonies |
T16530 |
30539-30543 |
VBD |
denotes |
were |
T16529 |
30544-30552 |
VBN |
denotes |
expanded |
T16531 |
30553-30555 |
CD |
denotes |
14 |
T16532 |
30556-30557 |
NN |
denotes |
d |
T16533 |
30558-30563 |
RB |
denotes |
later |
T16534 |
30563-30564 |
. |
denotes |
. |
T16535 |
30564-30654 |
sentence |
denotes |
For the duration of these experiments, the antibiotic was continually added to the media. |
T16536 |
30565-30568 |
IN |
denotes |
For |
T16538 |
30569-30572 |
DT |
denotes |
the |
T16539 |
30573-30581 |
NN |
denotes |
duration |
T16540 |
30582-30584 |
IN |
denotes |
of |
T16541 |
30585-30590 |
DT |
denotes |
these |
T16542 |
30591-30602 |
NNS |
denotes |
experiments |
T16543 |
30602-30604 |
, |
denotes |
, |
T16544 |
30604-30607 |
DT |
denotes |
the |
T16545 |
30608-30618 |
NN |
denotes |
antibiotic |
T16546 |
30619-30622 |
VBD |
denotes |
was |
T16547 |
30623-30634 |
RB |
denotes |
continually |
T16537 |
30635-30640 |
VBN |
denotes |
added |
T16548 |
30641-30643 |
IN |
denotes |
to |
T16549 |
30644-30647 |
DT |
denotes |
the |
T16550 |
30648-30653 |
NNS |
denotes |
media |
T16551 |
30653-30654 |
. |
denotes |
. |
T16552 |
30654-30765 |
sentence |
denotes |
Transient GFP transfections were carried out in subconfluent stable cells lines also using Lipofectamine 2000. |
T16553 |
30655-30664 |
JJ |
denotes |
Transient |
T16555 |
30665-30668 |
NN |
denotes |
GFP |
T16554 |
30669-30682 |
NNS |
denotes |
transfections |
T16557 |
30683-30687 |
VBD |
denotes |
were |
T16556 |
30688-30695 |
VBN |
denotes |
carried |
T16558 |
30696-30699 |
RP |
denotes |
out |
T16559 |
30700-30702 |
IN |
denotes |
in |
T16560 |
30703-30715 |
JJ |
denotes |
subconfluent |
T16562 |
30716-30722 |
JJ |
denotes |
stable |
T16563 |
30723-30728 |
NNS |
denotes |
cells |
T16561 |
30729-30734 |
NNS |
denotes |
lines |
T16564 |
30735-30739 |
RB |
denotes |
also |
T16565 |
30740-30745 |
VBG |
denotes |
using |
T16566 |
30746-30759 |
NN |
denotes |
Lipofectamine |
T16567 |
30760-30764 |
CD |
denotes |
2000 |
T16568 |
30764-30765 |
. |
denotes |
. |
T16676 |
30767-30777 |
NN |
denotes |
Sequencing |
T16677 |
30778-30780 |
IN |
denotes |
of |
T16678 |
30781-30785 |
NN |
denotes |
Aqp2 |
T16679 |
30786-30789 |
CC |
denotes |
and |
T16680 |
30790-30800 |
NN |
denotes |
genotyping |
T16681 |
30801-30803 |
IN |
denotes |
of |
T16682 |
30804-30808 |
NNS |
denotes |
mice |
T16683 |
30808-30809 |
. |
denotes |
. |
T16684 |
30809-30880 |
sentence |
denotes |
All exons of Aqp2 were amplified from mouse genomic DNA and sequenced. |
T16685 |
30810-30813 |
DT |
denotes |
All |
T16686 |
30814-30819 |
NNS |
denotes |
exons |
T16688 |
30820-30822 |
IN |
denotes |
of |
T16689 |
30823-30827 |
NN |
denotes |
Aqp2 |
T16690 |
30828-30832 |
VBD |
denotes |
were |
T16687 |
30833-30842 |
VBN |
denotes |
amplified |
T16691 |
30843-30847 |
IN |
denotes |
from |
T16692 |
30848-30853 |
NN |
denotes |
mouse |
T16694 |
30854-30861 |
JJ |
denotes |
genomic |
T16693 |
30862-30865 |
NN |
denotes |
DNA |
T16695 |
30866-30869 |
CC |
denotes |
and |
T16696 |
30870-30879 |
VBN |
denotes |
sequenced |
T16697 |
30879-30880 |
. |
denotes |
. |
T16698 |
30880-30994 |
sentence |
denotes |
For genotyping, exon 4 was amplified using the primers 5′-TCAGAACTTGCCCACTAGCC-3′ and 5′-TGTAGAGGAGGGAACCGATG-3′. |
T16699 |
30881-30884 |
IN |
denotes |
For |
T16701 |
30885-30895 |
NN |
denotes |
genotyping |
T16702 |
30895-30897 |
, |
denotes |
, |
T16703 |
30897-30901 |
NN |
denotes |
exon |
T16704 |
30902-30903 |
CD |
denotes |
4 |
T16705 |
30904-30907 |
VBD |
denotes |
was |
T16700 |
30908-30917 |
VBN |
denotes |
amplified |
T16706 |
30918-30923 |
VBG |
denotes |
using |
T16707 |
30924-30927 |
DT |
denotes |
the |
T16708 |
30928-30935 |
NNS |
denotes |
primers |
T16709 |
30936-30937 |
CD |
denotes |
5 |
T16711 |
30937-30938 |
SYM |
denotes |
′ |
T16712 |
30938-30939 |
HYPH |
denotes |
- |
T16710 |
30939-30959 |
NN |
denotes |
TCAGAACTTGCCCACTAGCC |
T16713 |
30959-30960 |
HYPH |
denotes |
- |
T16714 |
30960-30961 |
CD |
denotes |
3 |
T16715 |
30961-30962 |
SYM |
denotes |
′ |
T16716 |
30963-30966 |
CC |
denotes |
and |
T16717 |
30967-30968 |
CD |
denotes |
5 |
T16719 |
30968-30969 |
SYM |
denotes |
′ |
T16720 |
30969-30970 |
HYPH |
denotes |
- |
T16718 |
30970-30990 |
NN |
denotes |
TGTAGAGGAGGGAACCGATG |
T16721 |
30990-30991 |
HYPH |
denotes |
- |
T16722 |
30991-30992 |
CD |
denotes |
3 |
T16723 |
30992-30993 |
SYM |
denotes |
′ |
T16724 |
30993-30994 |
. |
denotes |
. |
T16959 |
30996-31001 |
NN |
denotes |
Urine |
T16960 |
31002-31014 |
NNS |
denotes |
measurements |
T16961 |
31014-31015 |
. |
denotes |
. |
T16962 |
31015-31199 |
sentence |
denotes |
Total urine output was measured by separately housing adult mice in Nalgene Metabolic Cages (Minimitter, Bend, Oregon, United States) for 2–3 d and collecting urine every 24 h period. |
T16963 |
31016-31021 |
JJ |
denotes |
Total |
T16965 |
31022-31027 |
NN |
denotes |
urine |
T16964 |
31028-31034 |
NN |
denotes |
output |
T16967 |
31035-31038 |
VBD |
denotes |
was |
T16966 |
31039-31047 |
VBN |
denotes |
measured |
T16968 |
31048-31050 |
IN |
denotes |
by |
T16969 |
31051-31061 |
RB |
denotes |
separately |
T16970 |
31062-31069 |
VBG |
denotes |
housing |
T16971 |
31070-31075 |
JJ |
denotes |
adult |
T16972 |
31076-31080 |
NNS |
denotes |
mice |
T16973 |
31081-31083 |
IN |
denotes |
in |
T16974 |
31084-31091 |
NNP |
denotes |
Nalgene |
T16976 |
31092-31101 |
JJ |
denotes |
Metabolic |
T16975 |
31102-31107 |
NNS |
denotes |
Cages |
T16977 |
31108-31109 |
-LRB- |
denotes |
( |
T16978 |
31109-31119 |
NNP |
denotes |
Minimitter |
T16979 |
31119-31121 |
, |
denotes |
, |
T16980 |
31121-31125 |
NNP |
denotes |
Bend |
T16981 |
31125-31127 |
, |
denotes |
, |
T16982 |
31127-31133 |
NNP |
denotes |
Oregon |
T16983 |
31133-31135 |
, |
denotes |
, |
T16984 |
31135-31141 |
NNP |
denotes |
United |
T16985 |
31142-31148 |
NNP |
denotes |
States |
T16986 |
31148-31149 |
-RRB- |
denotes |
) |
T16987 |
31150-31153 |
IN |
denotes |
for |
T16988 |
31154-31155 |
CD |
denotes |
2 |
T16990 |
31155-31156 |
SYM |
denotes |
– |
T16989 |
31156-31157 |
CD |
denotes |
3 |
T16991 |
31158-31159 |
NN |
denotes |
d |
T16992 |
31160-31163 |
CC |
denotes |
and |
T16993 |
31164-31174 |
VBG |
denotes |
collecting |
T16994 |
31175-31180 |
NN |
denotes |
urine |
T16995 |
31181-31186 |
DT |
denotes |
every |
T16997 |
31187-31189 |
CD |
denotes |
24 |
T16998 |
31190-31191 |
NN |
denotes |
h |
T16996 |
31192-31198 |
NN |
denotes |
period |
T16999 |
31198-31199 |
. |
denotes |
. |
T17000 |
31199-31326 |
sentence |
denotes |
Urine osmolalities were determined using an Osmometer (Osmette 5004; Precision Systems, Natick, Massachusetts, United States). |
T17001 |
31200-31205 |
NN |
denotes |
Urine |
T17002 |
31206-31218 |
NNS |
denotes |
osmolalities |
T17004 |
31219-31223 |
VBD |
denotes |
were |
T17003 |
31224-31234 |
VBN |
denotes |
determined |
T17005 |
31235-31240 |
VBG |
denotes |
using |
T17006 |
31241-31243 |
DT |
denotes |
an |
T17007 |
31244-31253 |
NN |
denotes |
Osmometer |
T17008 |
31254-31255 |
-LRB- |
denotes |
( |
T17010 |
31255-31262 |
NNP |
denotes |
Osmette |
T17011 |
31263-31267 |
CD |
denotes |
5004 |
T17012 |
31267-31268 |
: |
denotes |
; |
T17013 |
31269-31278 |
NNP |
denotes |
Precision |
T17009 |
31279-31286 |
NNP |
denotes |
Systems |
T17014 |
31286-31288 |
, |
denotes |
, |
T17015 |
31288-31294 |
NNP |
denotes |
Natick |
T17016 |
31294-31296 |
, |
denotes |
, |
T17017 |
31296-31309 |
NNP |
denotes |
Massachusetts |
T17018 |
31309-31311 |
, |
denotes |
, |
T17019 |
31311-31317 |
NNP |
denotes |
United |
T17020 |
31318-31324 |
NNP |
denotes |
States |
T17021 |
31324-31325 |
-RRB- |
denotes |
) |
T17022 |
31325-31326 |
. |
denotes |
. |
T17023 |
31326-31426 |
sentence |
denotes |
Urine concentrating experiments were carried out by intraperitoneal injection of dDAVP (0.4 μg/kg). |
T17024 |
31327-31332 |
NN |
denotes |
Urine |
T17025 |
31333-31346 |
VBG |
denotes |
concentrating |
T17026 |
31347-31358 |
NNS |
denotes |
experiments |
T17028 |
31359-31363 |
VBD |
denotes |
were |
T17027 |
31364-31371 |
VBN |
denotes |
carried |
T17029 |
31372-31375 |
RP |
denotes |
out |
T17030 |
31376-31378 |
IN |
denotes |
by |
T17031 |
31379-31394 |
JJ |
denotes |
intraperitoneal |
T17032 |
31395-31404 |
NN |
denotes |
injection |
T17033 |
31405-31407 |
IN |
denotes |
of |
T17034 |
31408-31413 |
NN |
denotes |
dDAVP |
T17035 |
31414-31415 |
-LRB- |
denotes |
( |
T17037 |
31415-31418 |
CD |
denotes |
0.4 |
T17036 |
31419-31421 |
NN |
denotes |
μg |
T17038 |
31421-31422 |
SYM |
denotes |
/ |
T17039 |
31422-31424 |
NN |
denotes |
kg |
T17040 |
31424-31425 |
-RRB- |
denotes |
) |
T17041 |
31425-31426 |
. |
denotes |
. |
T17042 |
31426-31499 |
sentence |
denotes |
Mice were injected twice with dDAVP, once at time 0 and again at 30 min. |
T17043 |
31427-31431 |
NNS |
denotes |
Mice |
T17045 |
31432-31436 |
VBD |
denotes |
were |
T17044 |
31437-31445 |
VBN |
denotes |
injected |
T17046 |
31446-31451 |
RB |
denotes |
twice |
T17047 |
31452-31456 |
IN |
denotes |
with |
T17048 |
31457-31462 |
NN |
denotes |
dDAVP |
T17049 |
31462-31464 |
, |
denotes |
, |
T17050 |
31464-31468 |
RB |
denotes |
once |
T17051 |
31469-31471 |
IN |
denotes |
at |
T17052 |
31472-31476 |
NN |
denotes |
time |
T17053 |
31477-31478 |
CD |
denotes |
0 |
T17054 |
31479-31482 |
CC |
denotes |
and |
T17055 |
31483-31488 |
RB |
denotes |
again |
T17056 |
31489-31491 |
IN |
denotes |
at |
T17057 |
31492-31494 |
CD |
denotes |
30 |
T17058 |
31495-31498 |
NN |
denotes |
min |
T17059 |
31498-31499 |
. |
denotes |
. |
T17060 |
31499-31589 |
sentence |
denotes |
Urine was collected at the start of the experiment and 30 min after the second injection. |
T17061 |
31500-31505 |
NN |
denotes |
Urine |
T17063 |
31506-31509 |
VBD |
denotes |
was |
T17062 |
31510-31519 |
VBN |
denotes |
collected |
T17064 |
31520-31522 |
IN |
denotes |
at |
T17065 |
31523-31526 |
DT |
denotes |
the |
T17066 |
31527-31532 |
NN |
denotes |
start |
T17067 |
31533-31535 |
IN |
denotes |
of |
T17068 |
31536-31539 |
DT |
denotes |
the |
T17069 |
31540-31550 |
NN |
denotes |
experiment |
T17070 |
31551-31554 |
CC |
denotes |
and |
T17071 |
31555-31557 |
CD |
denotes |
30 |
T17072 |
31558-31561 |
NN |
denotes |
min |
T17073 |
31562-31567 |
IN |
denotes |
after |
T17074 |
31568-31571 |
DT |
denotes |
the |
T17076 |
31572-31578 |
JJ |
denotes |
second |
T17075 |
31579-31588 |
NN |
denotes |
injection |
T17077 |
31588-31589 |
. |
denotes |
. |
T17265 |
31591-31597 |
NN |
denotes |
Kidney |
T17266 |
31598-31606 |
NN |
denotes |
membrane |
T17267 |
31607-31618 |
NN |
denotes |
preparation |
T17268 |
31618-31619 |
. |
denotes |
. |
T17269 |
31619-31800 |
sentence |
denotes |
Whole mouse kidneys were homogenized in 10 mM Tris (pH 7.4), 350 mM sucrose, and 5 mM EDTA containing protease inhibitors (Sigma-Aldrich, #P-8340) in a Potter-Elvehjem homogenizer. |
T17270 |
31620-31625 |
JJ |
denotes |
Whole |
T17272 |
31626-31631 |
NN |
denotes |
mouse |
T17271 |
31632-31639 |
NNS |
denotes |
kidneys |
T17274 |
31640-31644 |
VBD |
denotes |
were |
T17273 |
31645-31656 |
VBN |
denotes |
homogenized |
T17275 |
31657-31659 |
IN |
denotes |
in |
T17276 |
31660-31662 |
CD |
denotes |
10 |
T17277 |
31663-31665 |
NN |
denotes |
mM |
T17278 |
31666-31670 |
NN |
denotes |
Tris |
T17279 |
31671-31672 |
-LRB- |
denotes |
( |
T17280 |
31672-31674 |
NN |
denotes |
pH |
T17281 |
31675-31678 |
CD |
denotes |
7.4 |
T17282 |
31678-31679 |
-RRB- |
denotes |
) |
T17283 |
31679-31681 |
, |
denotes |
, |
T17284 |
31681-31684 |
CD |
denotes |
350 |
T17285 |
31685-31687 |
NN |
denotes |
mM |
T17286 |
31688-31695 |
NN |
denotes |
sucrose |
T17287 |
31695-31697 |
, |
denotes |
, |
T17288 |
31697-31700 |
CC |
denotes |
and |
T17289 |
31701-31702 |
CD |
denotes |
5 |
T17290 |
31703-31705 |
NN |
denotes |
mM |
T17291 |
31706-31710 |
NN |
denotes |
EDTA |
T17292 |
31711-31721 |
VBG |
denotes |
containing |
T17293 |
31722-31730 |
NN |
denotes |
protease |
T17294 |
31731-31741 |
NNS |
denotes |
inhibitors |
T17295 |
31742-31743 |
-LRB- |
denotes |
( |
T17297 |
31743-31748 |
NNP |
denotes |
Sigma |
T17299 |
31748-31749 |
HYPH |
denotes |
- |
T17298 |
31749-31756 |
NNP |
denotes |
Aldrich |
T17300 |
31756-31758 |
, |
denotes |
, |
T17301 |
31758-31759 |
SYM |
denotes |
# |
T17296 |
31759-31760 |
NN |
denotes |
P |
T17302 |
31760-31761 |
HYPH |
denotes |
- |
T17303 |
31761-31765 |
CD |
denotes |
8340 |
T17304 |
31765-31766 |
-RRB- |
denotes |
) |
T17305 |
31767-31769 |
IN |
denotes |
in |
T17306 |
31770-31771 |
DT |
denotes |
a |
T17308 |
31772-31778 |
NNP |
denotes |
Potter |
T17310 |
31778-31779 |
HYPH |
denotes |
- |
T17309 |
31779-31787 |
NNP |
denotes |
Elvehjem |
T17307 |
31788-31799 |
NN |
denotes |
homogenizer |
T17311 |
31799-31800 |
. |
denotes |
. |
T17312 |
31800-31940 |
sentence |
denotes |
The homogenate was centrifuged at 2,000 g for 10 min and the supernatant was subjected to ultracentrifugation at 100,000 g for 1 h at 4 °C. |
T17313 |
31801-31804 |
DT |
denotes |
The |
T17314 |
31805-31815 |
NN |
denotes |
homogenate |
T17316 |
31816-31819 |
VBD |
denotes |
was |
T17315 |
31820-31831 |
VBN |
denotes |
centrifuged |
T17317 |
31832-31834 |
IN |
denotes |
at |
T17318 |
31835-31840 |
CD |
denotes |
2,000 |
T17319 |
31841-31842 |
NN |
denotes |
g |
T17320 |
31843-31846 |
IN |
denotes |
for |
T17321 |
31847-31849 |
CD |
denotes |
10 |
T17322 |
31850-31853 |
NN |
denotes |
min |
T17323 |
31854-31857 |
CC |
denotes |
and |
T17324 |
31858-31861 |
DT |
denotes |
the |
T17325 |
31862-31873 |
NN |
denotes |
supernatant |
T17327 |
31874-31877 |
VBD |
denotes |
was |
T17326 |
31878-31887 |
VBN |
denotes |
subjected |
T17328 |
31888-31890 |
IN |
denotes |
to |
T17329 |
31891-31910 |
NN |
denotes |
ultracentrifugation |
T17330 |
31911-31913 |
IN |
denotes |
at |
T17331 |
31914-31921 |
CD |
denotes |
100,000 |
T17332 |
31922-31923 |
NN |
denotes |
g |
T17333 |
31924-31927 |
IN |
denotes |
for |
T17334 |
31928-31929 |
CD |
denotes |
1 |
T17335 |
31930-31931 |
NN |
denotes |
h |
T17336 |
31932-31934 |
IN |
denotes |
at |
T17337 |
31935-31936 |
CD |
denotes |
4 |
T17338 |
31937-31939 |
NN |
denotes |
°C |
T17339 |
31939-31940 |
. |
denotes |
. |
T17340 |
31940-32056 |
sentence |
denotes |
Pelleted membranes were resuspended in the same buffer, and protein concentration was determined by Bradford assay. |
T17341 |
31941-31949 |
VBN |
denotes |
Pelleted |
T17342 |
31950-31959 |
NNS |
denotes |
membranes |
T17344 |
31960-31964 |
VBD |
denotes |
were |
T17343 |
31965-31976 |
VBN |
denotes |
resuspended |
T17345 |
31977-31979 |
IN |
denotes |
in |
T17346 |
31980-31983 |
DT |
denotes |
the |
T17348 |
31984-31988 |
JJ |
denotes |
same |
T17347 |
31989-31995 |
NN |
denotes |
buffer |
T17349 |
31995-31997 |
, |
denotes |
, |
T17350 |
31997-32000 |
CC |
denotes |
and |
T17351 |
32001-32008 |
NN |
denotes |
protein |
T17352 |
32009-32022 |
NN |
denotes |
concentration |
T17354 |
32023-32026 |
VBD |
denotes |
was |
T17353 |
32027-32037 |
VBN |
denotes |
determined |
T17355 |
32038-32040 |
IN |
denotes |
by |
T17356 |
32041-32049 |
NNP |
denotes |
Bradford |
T17357 |
32050-32055 |
NN |
denotes |
assay |
T17358 |
32055-32056 |
. |
denotes |
. |
T17614 |
32058-32072 |
NN |
denotes |
Immunoblotting |
T17615 |
32072-32073 |
. |
denotes |
. |
T17616 |
32073-32199 |
sentence |
denotes |
Kidney membrane fractions (60 μg) were resolved on a 12% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. |
T17617 |
32074-32080 |
NN |
denotes |
Kidney |
T17618 |
32081-32089 |
NN |
denotes |
membrane |
T17619 |
32090-32099 |
NNS |
denotes |
fractions |
T17621 |
32100-32101 |
-LRB- |
denotes |
( |
T17623 |
32101-32103 |
CD |
denotes |
60 |
T17622 |
32104-32106 |
NN |
denotes |
μg |
T17624 |
32106-32107 |
-RRB- |
denotes |
) |
T17625 |
32108-32112 |
VBD |
denotes |
were |
T17620 |
32113-32121 |
VBN |
denotes |
resolved |
T17626 |
32122-32124 |
IN |
denotes |
on |
T17627 |
32125-32126 |
DT |
denotes |
a |
T17629 |
32127-32129 |
CD |
denotes |
12 |
T17630 |
32129-32130 |
NN |
denotes |
% |
T17631 |
32131-32134 |
NN |
denotes |
SDS |
T17633 |
32134-32135 |
HYPH |
denotes |
- |
T17632 |
32135-32149 |
NN |
denotes |
polyacrylamide |
T17628 |
32150-32153 |
NN |
denotes |
gel |
T17634 |
32154-32157 |
CC |
denotes |
and |
T17635 |
32158-32169 |
VBN |
denotes |
transferred |
T17636 |
32170-32172 |
IN |
denotes |
to |
T17637 |
32173-32174 |
DT |
denotes |
a |
T17639 |
32175-32189 |
NN |
denotes |
nitrocellulose |
T17638 |
32190-32198 |
NN |
denotes |
membrane |
T17640 |
32198-32199 |
. |
denotes |
. |
T17641 |
32199-32445 |
sentence |
denotes |
Membranes were blocked in 5% nonfat milk in Tris-buffered saline with 0.05% Tween 20 (TBST), followed by an overnight incubation (at 4 °C) with AQP2 polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, California, United States; #sc-9882). |
T17642 |
32200-32209 |
NNS |
denotes |
Membranes |
T17644 |
32210-32214 |
VBD |
denotes |
were |
T17643 |
32215-32222 |
VBN |
denotes |
blocked |
T17645 |
32223-32225 |
IN |
denotes |
in |
T17646 |
32226-32227 |
CD |
denotes |
5 |
T17647 |
32227-32228 |
NN |
denotes |
% |
T17649 |
32229-32235 |
JJ |
denotes |
nonfat |
T17648 |
32236-32240 |
NN |
denotes |
milk |
T17650 |
32241-32243 |
IN |
denotes |
in |
T17651 |
32244-32248 |
NN |
denotes |
Tris |
T17653 |
32248-32249 |
HYPH |
denotes |
- |
T17652 |
32249-32257 |
VBN |
denotes |
buffered |
T17654 |
32258-32264 |
NN |
denotes |
saline |
T17655 |
32265-32269 |
IN |
denotes |
with |
T17656 |
32270-32274 |
CD |
denotes |
0.05 |
T17657 |
32274-32275 |
NN |
denotes |
% |
T17658 |
32276-32281 |
NN |
denotes |
Tween |
T17659 |
32282-32284 |
CD |
denotes |
20 |
T17660 |
32285-32286 |
-LRB- |
denotes |
( |
T17661 |
32286-32290 |
NN |
denotes |
TBST |
T17662 |
32290-32291 |
-RRB- |
denotes |
) |
T17663 |
32291-32293 |
, |
denotes |
, |
T17664 |
32293-32301 |
VBN |
denotes |
followed |
T17665 |
32302-32304 |
IN |
denotes |
by |
T17666 |
32305-32307 |
DT |
denotes |
an |
T17668 |
32308-32317 |
JJ |
denotes |
overnight |
T17667 |
32318-32328 |
NN |
denotes |
incubation |
T17669 |
32329-32330 |
-LRB- |
denotes |
( |
T17670 |
32330-32332 |
IN |
denotes |
at |
T17671 |
32333-32334 |
CD |
denotes |
4 |
T17672 |
32335-32337 |
NN |
denotes |
°C |
T17673 |
32337-32338 |
-RRB- |
denotes |
) |
T17674 |
32339-32343 |
IN |
denotes |
with |
T17675 |
32344-32348 |
NN |
denotes |
AQP2 |
T17677 |
32349-32359 |
JJ |
denotes |
polyclonal |
T17676 |
32360-32368 |
NN |
denotes |
antibody |
T17678 |
32369-32370 |
-LRB- |
denotes |
( |
T17680 |
32370-32375 |
NNP |
denotes |
Santa |
T17681 |
32376-32380 |
NNP |
denotes |
Cruz |
T17682 |
32381-32394 |
NNP |
denotes |
Biotechnology |
T17683 |
32394-32396 |
, |
denotes |
, |
T17684 |
32396-32401 |
NNP |
denotes |
Santa |
T17685 |
32402-32406 |
NNP |
denotes |
Cruz |
T17686 |
32406-32408 |
, |
denotes |
, |
T17687 |
32408-32418 |
NNP |
denotes |
California |
T17688 |
32418-32420 |
, |
denotes |
, |
T17689 |
32420-32426 |
NNP |
denotes |
United |
T17690 |
32427-32433 |
NNP |
denotes |
States |
T17691 |
32433-32434 |
: |
denotes |
; |
T17692 |
32435-32436 |
SYM |
denotes |
# |
T17679 |
32436-32438 |
NN |
denotes |
sc |
T17693 |
32438-32439 |
HYPH |
denotes |
- |
T17694 |
32439-32443 |
CD |
denotes |
9882 |
T17695 |
32443-32444 |
-RRB- |
denotes |
) |
T17696 |
32444-32445 |
. |
denotes |
. |
T17697 |
32445-32537 |
sentence |
denotes |
Membranes were washed in TBST then incubated with HRP-conjugated donkey anti-goat antibody. |
T17698 |
32446-32455 |
NNS |
denotes |
Membranes |
T17700 |
32456-32460 |
VBD |
denotes |
were |
T17699 |
32461-32467 |
VBN |
denotes |
washed |
T17701 |
32468-32470 |
IN |
denotes |
in |
T17702 |
32471-32475 |
NN |
denotes |
TBST |
T17703 |
32476-32480 |
RB |
denotes |
then |
T17704 |
32481-32490 |
VBN |
denotes |
incubated |
T17705 |
32491-32495 |
IN |
denotes |
with |
T17706 |
32496-32499 |
NN |
denotes |
HRP |
T17708 |
32499-32500 |
HYPH |
denotes |
- |
T17707 |
32500-32510 |
VBN |
denotes |
conjugated |
T17710 |
32511-32517 |
NN |
denotes |
donkey |
T17711 |
32518-32527 |
JJ |
denotes |
anti-goat |
T17709 |
32528-32536 |
NN |
denotes |
antibody |
T17712 |
32536-32537 |
. |
denotes |
. |
T17713 |
32537-32676 |
sentence |
denotes |
Membranes were washed further in TBST and bands were visualized using ECL reagent (Amersham Biosciences, Little Chalfont, United Kingdom). |
T17714 |
32538-32547 |
NNS |
denotes |
Membranes |
T17716 |
32548-32552 |
VBD |
denotes |
were |
T17715 |
32553-32559 |
VBN |
denotes |
washed |
T17717 |
32560-32567 |
RB |
denotes |
further |
T17718 |
32568-32570 |
IN |
denotes |
in |
T17719 |
32571-32575 |
NN |
denotes |
TBST |
T17720 |
32576-32579 |
CC |
denotes |
and |
T17721 |
32580-32585 |
NNS |
denotes |
bands |
T17723 |
32586-32590 |
VBD |
denotes |
were |
T17722 |
32591-32601 |
VBN |
denotes |
visualized |
T17724 |
32602-32607 |
VBG |
denotes |
using |
T17725 |
32608-32611 |
NN |
denotes |
ECL |
T17726 |
32612-32619 |
NN |
denotes |
reagent |
T17727 |
32620-32621 |
-LRB- |
denotes |
( |
T17729 |
32621-32629 |
NNP |
denotes |
Amersham |
T17728 |
32630-32641 |
NNP |
denotes |
Biosciences |
T17730 |
32641-32643 |
, |
denotes |
, |
T17731 |
32643-32649 |
NNP |
denotes |
Little |
T17732 |
32650-32658 |
NNP |
denotes |
Chalfont |
T17733 |
32658-32660 |
, |
denotes |
, |
T17734 |
32660-32666 |
NNP |
denotes |
United |
T17735 |
32667-32674 |
NNP |
denotes |
Kingdom |
T17736 |
32674-32675 |
-RRB- |
denotes |
) |
T17737 |
32675-32676 |
. |
denotes |
. |
T17905 |
32678-32693 |
NN |
denotes |
Endoglycosidase |
T17906 |
32694-32703 |
NN |
denotes |
digestion |
T17907 |
32703-32704 |
. |
denotes |
. |
T17908 |
32704-32860 |
sentence |
denotes |
Kidney membranes (60 μg) were incubated in 50 mM sodium phosphate (pH 5.5), 0.1% SDS, and 50 mM β-mercaptoethanol, heated to 100 °C for 5 min, then cooled. |
T17909 |
32705-32711 |
NN |
denotes |
Kidney |
T17910 |
32712-32721 |
NNS |
denotes |
membranes |
T17912 |
32722-32723 |
-LRB- |
denotes |
( |
T17914 |
32723-32725 |
CD |
denotes |
60 |
T17913 |
32726-32728 |
NN |
denotes |
μg |
T17915 |
32728-32729 |
-RRB- |
denotes |
) |
T17916 |
32730-32734 |
VBD |
denotes |
were |
T17911 |
32735-32744 |
VBN |
denotes |
incubated |
T17917 |
32745-32747 |
IN |
denotes |
in |
T17918 |
32748-32750 |
CD |
denotes |
50 |
T17919 |
32751-32753 |
NN |
denotes |
mM |
T17921 |
32754-32760 |
NN |
denotes |
sodium |
T17920 |
32761-32770 |
NN |
denotes |
phosphate |
T17922 |
32771-32772 |
-LRB- |
denotes |
( |
T17923 |
32772-32774 |
NN |
denotes |
pH |
T17924 |
32775-32778 |
CD |
denotes |
5.5 |
T17925 |
32778-32779 |
-RRB- |
denotes |
) |
T17926 |
32779-32781 |
, |
denotes |
, |
T17927 |
32781-32784 |
CD |
denotes |
0.1 |
T17928 |
32784-32785 |
NN |
denotes |
% |
T17929 |
32786-32789 |
NN |
denotes |
SDS |
T17930 |
32789-32791 |
, |
denotes |
, |
T17931 |
32791-32794 |
CC |
denotes |
and |
T17932 |
32795-32797 |
CD |
denotes |
50 |
T17933 |
32798-32800 |
NN |
denotes |
mM |
T17935 |
32801-32802 |
NN |
denotes |
β |
T17936 |
32802-32803 |
HYPH |
denotes |
- |
T17934 |
32803-32818 |
NN |
denotes |
mercaptoethanol |
T17937 |
32818-32820 |
, |
denotes |
, |
T17938 |
32820-32826 |
VBN |
denotes |
heated |
T17939 |
32827-32829 |
IN |
denotes |
to |
T17940 |
32830-32833 |
CD |
denotes |
100 |
T17941 |
32834-32836 |
NN |
denotes |
°C |
T17942 |
32837-32840 |
IN |
denotes |
for |
T17943 |
32841-32842 |
CD |
denotes |
5 |
T17944 |
32843-32846 |
NN |
denotes |
min |
T17945 |
32846-32848 |
, |
denotes |
, |
T17946 |
32848-32852 |
RB |
denotes |
then |
T17947 |
32853-32859 |
VBN |
denotes |
cooled |
T17948 |
32859-32860 |
. |
denotes |
. |
T17949 |
32860-32948 |
sentence |
denotes |
Endoglycosidase H (0.01 units; Sigma-Aldrich) was added and incubated at 37 °C for 2 h. |
T17950 |
32861-32876 |
NN |
denotes |
Endoglycosidase |
T17951 |
32877-32878 |
NN |
denotes |
H |
T17953 |
32879-32880 |
-LRB- |
denotes |
( |
T17955 |
32880-32884 |
CD |
denotes |
0.01 |
T17956 |
32885-32890 |
NNS |
denotes |
units |
T17957 |
32890-32891 |
: |
denotes |
; |
T17958 |
32892-32897 |
NNP |
denotes |
Sigma |
T17959 |
32897-32898 |
HYPH |
denotes |
- |
T17954 |
32898-32905 |
NNP |
denotes |
Aldrich |
T17960 |
32905-32906 |
-RRB- |
denotes |
) |
T17961 |
32907-32910 |
VBD |
denotes |
was |
T17952 |
32911-32916 |
VBN |
denotes |
added |
T17962 |
32917-32920 |
CC |
denotes |
and |
T17963 |
32921-32930 |
VBN |
denotes |
incubated |
T17964 |
32931-32933 |
IN |
denotes |
at |
T17965 |
32934-32936 |
CD |
denotes |
37 |
T17966 |
32937-32939 |
NN |
denotes |
°C |
T17967 |
32940-32943 |
IN |
denotes |
for |
T17968 |
32944-32945 |
CD |
denotes |
2 |
T17969 |
32946-32947 |
NN |
denotes |
h |
T17970 |
32947-32948 |
. |
denotes |
. |
T17971 |
32948-33015 |
sentence |
denotes |
The reaction was stopped by boiling the samples in Laemmli buffer. |
T17972 |
32949-32952 |
DT |
denotes |
The |
T17973 |
32953-32961 |
NN |
denotes |
reaction |
T17975 |
32962-32965 |
VBD |
denotes |
was |
T17974 |
32966-32973 |
VBN |
denotes |
stopped |
T17976 |
32974-32976 |
IN |
denotes |
by |
T17977 |
32977-32984 |
VBG |
denotes |
boiling |
T17978 |
32985-32988 |
DT |
denotes |
the |
T17979 |
32989-32996 |
NNS |
denotes |
samples |
T17980 |
32997-32999 |
IN |
denotes |
in |
T17981 |
33000-33007 |
NNP |
denotes |
Laemmli |
T17982 |
33008-33014 |
NN |
denotes |
buffer |
T17983 |
33014-33015 |
. |
denotes |
. |
T17984 |
33015-33070 |
sentence |
denotes |
Total reactants were immunoblotted as described above. |
T17985 |
33016-33021 |
JJ |
denotes |
Total |
T17986 |
33022-33031 |
NNS |
denotes |
reactants |
T17988 |
33032-33036 |
VBD |
denotes |
were |
T17987 |
33037-33050 |
VBN |
denotes |
immunoblotted |
T17989 |
33051-33053 |
IN |
denotes |
as |
T17990 |
33054-33063 |
VBN |
denotes |
described |
T17991 |
33064-33069 |
RB |
denotes |
above |
T17992 |
33069-33070 |
. |
denotes |
. |
T18783 |
33072-33093 |
NN |
denotes |
Coimmunoprecipitation |
T18784 |
33094-33097 |
CC |
denotes |
and |
T18785 |
33098-33111 |
NN |
denotes |
biotinylation |
T18786 |
33112-33114 |
IN |
denotes |
in |
T18787 |
33115-33119 |
NN |
denotes |
MDCK |
T18788 |
33120-33125 |
NNS |
denotes |
cells |
T18789 |
33125-33126 |
. |
denotes |
. |
T18790 |
33126-33273 |
sentence |
denotes |
MDCK cells stably expressing wild-type AQP2 (grown on 10-cm plates) were transfected with pEGFP-wild-type AQP2, pEGFP-AQP2-F204V, or vector alone. |
T18791 |
33127-33131 |
NN |
denotes |
MDCK |
T18792 |
33132-33137 |
NNS |
denotes |
cells |
T18794 |
33138-33144 |
RB |
denotes |
stably |
T18795 |
33145-33155 |
VBG |
denotes |
expressing |
T18796 |
33156-33160 |
JJ |
denotes |
wild |
T18798 |
33160-33161 |
HYPH |
denotes |
- |
T18797 |
33161-33165 |
NN |
denotes |
type |
T18799 |
33166-33170 |
NN |
denotes |
AQP2 |
T18800 |
33171-33172 |
-LRB- |
denotes |
( |
T18801 |
33172-33177 |
VBN |
denotes |
grown |
T18802 |
33178-33180 |
IN |
denotes |
on |
T18803 |
33181-33183 |
CD |
denotes |
10 |
T18805 |
33183-33184 |
HYPH |
denotes |
- |
T18804 |
33184-33186 |
NN |
denotes |
cm |
T18806 |
33187-33193 |
NNS |
denotes |
plates |
T18807 |
33193-33194 |
-RRB- |
denotes |
) |
T18808 |
33195-33199 |
VBD |
denotes |
were |
T18793 |
33200-33211 |
VBN |
denotes |
transfected |
T18809 |
33212-33216 |
IN |
denotes |
with |
T18810 |
33217-33222 |
NN |
denotes |
pEGFP |
T18812 |
33222-33223 |
HYPH |
denotes |
- |
T18813 |
33223-33227 |
JJ |
denotes |
wild |
T18814 |
33227-33228 |
HYPH |
denotes |
- |
T18811 |
33228-33232 |
NN |
denotes |
type |
T18815 |
33233-33237 |
NN |
denotes |
AQP2 |
T18816 |
33237-33239 |
, |
denotes |
, |
T18817 |
33239-33244 |
NN |
denotes |
pEGFP |
T18819 |
33244-33245 |
HYPH |
denotes |
- |
T18820 |
33245-33249 |
NN |
denotes |
AQP2 |
T18821 |
33249-33250 |
HYPH |
denotes |
- |
T18818 |
33250-33255 |
NN |
denotes |
F204V |
T18822 |
33255-33257 |
, |
denotes |
, |
T18823 |
33257-33259 |
CC |
denotes |
or |
T18824 |
33260-33266 |
NN |
denotes |
vector |
T18825 |
33267-33272 |
RB |
denotes |
alone |
T18826 |
33272-33273 |
. |
denotes |
. |
T18827 |
33273-33366 |
sentence |
denotes |
The cells were homogenized in 10 mM Tris (pH 7.4), 1 mM EDTA, and 250 mM sucrose 40 h later. |
T18828 |
33274-33277 |
DT |
denotes |
The |
T18829 |
33278-33283 |
NNS |
denotes |
cells |
T18831 |
33284-33288 |
VBD |
denotes |
were |
T18830 |
33289-33300 |
VBN |
denotes |
homogenized |
T18832 |
33301-33303 |
IN |
denotes |
in |
T18833 |
33304-33306 |
CD |
denotes |
10 |
T18834 |
33307-33309 |
NN |
denotes |
mM |
T18835 |
33310-33314 |
NN |
denotes |
Tris |
T18836 |
33315-33316 |
-LRB- |
denotes |
( |
T18837 |
33316-33318 |
NN |
denotes |
pH |
T18838 |
33319-33322 |
CD |
denotes |
7.4 |
T18839 |
33322-33323 |
-RRB- |
denotes |
) |
T18840 |
33323-33325 |
, |
denotes |
, |
T18841 |
33325-33326 |
CD |
denotes |
1 |
T18842 |
33327-33329 |
NN |
denotes |
mM |
T18843 |
33330-33334 |
NN |
denotes |
EDTA |
T18844 |
33334-33336 |
, |
denotes |
, |
T18845 |
33336-33339 |
CC |
denotes |
and |
T18846 |
33340-33343 |
CD |
denotes |
250 |
T18847 |
33344-33346 |
NN |
denotes |
mM |
T18848 |
33347-33354 |
NN |
denotes |
sucrose |
T18849 |
33355-33357 |
CD |
denotes |
40 |
T18850 |
33358-33359 |
NN |
denotes |
h |
T18851 |
33360-33365 |
RB |
denotes |
later |
T18852 |
33365-33366 |
. |
denotes |
. |
T18853 |
33366-33433 |
sentence |
denotes |
The clarified supernatant was centrifuged at 200,000 g for 30 min. |
T18854 |
33367-33370 |
DT |
denotes |
The |
T18856 |
33371-33380 |
VBN |
denotes |
clarified |
T18855 |
33381-33392 |
NN |
denotes |
supernatant |
T18858 |
33393-33396 |
VBD |
denotes |
was |
T18857 |
33397-33408 |
VBN |
denotes |
centrifuged |
T18859 |
33409-33411 |
IN |
denotes |
at |
T18860 |
33412-33419 |
CD |
denotes |
200,000 |
T18861 |
33420-33421 |
NN |
denotes |
g |
T18862 |
33422-33425 |
IN |
denotes |
for |
T18863 |
33426-33428 |
CD |
denotes |
30 |
T18864 |
33429-33432 |
NN |
denotes |
min |
T18865 |
33432-33433 |
. |
denotes |
. |
T18866 |
33433-33558 |
sentence |
denotes |
Pelleted membranes were resuspended in the same buffer but containing 4% sodium deoxycholate and incubated at 37 °C for 1 h. |
T18867 |
33434-33442 |
VBN |
denotes |
Pelleted |
T18868 |
33443-33452 |
NNS |
denotes |
membranes |
T18870 |
33453-33457 |
VBD |
denotes |
were |
T18871 |
33458-33469 |
VBN |
denotes |
resuspended |
T18872 |
33470-33472 |
IN |
denotes |
in |
T18873 |
33473-33476 |
DT |
denotes |
the |
T18875 |
33477-33481 |
JJ |
denotes |
same |
T18874 |
33482-33488 |
NN |
denotes |
buffer |
T18876 |
33489-33492 |
IN |
denotes |
but |
T18877 |
33493-33503 |
VBG |
denotes |
containing |
T18878 |
33504-33505 |
CD |
denotes |
4 |
T18879 |
33505-33506 |
NN |
denotes |
% |
T18881 |
33507-33513 |
NN |
denotes |
sodium |
T18880 |
33514-33526 |
NN |
denotes |
deoxycholate |
T18882 |
33527-33530 |
CC |
denotes |
and |
T18869 |
33531-33540 |
VBN |
denotes |
incubated |
T18883 |
33541-33543 |
IN |
denotes |
at |
T18884 |
33544-33546 |
CD |
denotes |
37 |
T18885 |
33547-33549 |
NN |
denotes |
°C |
T18886 |
33550-33553 |
IN |
denotes |
for |
T18887 |
33554-33555 |
CD |
denotes |
1 |
T18888 |
33556-33557 |
NN |
denotes |
h |
T18889 |
33557-33558 |
. |
denotes |
. |
T18890 |
33558-33656 |
sentence |
denotes |
From the dissolved membranes, a 30 μl sample was removed and used as the total membrane fraction. |
T18891 |
33559-33563 |
IN |
denotes |
From |
T18893 |
33564-33567 |
DT |
denotes |
the |
T18895 |
33568-33577 |
VBN |
denotes |
dissolved |
T18894 |
33578-33587 |
NNS |
denotes |
membranes |
T18896 |
33587-33589 |
, |
denotes |
, |
T18897 |
33589-33590 |
DT |
denotes |
a |
T18899 |
33591-33593 |
CD |
denotes |
30 |
T18900 |
33594-33596 |
NN |
denotes |
μl |
T18898 |
33597-33603 |
NN |
denotes |
sample |
T18901 |
33604-33607 |
VBD |
denotes |
was |
T18892 |
33608-33615 |
VBN |
denotes |
removed |
T18902 |
33616-33619 |
CC |
denotes |
and |
T18903 |
33620-33624 |
VBN |
denotes |
used |
T18904 |
33625-33627 |
IN |
denotes |
as |
T18905 |
33628-33631 |
DT |
denotes |
the |
T18907 |
33632-33637 |
JJ |
denotes |
total |
T18908 |
33638-33646 |
NN |
denotes |
membrane |
T18906 |
33647-33655 |
NN |
denotes |
fraction |
T18909 |
33655-33656 |
. |
denotes |
. |
T18910 |
33656-33825 |
sentence |
denotes |
The remaining membranes were diluted with 600 μl of the homogenization buffer, and incubated with 1 μl of GFP antisera (Invitrogen, #46–0092) and protein A/G sepharose. |
T18911 |
33657-33660 |
DT |
denotes |
The |
T18913 |
33661-33670 |
VBG |
denotes |
remaining |
T18912 |
33671-33680 |
NNS |
denotes |
membranes |
T18915 |
33681-33685 |
VBD |
denotes |
were |
T18914 |
33686-33693 |
VBN |
denotes |
diluted |
T18916 |
33694-33698 |
IN |
denotes |
with |
T18917 |
33699-33702 |
CD |
denotes |
600 |
T18918 |
33703-33705 |
NN |
denotes |
μl |
T18919 |
33706-33708 |
IN |
denotes |
of |
T18920 |
33709-33712 |
DT |
denotes |
the |
T18922 |
33713-33727 |
NN |
denotes |
homogenization |
T18921 |
33728-33734 |
NN |
denotes |
buffer |
T18923 |
33734-33736 |
, |
denotes |
, |
T18924 |
33736-33739 |
CC |
denotes |
and |
T18925 |
33740-33749 |
VBN |
denotes |
incubated |
T18926 |
33750-33754 |
IN |
denotes |
with |
T18927 |
33755-33756 |
CD |
denotes |
1 |
T18928 |
33757-33759 |
NN |
denotes |
μl |
T18929 |
33760-33762 |
IN |
denotes |
of |
T18930 |
33763-33766 |
NN |
denotes |
GFP |
T18931 |
33767-33775 |
NNS |
denotes |
antisera |
T18932 |
33776-33777 |
-LRB- |
denotes |
( |
T18934 |
33777-33787 |
NNP |
denotes |
Invitrogen |
T18935 |
33787-33789 |
, |
denotes |
, |
T18936 |
33789-33790 |
SYM |
denotes |
# |
T18937 |
33790-33792 |
CD |
denotes |
46 |
T18938 |
33792-33793 |
HYPH |
denotes |
– |
T18933 |
33793-33797 |
CD |
denotes |
0092 |
T18939 |
33797-33798 |
-RRB- |
denotes |
) |
T18940 |
33799-33802 |
CC |
denotes |
and |
T18941 |
33803-33810 |
NN |
denotes |
protein |
T18943 |
33811-33812 |
NN |
denotes |
A |
T18945 |
33812-33813 |
HYPH |
denotes |
/ |
T18944 |
33813-33814 |
NN |
denotes |
G |
T18942 |
33815-33824 |
NN |
denotes |
sepharose |
T18946 |
33824-33825 |
. |
denotes |
. |
T18947 |
33825-33957 |
sentence |
denotes |
Following overnight incubation, the precipitated proteins were washed in RIPA buffer and finally boiled in 50 μl of Laemmli buffer. |
T18948 |
33826-33835 |
VBG |
denotes |
Following |
T18950 |
33836-33845 |
JJ |
denotes |
overnight |
T18951 |
33846-33856 |
NN |
denotes |
incubation |
T18952 |
33856-33858 |
, |
denotes |
, |
T18953 |
33858-33861 |
DT |
denotes |
the |
T18955 |
33862-33874 |
VBN |
denotes |
precipitated |
T18954 |
33875-33883 |
NN |
denotes |
proteins |
T18956 |
33884-33888 |
VBD |
denotes |
were |
T18949 |
33889-33895 |
VBN |
denotes |
washed |
T18957 |
33896-33898 |
IN |
denotes |
in |
T18958 |
33899-33903 |
NN |
denotes |
RIPA |
T18959 |
33904-33910 |
NN |
denotes |
buffer |
T18960 |
33911-33914 |
CC |
denotes |
and |
T18961 |
33915-33922 |
RB |
denotes |
finally |
T18962 |
33923-33929 |
VBN |
denotes |
boiled |
T18963 |
33930-33932 |
IN |
denotes |
in |
T18964 |
33933-33935 |
CD |
denotes |
50 |
T18965 |
33936-33938 |
NN |
denotes |
μl |
T18966 |
33939-33941 |
IN |
denotes |
of |
T18967 |
33942-33949 |
NNP |
denotes |
Laemmli |
T18968 |
33950-33956 |
NN |
denotes |
buffer |
T18969 |
33956-33957 |
. |
denotes |
. |
T18970 |
33957-34040 |
sentence |
denotes |
Half of the total membrane and the IP fractions were processed for immunoblotting. |
T18971 |
33958-33962 |
NN |
denotes |
Half |
T18973 |
33963-33965 |
IN |
denotes |
of |
T18974 |
33966-33969 |
DT |
denotes |
the |
T18976 |
33970-33975 |
JJ |
denotes |
total |
T18975 |
33976-33984 |
NN |
denotes |
membrane |
T18977 |
33985-33988 |
CC |
denotes |
and |
T18978 |
33989-33992 |
DT |
denotes |
the |
T18980 |
33993-33995 |
NN |
denotes |
IP |
T18979 |
33996-34005 |
NNS |
denotes |
fractions |
T18981 |
34006-34010 |
VBD |
denotes |
were |
T18972 |
34011-34020 |
VBN |
denotes |
processed |
T18982 |
34021-34024 |
IN |
denotes |
for |
T18983 |
34025-34039 |
NN |
denotes |
immunoblotting |
T18984 |
34039-34040 |
. |
denotes |
. |
T18985 |
34040-34102 |
sentence |
denotes |
Cell surface biotinylation was performed in a similar manner. |
T18986 |
34041-34045 |
NN |
denotes |
Cell |
T18988 |
34046-34053 |
NN |
denotes |
surface |
T18987 |
34054-34067 |
NN |
denotes |
biotinylation |
T18990 |
34068-34071 |
VBD |
denotes |
was |
T18989 |
34072-34081 |
VBN |
denotes |
performed |
T18991 |
34082-34084 |
IN |
denotes |
in |
T18992 |
34085-34086 |
DT |
denotes |
a |
T18994 |
34087-34094 |
JJ |
denotes |
similar |
T18993 |
34095-34101 |
NN |
denotes |
manner |
T18995 |
34101-34102 |
. |
denotes |
. |
T18996 |
34102-34235 |
sentence |
denotes |
However, pEGFP-AQP2-F204V, was transfected into MDCK cells stably expressing wild-type AQP2 and cells made stable with vector alone. |
T18997 |
34103-34110 |
RB |
denotes |
However |
T18999 |
34110-34112 |
, |
denotes |
, |
T19000 |
34112-34117 |
NN |
denotes |
pEGFP |
T19002 |
34117-34118 |
HYPH |
denotes |
- |
T19003 |
34118-34122 |
NN |
denotes |
AQP2 |
T19004 |
34122-34123 |
HYPH |
denotes |
- |
T19001 |
34123-34128 |
NN |
denotes |
F204V |
T19005 |
34128-34130 |
, |
denotes |
, |
T19006 |
34130-34133 |
VBD |
denotes |
was |
T18998 |
34134-34145 |
VBN |
denotes |
transfected |
T19007 |
34146-34150 |
IN |
denotes |
into |
T19008 |
34151-34155 |
NN |
denotes |
MDCK |
T19009 |
34156-34161 |
NNS |
denotes |
cells |
T19010 |
34162-34168 |
RB |
denotes |
stably |
T19011 |
34169-34179 |
VBG |
denotes |
expressing |
T19012 |
34180-34184 |
JJ |
denotes |
wild |
T19014 |
34184-34185 |
HYPH |
denotes |
- |
T19013 |
34185-34189 |
NN |
denotes |
type |
T19015 |
34190-34194 |
NN |
denotes |
AQP2 |
T19016 |
34195-34198 |
CC |
denotes |
and |
T19017 |
34199-34204 |
NNS |
denotes |
cells |
T19018 |
34205-34209 |
VBN |
denotes |
made |
T19019 |
34210-34216 |
JJ |
denotes |
stable |
T19020 |
34217-34221 |
IN |
denotes |
with |
T19021 |
34222-34228 |
NN |
denotes |
vector |
T19022 |
34229-34234 |
RB |
denotes |
alone |
T19023 |
34234-34235 |
. |
denotes |
. |
T19024 |
34235-34472 |
sentence |
denotes |
Twenty-four hours post-transfection, cells were stimulated with forskolin, trypsinized, resuspended in 1 ml of PBS (2.5 × 106 cells/ml), and incubated with 0.5 mg of NHS-PEO4-biotin (Pierce Biotechnology) for 30 min at room temperature. |
T19025 |
34236-34242 |
CD |
denotes |
Twenty |
T19027 |
34242-34243 |
HYPH |
denotes |
- |
T19026 |
34243-34247 |
CD |
denotes |
four |
T19028 |
34248-34253 |
NNS |
denotes |
hours |
T19029 |
34254-34271 |
RB |
denotes |
post-transfection |
T19031 |
34271-34273 |
, |
denotes |
, |
T19032 |
34273-34278 |
NNS |
denotes |
cells |
T19033 |
34279-34283 |
VBD |
denotes |
were |
T19030 |
34284-34294 |
VBN |
denotes |
stimulated |
T19034 |
34295-34299 |
IN |
denotes |
with |
T19035 |
34300-34309 |
NN |
denotes |
forskolin |
T19036 |
34309-34311 |
, |
denotes |
, |
T19037 |
34311-34322 |
VBN |
denotes |
trypsinized |
T19038 |
34322-34324 |
, |
denotes |
, |
T19039 |
34324-34335 |
VBN |
denotes |
resuspended |
T19040 |
34336-34338 |
IN |
denotes |
in |
T19041 |
34339-34340 |
CD |
denotes |
1 |
T19042 |
34341-34343 |
NN |
denotes |
ml |
T19043 |
34344-34346 |
IN |
denotes |
of |
T19044 |
34347-34350 |
NN |
denotes |
PBS |
T19045 |
34351-34352 |
-LRB- |
denotes |
( |
T19047 |
34352-34355 |
CD |
denotes |
2.5 |
T19049 |
34356-34357 |
SYM |
denotes |
× |
T19048 |
34358-34361 |
CD |
denotes |
106 |
T19046 |
34362-34367 |
NNS |
denotes |
cells |
T19050 |
34367-34368 |
SYM |
denotes |
/ |
T19051 |
34368-34370 |
NNS |
denotes |
ml |
T19052 |
34370-34371 |
-RRB- |
denotes |
) |
T19053 |
34371-34373 |
, |
denotes |
, |
T19054 |
34373-34376 |
CC |
denotes |
and |
T19055 |
34377-34386 |
VBN |
denotes |
incubated |
T19056 |
34387-34391 |
IN |
denotes |
with |
T19057 |
34392-34395 |
CD |
denotes |
0.5 |
T19058 |
34396-34398 |
NN |
denotes |
mg |
T19059 |
34399-34401 |
IN |
denotes |
of |
T19060 |
34402-34405 |
NN |
denotes |
NHS |
T19062 |
34405-34406 |
HYPH |
denotes |
- |
T19063 |
34406-34410 |
NN |
denotes |
PEO4 |
T19064 |
34410-34411 |
HYPH |
denotes |
- |
T19061 |
34411-34417 |
NN |
denotes |
biotin |
T19065 |
34418-34419 |
-LRB- |
denotes |
( |
T19067 |
34419-34425 |
NNP |
denotes |
Pierce |
T19066 |
34426-34439 |
NNP |
denotes |
Biotechnology |
T19068 |
34439-34440 |
-RRB- |
denotes |
) |
T19069 |
34441-34444 |
IN |
denotes |
for |
T19070 |
34445-34447 |
CD |
denotes |
30 |
T19071 |
34448-34451 |
NN |
denotes |
min |
T19072 |
34452-34454 |
IN |
denotes |
at |
T19073 |
34455-34459 |
NN |
denotes |
room |
T19074 |
34460-34471 |
NN |
denotes |
temperature |
T19075 |
34471-34472 |
. |
denotes |
. |
T19076 |
34472-34612 |
sentence |
denotes |
Cells were washed once in 10 mM Tris (pH 8) and three times in PBS, after which membranes were purified and solubilized as described above. |
T19077 |
34473-34478 |
NNS |
denotes |
Cells |
T19079 |
34479-34483 |
VBD |
denotes |
were |
T19078 |
34484-34490 |
VBN |
denotes |
washed |
T19080 |
34491-34495 |
RB |
denotes |
once |
T19081 |
34496-34498 |
IN |
denotes |
in |
T19082 |
34499-34501 |
CD |
denotes |
10 |
T19083 |
34502-34504 |
NN |
denotes |
mM |
T19084 |
34505-34509 |
NN |
denotes |
Tris |
T19085 |
34510-34511 |
-LRB- |
denotes |
( |
T19086 |
34511-34513 |
NN |
denotes |
pH |
T19087 |
34514-34515 |
CD |
denotes |
8 |
T19088 |
34515-34516 |
-RRB- |
denotes |
) |
T19089 |
34517-34520 |
CC |
denotes |
and |
T19090 |
34521-34526 |
CD |
denotes |
three |
T19091 |
34527-34532 |
NNS |
denotes |
times |
T19092 |
34533-34535 |
IN |
denotes |
in |
T19093 |
34536-34539 |
NN |
denotes |
PBS |
T19094 |
34539-34541 |
, |
denotes |
, |
T19095 |
34541-34546 |
IN |
denotes |
after |
T19097 |
34547-34552 |
WDT |
denotes |
which |
T19098 |
34553-34562 |
NNS |
denotes |
membranes |
T19099 |
34563-34567 |
VBD |
denotes |
were |
T19096 |
34568-34576 |
VBN |
denotes |
purified |
T19100 |
34577-34580 |
CC |
denotes |
and |
T19101 |
34581-34592 |
VBN |
denotes |
solubilized |
T19102 |
34593-34595 |
IN |
denotes |
as |
T19103 |
34596-34605 |
VBN |
denotes |
described |
T19104 |
34606-34611 |
RB |
denotes |
above |
T19105 |
34611-34612 |
. |
denotes |
. |
T19106 |
34612-34728 |
sentence |
denotes |
Solubilized membranes were incubated with 20 μl of immobilized streptavidin (Pierce Biotechnology) for 2 h at 4 °C. |
T19107 |
34613-34624 |
VBN |
denotes |
Solubilized |
T19108 |
34625-34634 |
NNS |
denotes |
membranes |
T19110 |
34635-34639 |
VBD |
denotes |
were |
T19109 |
34640-34649 |
VBN |
denotes |
incubated |
T19111 |
34650-34654 |
IN |
denotes |
with |
T19112 |
34655-34657 |
CD |
denotes |
20 |
T19113 |
34658-34660 |
NN |
denotes |
μl |
T19114 |
34661-34663 |
IN |
denotes |
of |
T19115 |
34664-34675 |
VBN |
denotes |
immobilized |
T19116 |
34676-34688 |
NN |
denotes |
streptavidin |
T19117 |
34689-34690 |
-LRB- |
denotes |
( |
T19119 |
34690-34696 |
NNP |
denotes |
Pierce |
T19118 |
34697-34710 |
NNP |
denotes |
Biotechnology |
T19120 |
34710-34711 |
-RRB- |
denotes |
) |
T19121 |
34712-34715 |
IN |
denotes |
for |
T19122 |
34716-34717 |
CD |
denotes |
2 |
T19123 |
34718-34719 |
NN |
denotes |
h |
T19124 |
34720-34722 |
IN |
denotes |
at |
T19125 |
34723-34724 |
CD |
denotes |
4 |
T19126 |
34725-34727 |
NN |
denotes |
°C |
T19127 |
34727-34728 |
. |
denotes |
. |
T19128 |
34728-34828 |
sentence |
denotes |
Finally the precipitated proteins were washed in RIPA buffer and boiled in 50 μl of Laemmli buffer. |
T19129 |
34729-34736 |
RB |
denotes |
Finally |
T19131 |
34737-34740 |
DT |
denotes |
the |
T19133 |
34741-34753 |
VBN |
denotes |
precipitated |
T19132 |
34754-34762 |
NN |
denotes |
proteins |
T19134 |
34763-34767 |
VBD |
denotes |
were |
T19130 |
34768-34774 |
VBN |
denotes |
washed |
T19135 |
34775-34777 |
IN |
denotes |
in |
T19136 |
34778-34782 |
NN |
denotes |
RIPA |
T19137 |
34783-34789 |
NN |
denotes |
buffer |
T19138 |
34790-34793 |
CC |
denotes |
and |
T19139 |
34794-34800 |
VBN |
denotes |
boiled |
T19140 |
34801-34803 |
IN |
denotes |
in |
T19141 |
34804-34806 |
CD |
denotes |
50 |
T19142 |
34807-34809 |
NN |
denotes |
μl |
T19143 |
34810-34812 |
IN |
denotes |
of |
T19144 |
34813-34820 |
NNP |
denotes |
Laemmli |
T19145 |
34821-34827 |
NN |
denotes |
buffer |
T19146 |
34827-34828 |
. |
denotes |
. |
T19147 |
34828-34921 |
sentence |
denotes |
Total cells and the biotinylated precipitates were immunoblotting using an antibody to AQP2. |
T19148 |
34829-34834 |
JJ |
denotes |
Total |
T19149 |
34835-34840 |
NNS |
denotes |
cells |
T19151 |
34841-34844 |
CC |
denotes |
and |
T19152 |
34845-34848 |
DT |
denotes |
the |
T19154 |
34849-34861 |
VBN |
denotes |
biotinylated |
T19153 |
34862-34874 |
NNS |
denotes |
precipitates |
T19155 |
34875-34879 |
VBD |
denotes |
were |
T19150 |
34880-34894 |
VBG |
denotes |
immunoblotting |
T19156 |
34895-34900 |
VBG |
denotes |
using |
T19157 |
34901-34903 |
DT |
denotes |
an |
T19158 |
34904-34912 |
NN |
denotes |
antibody |
T19159 |
34913-34915 |
IN |
denotes |
to |
T19160 |
34916-34920 |
NN |
denotes |
AQP2 |
T19161 |
34920-34921 |
. |
denotes |
. |
T19603 |
34923-34929 |
NN |
denotes |
Kidney |
T19604 |
34930-34950 |
NN |
denotes |
immunohistochemistry |
T19605 |
34950-34951 |
. |
denotes |
. |
T19606 |
34951-35027 |
sentence |
denotes |
Whole mouse kidneys were fixed in 10% phosphate-buffered formalin for 24 h. |
T19607 |
34952-34957 |
JJ |
denotes |
Whole |
T19609 |
34958-34963 |
NN |
denotes |
mouse |
T19608 |
34964-34971 |
NNS |
denotes |
kidneys |
T19611 |
34972-34976 |
VBD |
denotes |
were |
T19610 |
34977-34982 |
VBN |
denotes |
fixed |
T19612 |
34983-34985 |
IN |
denotes |
in |
T19613 |
34986-34988 |
CD |
denotes |
10 |
T19614 |
34988-34989 |
NN |
denotes |
% |
T19616 |
34990-34999 |
NN |
denotes |
phosphate |
T19618 |
34999-35000 |
HYPH |
denotes |
- |
T19617 |
35000-35008 |
VBN |
denotes |
buffered |
T19615 |
35009-35017 |
NN |
denotes |
formalin |
T19619 |
35018-35021 |
IN |
denotes |
for |
T19620 |
35022-35024 |
CD |
denotes |
24 |
T19621 |
35025-35026 |
NN |
denotes |
h |
T19622 |
35026-35027 |
. |
denotes |
. |
T19623 |
35027-35095 |
sentence |
denotes |
Kidneys were embedded in paraffin, and 5-μm sections were prepared. |
T19624 |
35028-35035 |
NNS |
denotes |
Kidneys |
T19626 |
35036-35040 |
VBD |
denotes |
were |
T19625 |
35041-35049 |
VBN |
denotes |
embedded |
T19627 |
35050-35052 |
IN |
denotes |
in |
T19628 |
35053-35061 |
NN |
denotes |
paraffin |
T19629 |
35061-35063 |
, |
denotes |
, |
T19630 |
35063-35066 |
CC |
denotes |
and |
T19631 |
35067-35068 |
CD |
denotes |
5 |
T19633 |
35068-35069 |
HYPH |
denotes |
- |
T19632 |
35069-35071 |
NN |
denotes |
μm |
T19634 |
35072-35080 |
NNS |
denotes |
sections |
T19636 |
35081-35085 |
VBD |
denotes |
were |
T19635 |
35086-35094 |
VBN |
denotes |
prepared |
T19637 |
35094-35095 |
. |
denotes |
. |
T19638 |
35095-35247 |
sentence |
denotes |
Following antigen retrieval using 10 mM sodium citrate (pH 8) for 10 min at 98 °C, sections were sequentially probed, first for AQP3 and then for AQP2. |
T19639 |
35096-35105 |
VBG |
denotes |
Following |
T19641 |
35106-35113 |
NN |
denotes |
antigen |
T19642 |
35114-35123 |
NN |
denotes |
retrieval |
T19643 |
35124-35129 |
VBG |
denotes |
using |
T19644 |
35130-35132 |
CD |
denotes |
10 |
T19645 |
35133-35135 |
NN |
denotes |
mM |
T19647 |
35136-35142 |
NN |
denotes |
sodium |
T19646 |
35143-35150 |
NN |
denotes |
citrate |
T19648 |
35151-35152 |
-LRB- |
denotes |
( |
T19649 |
35152-35154 |
NN |
denotes |
pH |
T19650 |
35155-35156 |
CD |
denotes |
8 |
T19651 |
35156-35157 |
-RRB- |
denotes |
) |
T19652 |
35158-35161 |
IN |
denotes |
for |
T19653 |
35162-35164 |
CD |
denotes |
10 |
T19654 |
35165-35168 |
NN |
denotes |
min |
T19655 |
35169-35171 |
IN |
denotes |
at |
T19656 |
35172-35174 |
CD |
denotes |
98 |
T19657 |
35175-35177 |
NN |
denotes |
°C |
T19658 |
35177-35179 |
, |
denotes |
, |
T19659 |
35179-35187 |
NNS |
denotes |
sections |
T19660 |
35188-35192 |
VBD |
denotes |
were |
T19661 |
35193-35205 |
RB |
denotes |
sequentially |
T19640 |
35206-35212 |
VBN |
denotes |
probed |
T19662 |
35212-35214 |
, |
denotes |
, |
T19663 |
35214-35219 |
RB |
denotes |
first |
T19664 |
35220-35223 |
IN |
denotes |
for |
T19665 |
35224-35228 |
NN |
denotes |
AQP3 |
T19666 |
35229-35232 |
CC |
denotes |
and |
T19667 |
35233-35237 |
RB |
denotes |
then |
T19668 |
35238-35241 |
IN |
denotes |
for |
T19669 |
35242-35246 |
NN |
denotes |
AQP2 |
T19670 |
35246-35247 |
. |
denotes |
. |
T19671 |
35247-35371 |
sentence |
denotes |
Sections were incubated in 5% donkey serum and then in goat anti-AQP3 antibody (1:100; Santa Cruz Biotechnology; #sc-9885). |
T19672 |
35248-35256 |
NNS |
denotes |
Sections |
T19674 |
35257-35261 |
VBD |
denotes |
were |
T19673 |
35262-35271 |
VBN |
denotes |
incubated |
T19675 |
35272-35274 |
IN |
denotes |
in |
T19676 |
35275-35276 |
CD |
denotes |
5 |
T19677 |
35276-35277 |
NN |
denotes |
% |
T19679 |
35278-35284 |
NN |
denotes |
donkey |
T19678 |
35285-35290 |
NN |
denotes |
serum |
T19680 |
35291-35294 |
CC |
denotes |
and |
T19681 |
35295-35299 |
RB |
denotes |
then |
T19682 |
35300-35302 |
IN |
denotes |
in |
T19683 |
35303-35307 |
NN |
denotes |
goat |
T19685 |
35308-35317 |
JJ |
denotes |
anti-AQP3 |
T19684 |
35318-35326 |
NN |
denotes |
antibody |
T19686 |
35327-35328 |
-LRB- |
denotes |
( |
T19688 |
35328-35329 |
CD |
denotes |
1 |
T19689 |
35329-35330 |
SYM |
denotes |
: |
T19690 |
35330-35333 |
CD |
denotes |
100 |
T19691 |
35333-35334 |
: |
denotes |
; |
T19692 |
35335-35340 |
NNP |
denotes |
Santa |
T19693 |
35341-35345 |
NNP |
denotes |
Cruz |
T19694 |
35346-35359 |
NNP |
denotes |
Biotechnology |
T19695 |
35359-35360 |
: |
denotes |
; |
T19696 |
35361-35362 |
SYM |
denotes |
# |
T19687 |
35362-35364 |
NN |
denotes |
sc |
T19697 |
35364-35365 |
HYPH |
denotes |
- |
T19698 |
35365-35369 |
CD |
denotes |
9885 |
T19699 |
35369-35370 |
-RRB- |
denotes |
) |
T19700 |
35370-35371 |
. |
denotes |
. |
T19701 |
35371-35521 |
sentence |
denotes |
Slides were washed with PBS and incubated with AlexaFluor 488-conjugated donkey anti-goat antibody (Molecular Probes, Eugene, Oregon, United States). |
T19702 |
35372-35378 |
NNS |
denotes |
Slides |
T19704 |
35379-35383 |
VBD |
denotes |
were |
T19703 |
35384-35390 |
VBN |
denotes |
washed |
T19705 |
35391-35395 |
IN |
denotes |
with |
T19706 |
35396-35399 |
NN |
denotes |
PBS |
T19707 |
35400-35403 |
CC |
denotes |
and |
T19708 |
35404-35413 |
VBN |
denotes |
incubated |
T19709 |
35414-35418 |
IN |
denotes |
with |
T19710 |
35419-35429 |
NNP |
denotes |
AlexaFluor |
T19712 |
35430-35433 |
CD |
denotes |
488 |
T19713 |
35433-35434 |
HYPH |
denotes |
- |
T19711 |
35434-35444 |
VBN |
denotes |
conjugated |
T19715 |
35445-35451 |
NN |
denotes |
donkey |
T19716 |
35452-35461 |
JJ |
denotes |
anti-goat |
T19714 |
35462-35470 |
NN |
denotes |
antibody |
T19717 |
35471-35472 |
-LRB- |
denotes |
( |
T19719 |
35472-35481 |
NNP |
denotes |
Molecular |
T19718 |
35482-35488 |
NNP |
denotes |
Probes |
T19720 |
35488-35490 |
, |
denotes |
, |
T19721 |
35490-35496 |
NNP |
denotes |
Eugene |
T19722 |
35496-35498 |
, |
denotes |
, |
T19723 |
35498-35504 |
NNP |
denotes |
Oregon |
T19724 |
35504-35506 |
, |
denotes |
, |
T19725 |
35506-35512 |
NNP |
denotes |
United |
T19726 |
35513-35519 |
NNP |
denotes |
States |
T19727 |
35519-35520 |
-RRB- |
denotes |
) |
T19728 |
35520-35521 |
. |
denotes |
. |
T19729 |
35521-35787 |
sentence |
denotes |
The slides were subsequently blocked in 5% chicken serum, incubated with a rabbit anti-AQP2 antibody (1:250; USB, Cleveland, Ohio, United States; #A3000–06), which was detected with a AlexaFluor 594-conjugated chicken anti-rabbit antibody (1:500; Molecular Probes). |
T19730 |
35522-35525 |
DT |
denotes |
The |
T19731 |
35526-35532 |
NNS |
denotes |
slides |
T19733 |
35533-35537 |
VBD |
denotes |
were |
T19734 |
35538-35550 |
RB |
denotes |
subsequently |
T19735 |
35551-35558 |
VBN |
denotes |
blocked |
T19736 |
35559-35561 |
IN |
denotes |
in |
T19737 |
35562-35563 |
CD |
denotes |
5 |
T19738 |
35563-35564 |
NN |
denotes |
% |
T19740 |
35565-35572 |
NN |
denotes |
chicken |
T19739 |
35573-35578 |
NN |
denotes |
serum |
T19741 |
35578-35580 |
, |
denotes |
, |
T19732 |
35580-35589 |
VBN |
denotes |
incubated |
T19742 |
35590-35594 |
IN |
denotes |
with |
T19743 |
35595-35596 |
DT |
denotes |
a |
T19745 |
35597-35603 |
NN |
denotes |
rabbit |
T19746 |
35604-35613 |
JJ |
denotes |
anti-AQP2 |
T19744 |
35614-35622 |
NN |
denotes |
antibody |
T19747 |
35623-35624 |
-LRB- |
denotes |
( |
T19749 |
35624-35625 |
CD |
denotes |
1 |
T19750 |
35625-35626 |
SYM |
denotes |
: |
T19751 |
35626-35629 |
CD |
denotes |
250 |
T19752 |
35629-35630 |
: |
denotes |
; |
T19753 |
35631-35634 |
NNP |
denotes |
USB |
T19754 |
35634-35636 |
, |
denotes |
, |
T19755 |
35636-35645 |
NNP |
denotes |
Cleveland |
T19756 |
35645-35647 |
, |
denotes |
, |
T19757 |
35647-35651 |
NNP |
denotes |
Ohio |
T19758 |
35651-35653 |
, |
denotes |
, |
T19759 |
35653-35659 |
NNP |
denotes |
United |
T19760 |
35660-35666 |
NNP |
denotes |
States |
T19761 |
35666-35667 |
: |
denotes |
; |
T19762 |
35668-35669 |
SYM |
denotes |
# |
T19748 |
35669-35674 |
NN |
denotes |
A3000 |
T19763 |
35674-35675 |
HYPH |
denotes |
– |
T19764 |
35675-35677 |
CD |
denotes |
06 |
T19765 |
35677-35678 |
-RRB- |
denotes |
) |
T19766 |
35678-35680 |
, |
denotes |
, |
T19767 |
35680-35685 |
WDT |
denotes |
which |
T19769 |
35686-35689 |
VBD |
denotes |
was |
T19768 |
35690-35698 |
VBN |
denotes |
detected |
T19770 |
35699-35703 |
IN |
denotes |
with |
T19771 |
35704-35705 |
DT |
denotes |
a |
T19773 |
35706-35716 |
NNP |
denotes |
AlexaFluor |
T19775 |
35717-35720 |
CD |
denotes |
594 |
T19776 |
35720-35721 |
HYPH |
denotes |
- |
T19774 |
35721-35731 |
VBN |
denotes |
conjugated |
T19777 |
35732-35739 |
NN |
denotes |
chicken |
T19778 |
35740-35751 |
JJ |
denotes |
anti-rabbit |
T19772 |
35752-35760 |
NN |
denotes |
antibody |
T19779 |
35761-35762 |
-LRB- |
denotes |
( |
T19781 |
35762-35763 |
CD |
denotes |
1 |
T19782 |
35763-35764 |
SYM |
denotes |
: |
T19783 |
35764-35767 |
CD |
denotes |
500 |
T19784 |
35767-35768 |
: |
denotes |
; |
T19785 |
35769-35778 |
NNP |
denotes |
Molecular |
T19780 |
35779-35785 |
NNP |
denotes |
Probes |
T19786 |
35785-35786 |
-RRB- |
denotes |
) |
T19787 |
35786-35787 |
. |
denotes |
. |
T19788 |
35787-35904 |
sentence |
denotes |
The sections were stained with DAPI and mounted in Vectashield (Vector Labs, Burlingame, California, United States). |
T19789 |
35788-35791 |
DT |
denotes |
The |
T19790 |
35792-35800 |
NNS |
denotes |
sections |
T19792 |
35801-35805 |
VBD |
denotes |
were |
T19791 |
35806-35813 |
VBN |
denotes |
stained |
T19793 |
35814-35818 |
IN |
denotes |
with |
T19794 |
35819-35823 |
NN |
denotes |
DAPI |
T19795 |
35824-35827 |
CC |
denotes |
and |
T19796 |
35828-35835 |
VBD |
denotes |
mounted |
T19797 |
35836-35838 |
IN |
denotes |
in |
T19798 |
35839-35850 |
NNP |
denotes |
Vectashield |
T19799 |
35851-35852 |
-LRB- |
denotes |
( |
T19801 |
35852-35858 |
NNP |
denotes |
Vector |
T19800 |
35859-35863 |
NNP |
denotes |
Labs |
T19802 |
35863-35865 |
, |
denotes |
, |
T19803 |
35865-35875 |
NNP |
denotes |
Burlingame |
T19804 |
35875-35877 |
, |
denotes |
, |
T19805 |
35877-35887 |
NNP |
denotes |
California |
T19806 |
35887-35889 |
, |
denotes |
, |
T19807 |
35889-35895 |
NNP |
denotes |
United |
T19808 |
35896-35902 |
NNP |
denotes |
States |
T19809 |
35902-35903 |
-RRB- |
denotes |
) |
T19810 |
35903-35904 |
. |
denotes |
. |
T20424 |
35906-35925 |
NN |
denotes |
Immunocytochemistry |
T20425 |
35926-35928 |
IN |
denotes |
on |
T20426 |
35929-35933 |
NN |
denotes |
MDCK |
T20427 |
35934-35939 |
NNS |
denotes |
cells |
T20428 |
35939-35940 |
. |
denotes |
. |
T20429 |
35940-36151 |
sentence |
denotes |
MDCK stable cell lines expressing vector alone, wild-type AQP2, or AQP2-F204V (and in some cases transiently expressing a GFP construct) were grown on fibronectin-coated coverslips until tight junctions formed. |
T20430 |
35941-35945 |
NN |
denotes |
MDCK |
T20432 |
35946-35952 |
JJ |
denotes |
stable |
T20433 |
35953-35957 |
NN |
denotes |
cell |
T20431 |
35958-35963 |
NNS |
denotes |
lines |
T20435 |
35964-35974 |
VBG |
denotes |
expressing |
T20436 |
35975-35981 |
NN |
denotes |
vector |
T20437 |
35982-35987 |
JJ |
denotes |
alone |
T20438 |
35987-35989 |
, |
denotes |
, |
T20439 |
35989-35993 |
JJ |
denotes |
wild |
T20441 |
35993-35994 |
HYPH |
denotes |
- |
T20440 |
35994-35998 |
NN |
denotes |
type |
T20442 |
35999-36003 |
NN |
denotes |
AQP2 |
T20443 |
36003-36005 |
, |
denotes |
, |
T20444 |
36005-36007 |
CC |
denotes |
or |
T20445 |
36008-36012 |
NN |
denotes |
AQP2 |
T20447 |
36012-36013 |
HYPH |
denotes |
- |
T20446 |
36013-36018 |
NN |
denotes |
F204V |
T20448 |
36019-36020 |
-LRB- |
denotes |
( |
T20449 |
36020-36023 |
CC |
denotes |
and |
T20450 |
36024-36026 |
IN |
denotes |
in |
T20452 |
36027-36031 |
DT |
denotes |
some |
T20453 |
36032-36037 |
NNS |
denotes |
cases |
T20454 |
36038-36049 |
RB |
denotes |
transiently |
T20451 |
36050-36060 |
VBG |
denotes |
expressing |
T20455 |
36061-36062 |
DT |
denotes |
a |
T20457 |
36063-36066 |
NN |
denotes |
GFP |
T20456 |
36067-36076 |
NN |
denotes |
construct |
T20458 |
36076-36077 |
-RRB- |
denotes |
) |
T20459 |
36078-36082 |
VBD |
denotes |
were |
T20434 |
36083-36088 |
VBN |
denotes |
grown |
T20460 |
36089-36091 |
IN |
denotes |
on |
T20461 |
36092-36103 |
NN |
denotes |
fibronectin |
T20463 |
36103-36104 |
HYPH |
denotes |
- |
T20462 |
36104-36110 |
VBN |
denotes |
coated |
T20464 |
36111-36121 |
NNS |
denotes |
coverslips |
T20465 |
36122-36127 |
IN |
denotes |
until |
T20467 |
36128-36133 |
JJ |
denotes |
tight |
T20468 |
36134-36143 |
NNS |
denotes |
junctions |
T20466 |
36144-36150 |
VBD |
denotes |
formed |
T20469 |
36150-36151 |
. |
denotes |
. |
T20470 |
36151-36248 |
sentence |
denotes |
Cells were treated with or without 150 μM forskolin for 90 min, and fixed in methanol at −20 °C. |
T20471 |
36152-36157 |
NNS |
denotes |
Cells |
T20473 |
36158-36162 |
VBD |
denotes |
were |
T20472 |
36163-36170 |
VBN |
denotes |
treated |
T20474 |
36171-36175 |
IN |
denotes |
with |
T20475 |
36176-36178 |
CC |
denotes |
or |
T20476 |
36179-36186 |
IN |
denotes |
without |
T20477 |
36187-36190 |
CD |
denotes |
150 |
T20478 |
36191-36193 |
NN |
denotes |
μM |
T20479 |
36194-36203 |
NN |
denotes |
forskolin |
T20480 |
36204-36207 |
IN |
denotes |
for |
T20481 |
36208-36210 |
CD |
denotes |
90 |
T20482 |
36211-36214 |
NN |
denotes |
min |
T20483 |
36214-36216 |
, |
denotes |
, |
T20484 |
36216-36219 |
CC |
denotes |
and |
T20485 |
36220-36225 |
VBN |
denotes |
fixed |
T20486 |
36226-36228 |
IN |
denotes |
in |
T20487 |
36229-36237 |
NN |
denotes |
methanol |
T20488 |
36238-36240 |
IN |
denotes |
at |
T20489 |
36241-36242 |
SYM |
denotes |
− |
T20490 |
36242-36244 |
CD |
denotes |
20 |
T20491 |
36245-36247 |
NN |
denotes |
°C |
T20492 |
36247-36248 |
. |
denotes |
. |
T20493 |
36248-36414 |
sentence |
denotes |
Subsequently, cells were washed and permeabilized in 0.2% Triton X-100 for 5 min, and sequentially probed for AQP2 and organelle markers for either the PM or the ER. |
T20494 |
36249-36261 |
RB |
denotes |
Subsequently |
T20496 |
36261-36263 |
, |
denotes |
, |
T20497 |
36263-36268 |
NNS |
denotes |
cells |
T20498 |
36269-36273 |
VBD |
denotes |
were |
T20495 |
36274-36280 |
VBN |
denotes |
washed |
T20499 |
36281-36284 |
CC |
denotes |
and |
T20500 |
36285-36298 |
VBN |
denotes |
permeabilized |
T20501 |
36299-36301 |
IN |
denotes |
in |
T20502 |
36302-36305 |
CD |
denotes |
0.2 |
T20503 |
36305-36306 |
NN |
denotes |
% |
T20505 |
36307-36313 |
NN |
denotes |
Triton |
T20504 |
36314-36315 |
NN |
denotes |
X |
T20506 |
36315-36316 |
HYPH |
denotes |
- |
T20507 |
36316-36319 |
CD |
denotes |
100 |
T20508 |
36320-36323 |
IN |
denotes |
for |
T20509 |
36324-36325 |
CD |
denotes |
5 |
T20510 |
36326-36329 |
NN |
denotes |
min |
T20511 |
36329-36331 |
, |
denotes |
, |
T20512 |
36331-36334 |
CC |
denotes |
and |
T20513 |
36335-36347 |
RB |
denotes |
sequentially |
T20514 |
36348-36354 |
VBN |
denotes |
probed |
T20515 |
36355-36358 |
IN |
denotes |
for |
T20516 |
36359-36363 |
NN |
denotes |
AQP2 |
T20517 |
36364-36367 |
CC |
denotes |
and |
T20518 |
36368-36377 |
NN |
denotes |
organelle |
T20519 |
36378-36385 |
NNS |
denotes |
markers |
T20520 |
36386-36389 |
IN |
denotes |
for |
T20521 |
36390-36396 |
CC |
denotes |
either |
T20523 |
36397-36400 |
DT |
denotes |
the |
T20522 |
36401-36403 |
NN |
denotes |
PM |
T20524 |
36404-36406 |
CC |
denotes |
or |
T20525 |
36407-36410 |
DT |
denotes |
the |
T20526 |
36411-36413 |
NN |
denotes |
ER |
T20527 |
36413-36414 |
. |
denotes |
. |
T20528 |
36414-36584 |
sentence |
denotes |
AQP2 was detected using goat anti-AQP2 (1:100; Santa Cruz Biotechnology; #sc-9882) and a 1:200 dilution of AlexaFluor 488-conjugated donkey anti-goat secondary antibody. |
T20529 |
36415-36419 |
NN |
denotes |
AQP2 |
T20531 |
36420-36423 |
VBD |
denotes |
was |
T20530 |
36424-36432 |
VBN |
denotes |
detected |
T20532 |
36433-36438 |
VBG |
denotes |
using |
T20533 |
36439-36443 |
NN |
denotes |
goat |
T20534 |
36444-36453 |
JJ |
denotes |
anti-AQP2 |
T20535 |
36454-36455 |
-LRB- |
denotes |
( |
T20537 |
36455-36456 |
CD |
denotes |
1 |
T20538 |
36456-36457 |
SYM |
denotes |
: |
T20539 |
36457-36460 |
CD |
denotes |
100 |
T20540 |
36460-36461 |
: |
denotes |
; |
T20541 |
36462-36467 |
NNP |
denotes |
Santa |
T20542 |
36468-36472 |
NNP |
denotes |
Cruz |
T20543 |
36473-36486 |
NNP |
denotes |
Biotechnology |
T20544 |
36486-36487 |
: |
denotes |
; |
T20545 |
36488-36489 |
SYM |
denotes |
# |
T20536 |
36489-36491 |
NN |
denotes |
sc |
T20546 |
36491-36492 |
HYPH |
denotes |
- |
T20547 |
36492-36496 |
CD |
denotes |
9882 |
T20548 |
36496-36497 |
-RRB- |
denotes |
) |
T20549 |
36498-36501 |
CC |
denotes |
and |
T20550 |
36502-36503 |
DT |
denotes |
a |
T20552 |
36504-36505 |
CD |
denotes |
1 |
T20554 |
36505-36506 |
SYM |
denotes |
: |
T20553 |
36506-36509 |
CD |
denotes |
200 |
T20551 |
36510-36518 |
NN |
denotes |
dilution |
T20555 |
36519-36521 |
IN |
denotes |
of |
T20556 |
36522-36532 |
NNP |
denotes |
AlexaFluor |
T20558 |
36533-36536 |
CD |
denotes |
488 |
T20559 |
36536-36537 |
HYPH |
denotes |
- |
T20557 |
36537-36547 |
VBN |
denotes |
conjugated |
T20561 |
36548-36554 |
NN |
denotes |
donkey |
T20562 |
36555-36564 |
JJ |
denotes |
anti-goat |
T20563 |
36565-36574 |
JJ |
denotes |
secondary |
T20560 |
36575-36583 |
NN |
denotes |
antibody |
T20564 |
36583-36584 |
. |
denotes |
. |
T20565 |
36584-36992 |
sentence |
denotes |
The PM and ER were probed using mouse anti-Na+/K+-ATPase (Upstate, Waltham, Massachusetts, United States) or rabbit anti-calnexin (Stressgen Biotechnology, Victoria, British Columbia, Canada) antibodies and the secondary antibodies, Cy3-conjugated goat anti-mouse (1:200; Jackson ImmunoResearch, West Grove, Pennsylvania, United States) or AlexaFluor 594-conjugated chicken anti-rabbit (1:200) respectively. |
T20566 |
36585-36588 |
DT |
denotes |
The |
T20567 |
36589-36591 |
NN |
denotes |
PM |
T20569 |
36592-36595 |
CC |
denotes |
and |
T20570 |
36596-36598 |
NN |
denotes |
ER |
T20571 |
36599-36603 |
VBD |
denotes |
were |
T20568 |
36604-36610 |
VBN |
denotes |
probed |
T20572 |
36611-36616 |
VBG |
denotes |
using |
T20573 |
36617-36622 |
NN |
denotes |
mouse |
T20575 |
36623-36631 |
JJ |
denotes |
anti-Na+ |
T20576 |
36631-36632 |
HYPH |
denotes |
/ |
T20577 |
36632-36634 |
NN |
denotes |
K+ |
T20578 |
36634-36635 |
HYPH |
denotes |
- |
T20574 |
36635-36641 |
NN |
denotes |
ATPase |
T20580 |
36642-36643 |
-LRB- |
denotes |
( |
T20581 |
36643-36650 |
NNP |
denotes |
Upstate |
T20582 |
36650-36652 |
, |
denotes |
, |
T20583 |
36652-36659 |
NNP |
denotes |
Waltham |
T20584 |
36659-36661 |
, |
denotes |
, |
T20585 |
36661-36674 |
NNP |
denotes |
Massachusetts |
T20586 |
36674-36676 |
, |
denotes |
, |
T20587 |
36676-36682 |
NNP |
denotes |
United |
T20588 |
36683-36689 |
NNP |
denotes |
States |
T20589 |
36689-36690 |
-RRB- |
denotes |
) |
T20590 |
36691-36693 |
CC |
denotes |
or |
T20591 |
36694-36700 |
NN |
denotes |
rabbit |
T20592 |
36701-36714 |
JJ |
denotes |
anti-calnexin |
T20593 |
36715-36716 |
-LRB- |
denotes |
( |
T20595 |
36716-36725 |
NNP |
denotes |
Stressgen |
T20594 |
36726-36739 |
NNP |
denotes |
Biotechnology |
T20596 |
36739-36741 |
, |
denotes |
, |
T20597 |
36741-36749 |
NNP |
denotes |
Victoria |
T20598 |
36749-36751 |
, |
denotes |
, |
T20599 |
36751-36758 |
NNP |
denotes |
British |
T20600 |
36759-36767 |
NNP |
denotes |
Columbia |
T20601 |
36767-36769 |
, |
denotes |
, |
T20602 |
36769-36775 |
NNP |
denotes |
Canada |
T20603 |
36775-36776 |
-RRB- |
denotes |
) |
T20579 |
36777-36787 |
NNS |
denotes |
antibodies |
T20604 |
36788-36791 |
CC |
denotes |
and |
T20605 |
36792-36795 |
DT |
denotes |
the |
T20607 |
36796-36805 |
JJ |
denotes |
secondary |
T20606 |
36806-36816 |
NNS |
denotes |
antibodies |
T20608 |
36816-36818 |
, |
denotes |
, |
T20609 |
36818-36821 |
NN |
denotes |
Cy3 |
T20611 |
36821-36822 |
HYPH |
denotes |
- |
T20610 |
36822-36832 |
VBN |
denotes |
conjugated |
T20612 |
36833-36837 |
NN |
denotes |
goat |
T20613 |
36838-36848 |
JJ |
denotes |
anti-mouse |
T20614 |
36849-36850 |
-LRB- |
denotes |
( |
T20616 |
36850-36851 |
CD |
denotes |
1 |
T20617 |
36851-36852 |
SYM |
denotes |
: |
T20618 |
36852-36855 |
CD |
denotes |
200 |
T20619 |
36855-36856 |
: |
denotes |
; |
T20620 |
36857-36864 |
NNP |
denotes |
Jackson |
T20615 |
36865-36879 |
NNP |
denotes |
ImmunoResearch |
T20621 |
36879-36881 |
, |
denotes |
, |
T20622 |
36881-36885 |
NNP |
denotes |
West |
T20623 |
36886-36891 |
NNP |
denotes |
Grove |
T20624 |
36891-36893 |
, |
denotes |
, |
T20625 |
36893-36905 |
NNP |
denotes |
Pennsylvania |
T20626 |
36905-36907 |
, |
denotes |
, |
T20627 |
36907-36913 |
NNP |
denotes |
United |
T20628 |
36914-36920 |
NNP |
denotes |
States |
T20629 |
36920-36921 |
-RRB- |
denotes |
) |
T20630 |
36922-36924 |
CC |
denotes |
or |
T20631 |
36925-36935 |
NNP |
denotes |
AlexaFluor |
T20633 |
36936-36939 |
CD |
denotes |
594 |
T20634 |
36939-36940 |
HYPH |
denotes |
- |
T20632 |
36940-36950 |
VBN |
denotes |
conjugated |
T20635 |
36951-36958 |
NN |
denotes |
chicken |
T20636 |
36959-36970 |
JJ |
denotes |
anti-rabbit |
T20637 |
36971-36972 |
-LRB- |
denotes |
( |
T20638 |
36972-36973 |
CD |
denotes |
1 |
T20639 |
36973-36974 |
SYM |
denotes |
: |
T20640 |
36974-36977 |
CD |
denotes |
200 |
T20641 |
36977-36978 |
-RRB- |
denotes |
) |
T20642 |
36979-36991 |
RB |
denotes |
respectively |
T20643 |
36991-36992 |
. |
denotes |
. |
T20644 |
36992-37072 |
sentence |
denotes |
Cells were washed in PBS, counterstained with DAPI, and mounted in Vectashield. |
T20645 |
36993-36998 |
NNS |
denotes |
Cells |
T20647 |
36999-37003 |
VBD |
denotes |
were |
T20646 |
37004-37010 |
VBN |
denotes |
washed |
T20648 |
37011-37013 |
IN |
denotes |
in |
T20649 |
37014-37017 |
NN |
denotes |
PBS |
T20650 |
37017-37019 |
, |
denotes |
, |
T20651 |
37019-37033 |
VBN |
denotes |
counterstained |
T20652 |
37034-37038 |
IN |
denotes |
with |
T20653 |
37039-37043 |
NN |
denotes |
DAPI |
T20654 |
37043-37045 |
, |
denotes |
, |
T20655 |
37045-37048 |
CC |
denotes |
and |
T20656 |
37049-37056 |
VBN |
denotes |
mounted |
T20657 |
37057-37059 |
IN |
denotes |
in |
T20658 |
37060-37071 |
NNP |
denotes |
Vectashield |
T20659 |
37071-37072 |
. |
denotes |
. |
T20660 |
37072-37290 |
sentence |
denotes |
In experiments in which GFP fusions were used, AQP2 was probed using the antibody combination used for kidney immunohistochemistry in order to detect the AQP2 at 594 nm, to distinguish between the GFP fusion proteins. |
T20661 |
37073-37075 |
IN |
denotes |
In |
T20663 |
37076-37087 |
NNS |
denotes |
experiments |
T20664 |
37088-37090 |
IN |
denotes |
in |
T20666 |
37091-37096 |
WDT |
denotes |
which |
T20667 |
37097-37100 |
NN |
denotes |
GFP |
T20668 |
37101-37108 |
NNS |
denotes |
fusions |
T20669 |
37109-37113 |
VBD |
denotes |
were |
T20665 |
37114-37118 |
VBN |
denotes |
used |
T20670 |
37118-37120 |
, |
denotes |
, |
T20671 |
37120-37124 |
NN |
denotes |
AQP2 |
T20672 |
37125-37128 |
VBD |
denotes |
was |
T20662 |
37129-37135 |
VBN |
denotes |
probed |
T20673 |
37136-37141 |
VBG |
denotes |
using |
T20674 |
37142-37145 |
DT |
denotes |
the |
T20676 |
37146-37154 |
NN |
denotes |
antibody |
T20675 |
37155-37166 |
NN |
denotes |
combination |
T20677 |
37167-37171 |
VBN |
denotes |
used |
T20678 |
37172-37175 |
IN |
denotes |
for |
T20679 |
37176-37182 |
NN |
denotes |
kidney |
T20680 |
37183-37203 |
NN |
denotes |
immunohistochemistry |
T20681 |
37204-37206 |
IN |
denotes |
in |
T20682 |
37207-37212 |
NN |
denotes |
order |
T20683 |
37213-37215 |
TO |
denotes |
to |
T20684 |
37216-37222 |
VB |
denotes |
detect |
T20685 |
37223-37226 |
DT |
denotes |
the |
T20686 |
37227-37231 |
NN |
denotes |
AQP2 |
T20687 |
37232-37234 |
IN |
denotes |
at |
T20688 |
37235-37238 |
CD |
denotes |
594 |
T20689 |
37239-37241 |
NN |
denotes |
nm |
T20690 |
37241-37243 |
, |
denotes |
, |
T20691 |
37243-37245 |
TO |
denotes |
to |
T20692 |
37246-37257 |
VB |
denotes |
distinguish |
T20693 |
37258-37265 |
IN |
denotes |
between |
T20694 |
37266-37269 |
DT |
denotes |
the |
T20696 |
37270-37273 |
NN |
denotes |
GFP |
T20697 |
37274-37280 |
NN |
denotes |
fusion |
T20695 |
37281-37289 |
NN |
denotes |
proteins |
T20698 |
37289-37290 |
. |
denotes |
. |
T20832 |
37292-37300 |
JJ |
denotes |
Confocal |
T20833 |
37301-37311 |
NN |
denotes |
microscopy |
T20834 |
37311-37312 |
. |
denotes |
. |
T20835 |
37312-37460 |
sentence |
denotes |
Optical z-section images were collected on a BioRad (Hercules, California, United States) Rainbow Radiance 2100 Laser Scanning Confocal Microscope. |
T20836 |
37313-37320 |
JJ |
denotes |
Optical |
T20838 |
37321-37322 |
NN |
denotes |
z |
T20840 |
37322-37323 |
HYPH |
denotes |
- |
T20839 |
37323-37330 |
NN |
denotes |
section |
T20837 |
37331-37337 |
NNS |
denotes |
images |
T20842 |
37338-37342 |
VBD |
denotes |
were |
T20841 |
37343-37352 |
VBN |
denotes |
collected |
T20843 |
37353-37355 |
IN |
denotes |
on |
T20844 |
37356-37357 |
DT |
denotes |
a |
T20846 |
37358-37364 |
NNP |
denotes |
BioRad |
T20847 |
37365-37366 |
-LRB- |
denotes |
( |
T20848 |
37366-37374 |
NNP |
denotes |
Hercules |
T20849 |
37374-37376 |
, |
denotes |
, |
T20850 |
37376-37386 |
NNP |
denotes |
California |
T20851 |
37386-37388 |
, |
denotes |
, |
T20852 |
37388-37394 |
NNP |
denotes |
United |
T20853 |
37395-37401 |
NNP |
denotes |
States |
T20854 |
37401-37402 |
-RRB- |
denotes |
) |
T20855 |
37403-37410 |
NNP |
denotes |
Rainbow |
T20856 |
37411-37419 |
NNP |
denotes |
Radiance |
T20857 |
37420-37424 |
CD |
denotes |
2100 |
T20858 |
37425-37430 |
NN |
denotes |
Laser |
T20859 |
37431-37439 |
NN |
denotes |
Scanning |
T20860 |
37440-37448 |
NN |
denotes |
Confocal |
T20845 |
37449-37459 |
NN |
denotes |
Microscope |
T20861 |
37459-37460 |
. |
denotes |
. |
T20862 |
37460-37645 |
sentence |
denotes |
Image stacks were flattened, or sectioned along the z-axis, then further processed using BioRad Laser Sharp 2000 software and Image J software (v. 1.32; National Institutes of Health). |
T20863 |
37461-37466 |
NN |
denotes |
Image |
T20864 |
37467-37473 |
NNS |
denotes |
stacks |
T20866 |
37474-37478 |
VBD |
denotes |
were |
T20865 |
37479-37488 |
VBN |
denotes |
flattened |
T20867 |
37488-37490 |
, |
denotes |
, |
T20868 |
37490-37492 |
CC |
denotes |
or |
T20869 |
37493-37502 |
VBN |
denotes |
sectioned |
T20870 |
37503-37508 |
IN |
denotes |
along |
T20871 |
37509-37512 |
DT |
denotes |
the |
T20873 |
37513-37514 |
NN |
denotes |
z |
T20874 |
37514-37515 |
HYPH |
denotes |
- |
T20872 |
37515-37519 |
NN |
denotes |
axis |
T20875 |
37519-37521 |
, |
denotes |
, |
T20876 |
37521-37525 |
RB |
denotes |
then |
T20878 |
37526-37533 |
RB |
denotes |
further |
T20877 |
37534-37543 |
VBN |
denotes |
processed |
T20879 |
37544-37549 |
VBG |
denotes |
using |
T20880 |
37550-37556 |
NNP |
denotes |
BioRad |
T20882 |
37557-37562 |
NNP |
denotes |
Laser |
T20883 |
37563-37568 |
NNP |
denotes |
Sharp |
T20884 |
37569-37573 |
CD |
denotes |
2000 |
T20881 |
37574-37582 |
NN |
denotes |
software |
T20885 |
37583-37586 |
CC |
denotes |
and |
T20886 |
37587-37592 |
NNP |
denotes |
Image |
T20887 |
37593-37594 |
NNP |
denotes |
J |
T20888 |
37595-37603 |
NN |
denotes |
software |
T20889 |
37604-37605 |
-LRB- |
denotes |
( |
T20891 |
37605-37607 |
NN |
denotes |
v. |
T20892 |
37608-37612 |
CD |
denotes |
1.32 |
T20893 |
37612-37613 |
: |
denotes |
; |
T20894 |
37614-37622 |
NNP |
denotes |
National |
T20890 |
37623-37633 |
NNPS |
denotes |
Institutes |
T20895 |
37634-37636 |
IN |
denotes |
of |
T20896 |
37637-37643 |
NNP |
denotes |
Health |
T20897 |
37643-37644 |
-RRB- |
denotes |
) |
T20898 |
37644-37645 |
. |
denotes |
. |
T20899 |
37645-37725 |
sentence |
denotes |
Colocalization was performed using the overlay coefficient of Image J software. |
T20900 |
37646-37660 |
NN |
denotes |
Colocalization |
T20902 |
37661-37664 |
VBD |
denotes |
was |
T20901 |
37665-37674 |
VBN |
denotes |
performed |
T20903 |
37675-37680 |
VBG |
denotes |
using |
T20904 |
37681-37684 |
DT |
denotes |
the |
T20906 |
37685-37692 |
JJ |
denotes |
overlay |
T20905 |
37693-37704 |
NN |
denotes |
coefficient |
T20907 |
37705-37707 |
IN |
denotes |
of |
T20908 |
37708-37713 |
NNP |
denotes |
Image |
T20909 |
37714-37715 |
NNP |
denotes |
J |
T20910 |
37716-37724 |
NN |
denotes |
software |
T20911 |
37724-37725 |
. |
denotes |
. |
R1000 |
T9121 |
T9120 |
amod |
sixth,domain |
R1001 |
T9005 |
T9006 |
compound |
plasma,levels |
R1002 |
T9122 |
T9123 |
npadvmod |
membrane,spanning |
R1003 |
T9123 |
T9120 |
amod |
spanning,domain |
R1004 |
T9124 |
T9120 |
punct |
", ",domain |
R1005 |
T9125 |
T9126 |
det |
a,region |
R1006 |
T9006 |
T9004 |
nsubj |
levels,were |
R1007 |
T9126 |
T9120 |
appos |
region,domain |
R1008 |
T9127 |
T9126 |
amod |
rich,region |
R1009 |
T9128 |
T9127 |
prep |
in,rich |
R1010 |
T9129 |
T9130 |
amod |
hydrophobic,acids |
R1011 |
T9130 |
T9128 |
pobj |
acids,in |
R1012 |
T9131 |
T9130 |
compound |
amino,acids |
R1013 |
T9007 |
T9006 |
compound |
glucose,levels |
R1014 |
T9132 |
T9113 |
punct |
.,lies |
R1015 |
T9134 |
T9135 |
nsubjpass |
This,conserved |
R1016 |
T9008 |
T9004 |
acomp |
normal,were |
R1017 |
T9136 |
T9134 |
cc |
and,This |
R1018 |
T9137 |
T9138 |
det |
the,other |
R1019 |
T9009 |
T9004 |
cc |
and,were |
R1020 |
T9138 |
T9139 |
nmod |
other,domains |
R1021 |
T9139 |
T9134 |
conj |
domains,This |
R1022 |
T9140 |
T9141 |
npadvmod |
membrane,spanning |
R1023 |
T9010 |
T9011 |
expl |
there,was |
R1024 |
T9141 |
T9139 |
amod |
spanning,domains |
R1025 |
T9142 |
T9141 |
punct |
-,spanning |
R1026 |
T9011 |
T9004 |
conj |
was,were |
R1027 |
T9143 |
T9135 |
auxpass |
are,conserved |
R1028 |
T9144 |
T9135 |
prep |
among,conserved |
R1029 |
T9145 |
T9146 |
amod |
vertebrate,species |
R1030 |
T9012 |
T9013 |
det |
no,glucose |
R1031 |
T9146 |
T9144 |
pobj |
species,among |
R1032 |
T9147 |
T9135 |
punct |
.,conserved |
R1033 |
T9013 |
T9011 |
attr |
glucose,was |
R1034 |
T9149 |
T9150 |
det |
The,phenylalanine |
R1035 |
T9150 |
T9151 |
nsubj |
phenylalanine,is |
R1036 |
T9014 |
T9011 |
prep |
in,was |
R1037 |
T9152 |
T9150 |
prep |
at,phenylalanine |
R1038 |
T9015 |
T9016 |
det |
the,urine |
R1039 |
T9016 |
T9014 |
pobj |
urine,in |
R1040 |
T9153 |
T9152 |
pobj |
position,at |
R1041 |
T9154 |
T9153 |
nummod |
204,position |
R1042 |
T9017 |
T9018 |
punct |
(,data |
R1043 |
T9155 |
T9156 |
advmod |
particularly,conserved |
R1044 |
T9156 |
T9151 |
acomp |
conserved,is |
R1045 |
T9018 |
T9002 |
meta |
data,showed |
R1046 |
T9157 |
T9156 |
advmod |
well,conserved |
R1047 |
T9158 |
T9159 |
punct |
(,Figure |
R1048 |
T9159 |
T9156 |
parataxis |
Figure,conserved |
R1049 |
T9019 |
T9018 |
amod |
unpublished,data |
R1050 |
T9160 |
T9159 |
nummod |
1B,Figure |
R1051 |
T9161 |
T9159 |
punct |
),Figure |
R1052 |
T9020 |
T9018 |
punct |
),data |
R1053 |
T9162 |
T9151 |
punct |
", ",is |
R1054 |
T9163 |
T9164 |
preconj |
not,among |
R1055 |
T9164 |
T9151 |
prep |
among,is |
R1056 |
T9021 |
T9002 |
punct |
.,showed |
R1057 |
T9165 |
T9163 |
advmod |
only,not |
R1058 |
T9166 |
T9167 |
amod |
vertebrate,proteins |
R1059 |
T9023 |
T9024 |
advmod |
Hence,was |
R1060 |
T9167 |
T9164 |
pobj |
proteins,among |
R1061 |
T9168 |
T9167 |
compound |
AQP2,proteins |
R1062 |
T9169 |
T9164 |
punct |
", ",among |
R1063 |
T9170 |
T9164 |
cc |
but,among |
R1064 |
T9171 |
T9170 |
advmod |
also,but |
R1065 |
T9172 |
T9164 |
conj |
among,among |
R1066 |
T9173 |
T9174 |
compound |
others,members |
R1067 |
T9025 |
T9024 |
punct |
", ",was |
R1068 |
T9174 |
T9172 |
pobj |
members,among |
R1069 |
T9175 |
T9174 |
prep |
of,members |
R1070 |
T9176 |
T9177 |
det |
this,family |
R1071 |
T9177 |
T9175 |
pobj |
family,of |
R1072 |
T9178 |
T9151 |
punct |
.,is |
R1073 |
T9026 |
T9024 |
nsubj |
this,was |
R1074 |
T9180 |
T9181 |
compound |
Aqp2F204V,F204V |
R1075 |
T9181 |
T9183 |
compound |
F204V,mice |
R1076 |
T9027 |
T9028 |
det |
an,example |
R1077 |
T9182 |
T9181 |
punct |
/,F204V |
R1078 |
T9183 |
T9184 |
nsubj |
mice,have |
R1079 |
T9028 |
T9024 |
attr |
example,was |
R1080 |
T9185 |
T9186 |
advmod |
dramatically,increased |
R1081 |
T9186 |
T9187 |
amod |
increased,production |
R1082 |
T9029 |
T9028 |
prep |
of,example |
R1083 |
T9187 |
T9184 |
dobj |
production,have |
R1084 |
T9188 |
T9187 |
compound |
urine,production |
R1085 |
T9189 |
T9184 |
punct |
", ",have |
R1086 |
T9030 |
T9031 |
compound |
diabetes,insipidus |
R1087 |
T9190 |
T9191 |
prep |
in,producing |
R1088 |
T9191 |
T9184 |
advcl |
producing,have |
R1089 |
T9031 |
T9029 |
pobj |
insipidus,of |
R1090 |
T9032 |
T9024 |
punct |
.,was |
R1091 |
T9034 |
T9035 |
det |
The,disorder |
R1092 |
T9192 |
T9193 |
det |
some,cases |
R1093 |
T9193 |
T9190 |
pobj |
cases,in |
R1094 |
T9194 |
T9195 |
det |
an,amount |
R1095 |
T9035 |
T9036 |
nsubj |
disorder,segregated |
R1096 |
T9195 |
T9191 |
dobj |
amount,producing |
R1097 |
T9196 |
T9195 |
prep |
of,amount |
R1098 |
T9197 |
T9196 |
pobj |
urine,of |
R1099 |
T9037 |
T9035 |
prep |
in,disorder |
R1100 |
T9198 |
T9191 |
prep |
in,producing |
R1101 |
T9199 |
T9200 |
nummod |
24,h |
R1102 |
T9200 |
T9198 |
pobj |
h,in |
R1103 |
T9201 |
T9202 |
dep |
that,exceeds |
R1104 |
T9038 |
T9039 |
det |
these,mice |
R1105 |
T9202 |
T9191 |
ccomp |
exceeds,producing |
R1106 |
T9203 |
T9204 |
poss |
their,weight |
R1107 |
T9204 |
T9202 |
dobj |
weight,exceeds |
R1108 |
T9039 |
T9037 |
pobj |
mice,in |
R1109 |
T9205 |
T9204 |
compound |
body,weight |
R1110 |
T9206 |
T9191 |
punct |
", ",producing |
R1111 |
T9040 |
T9036 |
prep |
in,segregated |
R1112 |
T9207 |
T9191 |
prep |
compared,producing |
R1113 |
T9208 |
T9207 |
prep |
to,compared |
R1114 |
T9209 |
T9210 |
poss |
their,littermates |
R1115 |
T9210 |
T9208 |
pobj |
littermates,to |
R1116 |
T9211 |
T9210 |
amod |
heterozygous,littermates |
R1117 |
T9212 |
T9211 |
cc |
or,heterozygous |
R1118 |
T9041 |
T9042 |
det |
a,manner |
R1119 |
T9213 |
T9214 |
amod |
wild,type |
R1120 |
T9214 |
T9211 |
conj |
type,heterozygous |
R1121 |
T9215 |
T9214 |
punct |
-,type |
R1122 |
T9042 |
T9040 |
pobj |
manner,in |
R1123 |
T9216 |
T9184 |
punct |
.,have |
R1124 |
T9043 |
T9042 |
amod |
monogenic,manner |
R1125 |
T9218 |
T9219 |
amod |
Such,loss |
R1126 |
T9219 |
T9220 |
nsubj |
loss,lead |
R1127 |
T9044 |
T9042 |
punct |
", ",manner |
R1128 |
T9221 |
T9219 |
prep |
of,loss |
R1129 |
T9222 |
T9221 |
pobj |
water,of |
R1130 |
T9223 |
T9220 |
aux |
would,lead |
R1131 |
T9224 |
T9220 |
advmod |
rapidly,lead |
R1132 |
T9045 |
T9046 |
amod |
autosomal,recessive |
R1133 |
T9225 |
T9220 |
prep |
to,lead |
R1134 |
T9226 |
T9225 |
pobj |
dehydration,to |
R1135 |
T9227 |
T9228 |
auxpass |
were,compensated |
R1136 |
T9046 |
T9042 |
amod |
recessive,manner |
R1137 |
T9228 |
T9220 |
advcl |
compensated,lead |
R1138 |
T9229 |
T9228 |
nsubjpass |
it,compensated |
R1139 |
T9047 |
T9036 |
punct |
", ",segregated |
R1140 |
T9230 |
T9228 |
neg |
not,compensated |
R1141 |
T9231 |
T9228 |
agent |
by,compensated |
R1142 |
T9232 |
T9233 |
amod |
increased,intake |
R1143 |
T9048 |
T9036 |
advcl |
making,segregated |
R1144 |
T9233 |
T9231 |
pobj |
intake,by |
R1145 |
T9234 |
T9233 |
compound |
water,intake |
R1146 |
T9235 |
T9220 |
punct |
.,lead |
R1147 |
T9049 |
T9050 |
nsubj |
Aqp2,gene |
R1148 |
T9237 |
T9238 |
advmod |
Indeed,increase |
R1149 |
T9050 |
T9048 |
ccomp |
gene,making |
R1150 |
T9239 |
T9238 |
punct |
", ",increase |
R1151 |
T9051 |
T9050 |
det |
a,gene |
R1152 |
T9240 |
T9241 |
compound |
mutant,mice |
R1153 |
T9052 |
T9050 |
compound |
candidate,gene |
R1154 |
T9241 |
T9238 |
nsubj |
mice,increase |
R1155 |
T9242 |
T9238 |
advmod |
also,increase |
R1156 |
T9053 |
T9036 |
punct |
.,segregated |
R1157 |
T9243 |
T9238 |
advmod |
dramatically,increase |
R1158 |
T9244 |
T9245 |
poss |
their,intake |
R1159 |
T9245 |
T9238 |
dobj |
intake,increase |
R1160 |
T9055 |
T9056 |
nsubj |
Sequencing,identified |
R1161 |
T9246 |
T9245 |
compound |
water,intake |
R1162 |
T9247 |
T9248 |
punct |
(,Figure |
R1163 |
T9248 |
T9238 |
parataxis |
Figure,increase |
R1164 |
T9249 |
T9248 |
nummod |
1C,Figure |
R1165 |
T9057 |
T9055 |
prep |
of,Sequencing |
R1166 |
T9250 |
T9248 |
punct |
),Figure |
R1167 |
T9251 |
T9238 |
prep |
compared,increase |
R1168 |
T9252 |
T9251 |
prep |
to,compared |
R1169 |
T9253 |
T9254 |
poss |
their,littermates |
R1170 |
T9254 |
T9252 |
pobj |
littermates,to |
R1171 |
T9058 |
T9059 |
compound |
Aqp2,region |
R1172 |
T9255 |
T9254 |
amod |
heterozygous,littermates |
R1173 |
T9256 |
T9255 |
cc |
or,heterozygous |
R1174 |
T9257 |
T9258 |
amod |
wild,type |
R1175 |
T9059 |
T9057 |
pobj |
region,of |
R1176 |
T9258 |
T9255 |
conj |
type,heterozygous |
R1177 |
T9259 |
T9258 |
punct |
-,type |
R1178 |
T9260 |
T9238 |
punct |
.,increase |
R1179 |
T9060 |
T9059 |
compound |
coding,region |
R1180 |
T9262 |
T9263 |
det |
This,phenotype |
R1181 |
T9061 |
T9059 |
prep |
of,region |
R1182 |
T9263 |
T9264 |
nsubj |
phenotype,showed |
R1183 |
T9265 |
T9263 |
punct |
—,phenotype |
R1184 |
T9062 |
T9063 |
amod |
affected,mice |
R1185 |
T9266 |
T9267 |
amod |
increased,output |
R1186 |
T9267 |
T9263 |
appos |
output,phenotype |
R1187 |
T9268 |
T9267 |
amod |
urinary,output |
R1188 |
T9063 |
T9061 |
pobj |
mice,of |
R1189 |
T9269 |
T9267 |
cc |
and,output |
R1190 |
T9270 |
T9271 |
compound |
water,intake |
R1191 |
T9271 |
T9267 |
conj |
intake,output |
R1192 |
T9064 |
T9065 |
det |
a,transversion |
R1193 |
T9272 |
T9264 |
punct |
—,showed |
R1194 |
T9273 |
T9274 |
amod |
complete,concordance |
R1195 |
T9274 |
T9264 |
dobj |
concordance,showed |
R1196 |
T9065 |
T9056 |
dobj |
transversion,identified |
R1197 |
T9275 |
T9274 |
prep |
with,concordance |
R1198 |
T9276 |
T9275 |
pobj |
homozygosity,with |
R1199 |
T9277 |
T9276 |
prep |
of,homozygosity |
R1200 |
T9066 |
T9065 |
nmod |
thymine,transversion |
R1201 |
T9278 |
T9279 |
det |
the,mutation |
R1202 |
T9279 |
T9277 |
pobj |
mutation,of |
R1203 |
T9280 |
T9279 |
compound |
F204V,mutation |
R1204 |
T9067 |
T9066 |
prep |
to,thymine |
R1205 |
T9281 |
T9264 |
prep |
in,showed |
R1206 |
T9282 |
T9283 |
det |
the,animals |
R1207 |
T9283 |
T9281 |
pobj |
animals,in |
R1208 |
T9068 |
T9067 |
pobj |
guanine,to |
R1209 |
T9284 |
T9283 |
nummod |
58,animals |
R1210 |
T9285 |
T9283 |
acl |
tested,animals |
R1211 |
T9286 |
T9264 |
punct |
.,showed |
R1212 |
T9069 |
T9066 |
punct |
(,thymine |
R1213 |
T9288 |
T9289 |
compound |
Diabetes,insipidus |
R1214 |
T9289 |
T9290 |
nsubjpass |
insipidus,defined |
R1215 |
T9070 |
T9066 |
appos |
T,thymine |
R1216 |
T9291 |
T9290 |
aux |
can,defined |
R1217 |
T9292 |
T9290 |
auxpass |
be,defined |
R1218 |
T9293 |
T9290 |
prep |
as,defined |
R1219 |
T9294 |
T9295 |
det |
an,inability |
R1220 |
T9295 |
T9293 |
pobj |
inability,as |
R1221 |
T9071 |
T9070 |
prep |
to,T |
R1222 |
T9296 |
T9297 |
aux |
to,concentrate |
R1223 |
T9297 |
T9295 |
acl |
concentrate,inability |
R1224 |
T9072 |
T9071 |
pobj |
G,to |
R1225 |
T9073 |
T9065 |
punct |
),transversion |
R1226 |
T9074 |
T9075 |
punct |
(,Figure |
R1227 |
T9298 |
T9297 |
dobj |
urine,concentrate |
R1228 |
T9299 |
T9300 |
advmod |
where,appropriate |
R1229 |
T9075 |
T9065 |
parataxis |
Figure,transversion |
R1230 |
T9300 |
T9297 |
advcl |
appropriate,concentrate |
R1231 |
T9301 |
T9290 |
punct |
.,defined |
R1232 |
T9076 |
T9075 |
nummod |
1A,Figure |
R1233 |
T9303 |
T9304 |
prep |
Compared,produce |
R1234 |
T9305 |
T9303 |
prep |
to,Compared |
R1235 |
T9077 |
T9075 |
punct |
),Figure |
R1236 |
T9306 |
T9307 |
amod |
wild,type |
R1237 |
T9307 |
T9309 |
nmod |
type,littermates |
R1238 |
T9308 |
T9307 |
punct |
-,type |
R1239 |
T9078 |
T9065 |
punct |
", ",transversion |
R1240 |
T9309 |
T9305 |
pobj |
littermates,to |
R1241 |
T9310 |
T9307 |
cc |
or,type |
R1242 |
T9311 |
T9307 |
conj |
heterozygous,type |
R1243 |
T9079 |
T9080 |
dep |
which,predicted |
R1244 |
T9312 |
T9304 |
punct |
", ",produce |
R1245 |
T9313 |
T9314 |
compound |
Aqp2F204V,F204V |
R1246 |
T9314 |
T9316 |
compound |
F204V,mice |
R1247 |
T9080 |
T9065 |
relcl |
predicted,transversion |
R1248 |
T9315 |
T9314 |
punct |
/,F204V |
R1249 |
T9316 |
T9304 |
nsubj |
mice,produce |
R1250 |
T9317 |
T9318 |
advmod |
very,dilute |
R1251 |
T9318 |
T9319 |
amod |
dilute,urine |
R1252 |
T9081 |
T9080 |
auxpass |
is,predicted |
R1253 |
T9319 |
T9304 |
dobj |
urine,produce |
R1254 |
T9320 |
T9321 |
punct |
(,Figure |
R1255 |
T9321 |
T9304 |
parataxis |
Figure,produce |
R1256 |
T9082 |
T9083 |
aux |
to,lead |
R1257 |
T9322 |
T9321 |
nummod |
1D,Figure |
R1258 |
T9323 |
T9321 |
punct |
),Figure |
R1259 |
T9083 |
T9080 |
xcomp |
lead,predicted |
R1260 |
T9324 |
T9304 |
punct |
.,produce |
R1261 |
T9326 |
T9327 |
amod |
Basal,concentration |
R1262 |
T9084 |
T9083 |
prep |
to,lead |
R1263 |
T9085 |
T9086 |
det |
a,substitution |
R1264 |
T9327 |
T9329 |
nsubj |
concentration,is |
R1265 |
T9403 |
T9402 |
oprd |
desmopressin,called |
R1266 |
T9328 |
T9327 |
compound |
urine,concentration |
R1267 |
T9330 |
T9327 |
prep |
in,concentration |
R1268 |
T9331 |
T9332 |
compound |
mutant,mice |
R1269 |
T9332 |
T9330 |
pobj |
mice,in |
R1270 |
T9333 |
T9334 |
advmod |
about,161 |
R1271 |
T9404 |
T9383 |
punct |
),analog |
R1272 |
T9334 |
T9335 |
nummod |
161,mOsm |
R1273 |
T9335 |
T9329 |
attr |
mOsm,is |
R1274 |
T9405 |
T9386 |
punct |
", ",is |
R1275 |
T9336 |
T9335 |
punct |
", ",mOsm |
R1276 |
T9337 |
T9335 |
prep |
compared,mOsm |
R1277 |
T9338 |
T9337 |
prep |
to,compared |
R1278 |
T9406 |
T9407 |
det |
a,agonist |
R1279 |
T9339 |
T9340 |
quantmod |
about,"1,293" |
R1280 |
T9340 |
T9341 |
nummod |
"1,293",mOsm |
R1281 |
T9341 |
T9338 |
pobj |
mOsm,to |
R1282 |
T9407 |
T9386 |
attr |
agonist,is |
R1283 |
T9342 |
T9341 |
prep |
in,mOsm |
R1284 |
T9343 |
T9344 |
amod |
wild,type |
R1285 |
T9344 |
T9346 |
compound |
type,mice |
R1286 |
T9408 |
T9407 |
amod |
potent,agonist |
R1287 |
T9345 |
T9344 |
punct |
-,type |
R1288 |
T9346 |
T9342 |
pobj |
mice,in |
R1289 |
T9409 |
T9407 |
prep |
of,agonist |
R1290 |
T9347 |
T9348 |
punct |
(,0.001 |
R1291 |
T9348 |
T9329 |
parataxis |
0.001,is |
R1292 |
T9349 |
T9348 |
nsubj |
p,0.001 |
R1293 |
T9410 |
T9409 |
pobj |
AVPR2,of |
R1294 |
T9350 |
T9348 |
punct |
<,0.001 |
R1295 |
T9351 |
T9348 |
punct |
),0.001 |
R1296 |
T9352 |
T9329 |
punct |
.,is |
R1297 |
T9411 |
T9386 |
punct |
.,is |
R1298 |
T9354 |
T9355 |
advmod |
Normally,is |
R1299 |
T9413 |
T9414 |
advmod |
When,administered |
R1300 |
T9356 |
T9355 |
punct |
", ",is |
R1301 |
T9357 |
T9358 |
compound |
urine,concentration |
R1302 |
T9358 |
T9355 |
nsubj |
concentration,is |
R1303 |
T9359 |
T9355 |
prep |
under,is |
R1304 |
T9360 |
T9361 |
det |
the,control |
R1305 |
T9361 |
T9359 |
pobj |
control,under |
R1306 |
T9414 |
T9415 |
advcl |
administered,leads |
R1307 |
T9362 |
T9361 |
prep |
of,control |
R1308 |
T9363 |
T9364 |
det |
the,hypothalamus |
R1309 |
T9364 |
T9362 |
pobj |
hypothalamus,of |
R1310 |
T9365 |
T9364 |
punct |
", ",hypothalamus |
R1311 |
T9416 |
T9414 |
prep |
to,administered |
R1312 |
T9366 |
T9367 |
dep |
which,secretes |
R1313 |
T9367 |
T9364 |
relcl |
secretes,hypothalamus |
R1314 |
T9368 |
T9367 |
punct |
", ",secretes |
R1315 |
T9369 |
T9367 |
prep |
in,secretes |
R1316 |
T9417 |
T9418 |
amod |
wild,type |
R1317 |
T9370 |
T9369 |
pobj |
response,in |
R1318 |
T9371 |
T9370 |
prep |
to,response |
R1319 |
T9372 |
T9371 |
pobj |
hypovolemia,to |
R1320 |
T9373 |
T9372 |
cc |
or,hypovolemia |
R1321 |
T9374 |
T9372 |
conj |
hypernatremia,hypovolemia |
R1322 |
T9375 |
T9376 |
punct |
[,21 |
R1323 |
T9418 |
T9420 |
compound |
type,mice |
R1324 |
T9376 |
T9370 |
parataxis |
21,response |
R1325 |
T9377 |
T9376 |
punct |
],21 |
R1326 |
T9378 |
T9367 |
punct |
", ",secretes |
R1327 |
T9379 |
T9367 |
dobj |
AVP,secretes |
R1328 |
T9419 |
T9418 |
punct |
-,type |
R1329 |
T9380 |
T9355 |
punct |
.,is |
R1330 |
T9382 |
T9383 |
det |
The,analog |
R1331 |
T9420 |
T9416 |
pobj |
mice,to |
R1332 |
T9383 |
T9386 |
nsubj |
analog,is |
R1333 |
T9384 |
T9383 |
amod |
synthetic,analog |
R1334 |
T9421 |
T9415 |
punct |
", ",leads |
R1335 |
T9385 |
T9383 |
compound |
AVP,analog |
R1336 |
T9387 |
T9383 |
punct |
", ",analog |
R1337 |
T9422 |
T9415 |
nsubj |
dDAVP,leads |
R1338 |
T9388 |
T9389 |
nummod |
1,deamino |
R1339 |
T9389 |
T9391 |
nmod |
deamino,arginine |
R1340 |
T9390 |
T9389 |
punct |
-,deamino |
R1341 |
T9423 |
T9415 |
prep |
to,leads |
R1342 |
T9424 |
T9425 |
det |
a,increase |
R1343 |
T9391 |
T9397 |
compound |
arginine,vasopressin |
R1344 |
T9425 |
T9423 |
pobj |
increase,to |
R1345 |
T9392 |
T9391 |
punct |
-,arginine |
R1346 |
T9393 |
T9391 |
nummod |
8,arginine |
R1347 |
T9426 |
T9425 |
amod |
dramatic,increase |
R1348 |
T9394 |
T9391 |
punct |
-,arginine |
R1349 |
T9395 |
T9391 |
compound |
D,arginine |
R1350 |
T9396 |
T9391 |
punct |
-,arginine |
R1351 |
T9427 |
T9425 |
prep |
in,increase |
R1352 |
T9397 |
T9383 |
appos |
vasopressin,analog |
R1353 |
T9398 |
T9397 |
punct |
(,vasopressin |
R1354 |
T9399 |
T9397 |
appos |
dDAVP,vasopressin |
R1355 |
T9428 |
T9429 |
compound |
urine,concentration |
R1356 |
T9400 |
T9397 |
punct |
;,vasopressin |
R1357 |
T9401 |
T9402 |
advmod |
also,called |
R1358 |
T9402 |
T9397 |
acl |
called,vasopressin |
R1359 |
T9429 |
T9427 |
pobj |
concentration,in |
R1360 |
T9430 |
T9425 |
punct |
", ",increase |
R1361 |
T9431 |
T9425 |
prep |
from,increase |
R1362 |
T9432 |
T9431 |
pobj |
"1,293",from |
R1363 |
T9509 |
T9510 |
dep |
which,be |
R1364 |
T9510 |
T9505 |
relcl |
be,channel |
R1365 |
T9433 |
T9431 |
prep |
to,from |
R1366 |
T9511 |
T9510 |
aux |
must,be |
R1367 |
T9512 |
T9510 |
acomp |
sufficient,be |
R1368 |
T9513 |
T9514 |
aux |
to,allow |
R1369 |
T9434 |
T9433 |
pobj |
"5,885",to |
R1370 |
T9514 |
T9512 |
xcomp |
allow,sufficient |
R1371 |
T9515 |
T9514 |
dobj |
survival,allow |
R1372 |
T9516 |
T9515 |
prep |
of,survival |
R1373 |
T9517 |
T9518 |
det |
the,individual |
R1374 |
T9518 |
T9516 |
pobj |
individual,of |
R1375 |
T9519 |
T9497 |
punct |
", ",indicates |
R1376 |
T9435 |
T9431 |
pobj |
mOsm,from |
R1377 |
T9520 |
T9497 |
prep |
in,indicates |
R1378 |
T9521 |
T9520 |
pobj |
contrast,in |
R1379 |
T9522 |
T9521 |
prep |
to,contrast |
R1380 |
T9436 |
T9437 |
punct |
(,Figure |
R1381 |
T9523 |
T9524 |
det |
the,mouse |
R1382 |
T9524 |
T9522 |
pobj |
mouse,to |
R1383 |
T9437 |
T9415 |
parataxis |
Figure,leads |
R1384 |
T9525 |
T9524 |
nmod |
T126M,mouse |
R1385 |
T9526 |
T9524 |
amod |
knock,mouse |
R1386 |
T9527 |
T9526 |
punct |
-,knock |
R1387 |
T9528 |
T9526 |
prt |
in,knock |
R1388 |
T9438 |
T9437 |
advmod |
4.6-fold,Figure |
R1389 |
T9529 |
T9530 |
punct |
[,18 |
R1390 |
T9530 |
T9497 |
parataxis |
18,indicates |
R1391 |
T9531 |
T9530 |
punct |
],18 |
R1392 |
T9439 |
T9437 |
punct |
;,Figure |
R1393 |
T9532 |
T9497 |
punct |
.,indicates |
R1394 |
T9534 |
T9535 |
amod |
Multiple,matings |
R1395 |
T9440 |
T9437 |
nummod |
1D,Figure |
R1396 |
T9535 |
T9537 |
nsubj |
matings,yielded |
R1397 |
T9536 |
T9535 |
amod |
heterozygous,matings |
R1398 |
T9441 |
T9437 |
punct |
),Figure |
R1399 |
T9538 |
T9539 |
nummod |
101,animals |
R1400 |
T9539 |
T9537 |
dobj |
animals,yielded |
R1401 |
T9442 |
T9415 |
punct |
.,leads |
R1402 |
T9540 |
T9539 |
punct |
", ",animals |
R1403 |
T9541 |
T9542 |
dep |
which,appeared |
R1404 |
T9542 |
T9539 |
relcl |
appeared,animals |
R1405 |
T9543 |
T9542 |
prep |
at,appeared |
R1406 |
T9444 |
T9445 |
prep |
With,concentrate |
R1407 |
T9544 |
T9545 |
det |
a,ratio |
R1408 |
T9545 |
T9543 |
pobj |
ratio,at |
R1409 |
T9546 |
T9545 |
prep |
of,ratio |
R1410 |
T9547 |
T9546 |
pobj |
26,of |
R1411 |
T9446 |
T9447 |
amod |
similar,treatment |
R1412 |
T9548 |
T9549 |
punct |
:,49 |
R1413 |
T9549 |
T9547 |
prep |
49,26 |
R1414 |
T9550 |
T9551 |
punct |
:,26 |
R1415 |
T9447 |
T9444 |
pobj |
treatment,With |
R1416 |
T9551 |
T9547 |
prep |
26,26 |
R1417 |
T9552 |
T9542 |
punct |
", ",appeared |
R1418 |
T9553 |
T9542 |
prep |
near,appeared |
R1419 |
T9448 |
T9445 |
punct |
", ",concentrate |
R1420 |
T9554 |
T9555 |
det |
the,frequencies |
R1421 |
T9555 |
T9553 |
pobj |
frequencies,near |
R1422 |
T9556 |
T9555 |
amod |
expected,frequencies |
R1423 |
T9557 |
T9558 |
amod |
Mendelian,type |
R1424 |
T9558 |
T9555 |
nmod |
type,frequencies |
R1425 |
T9559 |
T9558 |
amod |
wild,type |
R1426 |
T9449 |
T9450 |
compound |
mutant,mice |
R1427 |
T9560 |
T9558 |
punct |
", ",type |
R1428 |
T9561 |
T9558 |
conj |
heterozygote,type |
R1429 |
T9562 |
T9561 |
punct |
", ",heterozygote |
R1430 |
T9450 |
T9445 |
nsubj |
mice,concentrate |
R1431 |
T9563 |
T9561 |
cc |
and,heterozygote |
R1432 |
T9564 |
T9561 |
conj |
mutant,heterozygote |
R1433 |
T9565 |
T9542 |
punct |
", ",appeared |
R1434 |
T9451 |
T9452 |
poss |
their,urine |
R1435 |
T9566 |
T9542 |
advmod |
respectively,appeared |
R1436 |
T9567 |
T9537 |
punct |
", ",yielded |
R1437 |
T9452 |
T9445 |
dobj |
urine,concentrate |
R1438 |
T9568 |
T9537 |
advcl |
indicating,yielded |
R1439 |
T9569 |
T9570 |
mark |
that,is |
R1440 |
T9570 |
T9568 |
ccomp |
is,indicating |
R1441 |
T9571 |
T9570 |
expl |
there,is |
R1442 |
T9453 |
T9445 |
prep |
to,concentrate |
R1443 |
T9572 |
T9573 |
det |
no,viability |
R1444 |
T9573 |
T9570 |
attr |
viability,is |
R1445 |
T9454 |
T9455 |
det |
a,extent |
R1446 |
T9574 |
T9573 |
amod |
reduced,viability |
R1447 |
T9575 |
T9573 |
acl |
associated,viability |
R1448 |
T9576 |
T9575 |
prep |
with,associated |
R1449 |
T9455 |
T9453 |
pobj |
extent,to |
R1450 |
T9577 |
T9578 |
det |
this,mutation |
R1451 |
T9578 |
T9576 |
pobj |
mutation,with |
R1452 |
T9579 |
T9537 |
punct |
.,yielded |
R1453 |
T9456 |
T9455 |
amod |
lesser,extent |
R1454 |
T9581 |
T9582 |
amod |
Other,was |
R1455 |
T9457 |
T9456 |
cc |
but,lesser |
R1456 |
T9583 |
T9581 |
prep |
than,Other |
R1457 |
T9458 |
T9459 |
advmod |
still,significant |
R1458 |
T9459 |
T9456 |
conj |
significant,lesser |
R1459 |
T9584 |
T9585 |
det |
the,production |
R1460 |
T9585 |
T9583 |
pobj |
production,than |
R1461 |
T9586 |
T9585 |
amod |
increased,production |
R1462 |
T9460 |
T9445 |
punct |
", ",concentrate |
R1463 |
T9587 |
T9585 |
compound |
urine,production |
R1464 |
T9588 |
T9585 |
cc |
and,production |
R1465 |
T9589 |
T9590 |
compound |
water,intake |
R1466 |
T9461 |
T9445 |
prep |
from,concentrate |
R1467 |
T9590 |
T9585 |
conj |
intake,production |
R1468 |
T9591 |
T9582 |
punct |
", ",was |
R1469 |
T9592 |
T9582 |
expl |
there,was |
R1470 |
T9462 |
T9461 |
pobj |
161,from |
R1471 |
T9593 |
T9594 |
det |
no,phenotype |
R1472 |
T9594 |
T9582 |
attr |
phenotype,was |
R1473 |
T9463 |
T9461 |
prep |
to,from |
R1474 |
T9595 |
T9594 |
amod |
overt,phenotype |
R1475 |
T9596 |
T9594 |
prep |
in,phenotype |
R1476 |
T9597 |
T9598 |
compound |
mutant,mice |
R1477 |
T9598 |
T9596 |
pobj |
mice,in |
R1478 |
T9599 |
T9594 |
punct |
", ",phenotype |
R1479 |
T9600 |
T9594 |
prep |
save,phenotype |
R1480 |
T9464 |
T9463 |
pobj |
470,to |
R1481 |
T9601 |
T9602 |
amod |
distended,kidneys |
R1482 |
T9602 |
T9600 |
pobj |
kidneys,save |
R1483 |
T9603 |
T9602 |
punct |
", ",kidneys |
R1484 |
T9465 |
T9461 |
pobj |
mOsm,from |
R1485 |
T9604 |
T9605 |
dep |
which,appeared |
R1486 |
T9605 |
T9602 |
relcl |
appeared,kidneys |
R1487 |
T9606 |
T9605 |
advmod |
variably,appeared |
R1488 |
T9466 |
T9467 |
punct |
(,2.9-fold |
R1489 |
T9607 |
T9605 |
prep |
in,appeared |
R1490 |
T9608 |
T9609 |
amod |
adult,animals |
R1491 |
T9609 |
T9607 |
pobj |
animals,in |
R1492 |
T9467 |
T9461 |
parataxis |
2.9-fold,from |
R1493 |
T9610 |
T9611 |
punct |
(,Figure |
R1494 |
T9611 |
T9582 |
parataxis |
Figure,was |
R1495 |
T9612 |
T9611 |
nummod |
2A,Figure |
R1496 |
T9468 |
T9467 |
punct |
),2.9-fold |
R1497 |
T9613 |
T9611 |
punct |
),Figure |
R1498 |
T9614 |
T9582 |
punct |
.,was |
R1499 |
T9469 |
T9445 |
punct |
", ",concentrate |
R1500 |
T9470 |
T9445 |
advcl |
indicating,concentrate |
R1501 |
T9471 |
T9472 |
mark |
that,are |
R1502 |
T9616 |
T9617 |
mark |
Although,measured |
R1503 |
T9472 |
T9470 |
ccomp |
are,indicating |
R1504 |
T9617 |
T9620 |
advcl |
measured,seem |
R1505 |
T9618 |
T9617 |
neg |
not,measured |
R1506 |
T9619 |
T9617 |
advmod |
specifically,measured |
R1507 |
T9473 |
T9474 |
det |
these,animals |
R1508 |
T9621 |
T9620 |
punct |
", ",seem |
R1509 |
T9622 |
T9623 |
compound |
mutant,mice |
R1510 |
T9474 |
T9472 |
nsubj |
animals,are |
R1511 |
T9623 |
T9620 |
nsubj |
mice,seem |
R1512 |
T9624 |
T9625 |
aux |
to,have |
R1513 |
T9625 |
T9620 |
xcomp |
have,seem |
R1514 |
T9475 |
T9472 |
preconj |
not,are |
R1515 |
T9626 |
T9627 |
det |
a,lifespan |
R1516 |
T9627 |
T9625 |
dobj |
lifespan,have |
R1517 |
T9628 |
T9627 |
amod |
normal,lifespan |
R1518 |
T9476 |
T9475 |
advmod |
only,not |
R1519 |
T9629 |
T9620 |
punct |
.,seem |
R1520 |
T9477 |
T9472 |
conj |
unable,are |
R1521 |
T9631 |
T9632 |
det |
The,animal |
R1522 |
T9632 |
T9634 |
nsubj |
animal,lived |
R1523 |
T9633 |
T9632 |
nummod |
one,animal |
R1524 |
T9478 |
T9479 |
aux |
to,concentrate |
R1525 |
T9635 |
T9636 |
dep |
that,followed |
R1526 |
T9636 |
T9632 |
relcl |
followed,animal |
R1527 |
T9637 |
T9636 |
auxpass |
was,followed |
R1528 |
T9638 |
T9634 |
prep |
to,lived |
R1529 |
T9639 |
T9640 |
nummod |
18,mo |
R1530 |
T9479 |
T9477 |
xcomp |
concentrate,unable |
R1531 |
T9640 |
T9638 |
pobj |
mo,to |
R1532 |
T9641 |
T9634 |
punct |
", ",lived |
R1533 |
T9642 |
T9634 |
advcl |
typical,lived |
R1534 |
T9480 |
T9481 |
poss |
their,urine |
R1535 |
T9643 |
T9642 |
prep |
for,typical |
R1536 |
T9644 |
T9643 |
pobj |
animals,for |
R1537 |
T9645 |
T9644 |
prep |
in,animals |
R1538 |
T9481 |
T9479 |
dobj |
urine,concentrate |
R1539 |
T9646 |
T9647 |
poss |
our,colony |
R1540 |
T9647 |
T9645 |
pobj |
colony,in |
R1541 |
T9648 |
T9634 |
punct |
.,lived |
R1542 |
T9482 |
T9479 |
advmod |
properly,concentrate |
R1543 |
T9650 |
T9651 |
compound |
Aqp2F204V,F204V |
R1544 |
T9651 |
T9653 |
compound |
F204V,mice |
R1545 |
T9483 |
T9472 |
cc |
but,are |
R1546 |
T9652 |
T9651 |
punct |
/,F204V |
R1547 |
T9653 |
T9654 |
nsubj |
mice,suffer |
R1548 |
T9484 |
T9472 |
conj |
are,are |
R1549 |
T9655 |
T9654 |
prep |
from,suffer |
R1550 |
T9656 |
T9657 |
amod |
severe,hydronephrosis |
R1551 |
T9485 |
T9484 |
advmod |
also,are |
R1552 |
T9657 |
T9655 |
pobj |
hydronephrosis,from |
R1553 |
T9658 |
T9659 |
punct |
(,2A |
R1554 |
T9486 |
T9484 |
acomp |
defective,are |
R1555 |
T9659 |
T9654 |
parataxis |
2A,suffer |
R1556 |
T9660 |
T9659 |
nmod |
Figure,2A |
R1557 |
T9661 |
T9659 |
cc |
and,2A |
R1558 |
T9487 |
T9484 |
prep |
in,are |
R1559 |
T9662 |
T9659 |
conj |
2B,2A |
R1560 |
T9663 |
T9659 |
punct |
),2A |
R1561 |
T9664 |
T9654 |
punct |
", ",suffer |
R1562 |
T9488 |
T9489 |
poss |
their,response |
R1563 |
T9665 |
T9666 |
advmod |
presumably,as |
R1564 |
T9666 |
T9654 |
prep |
as,suffer |
R1565 |
T9667 |
T9668 |
det |
a,consequence |
R1566 |
T9489 |
T9487 |
pobj |
response,in |
R1567 |
T9668 |
T9666 |
pobj |
consequence,as |
R1568 |
T9669 |
T9668 |
prep |
of,consequence |
R1569 |
T9490 |
T9489 |
prep |
to,response |
R1570 |
T9491 |
T9490 |
pobj |
dDAVP,to |
R1571 |
T9670 |
T9671 |
det |
an,inability |
R1572 |
T9492 |
T9445 |
punct |
.,concentrate |
R1573 |
T9671 |
T9669 |
pobj |
inability,of |
R1574 |
T9672 |
T9673 |
aux |
to,cope |
R1575 |
T9673 |
T9671 |
acl |
cope,inability |
R1576 |
T9494 |
T9495 |
det |
The,response |
R1577 |
T9674 |
T9673 |
prep |
with,cope |
R1578 |
T9675 |
T9676 |
det |
the,polyuria |
R1579 |
T9676 |
T9674 |
pobj |
polyuria,with |
R1580 |
T9677 |
T9676 |
amod |
extreme,polyuria |
R1581 |
T9678 |
T9654 |
punct |
.,suffer |
R1582 |
T9495 |
T9497 |
nsubj |
response,indicates |
R1583 |
T9680 |
T9681 |
nsubj |
We,found |
R1584 |
T9681 |
T9682 |
ccomp |
found,was |
R1585 |
T9496 |
T9495 |
amod |
smaller,response |
R1586 |
T9683 |
T9684 |
amod |
distended,kidneys |
R1587 |
T9684 |
T9681 |
dobj |
kidneys,found |
R1588 |
T9685 |
T9681 |
prep |
in,found |
R1589 |
T9498 |
T9495 |
prep |
to,response |
R1590 |
T9686 |
T9687 |
det |
all,mice |
R1591 |
T9687 |
T9685 |
pobj |
mice,in |
R1592 |
T9688 |
T9689 |
compound |
Aqp2F204V,F204V |
R1593 |
T9689 |
T9687 |
compound |
F204V,mice |
R1594 |
T9499 |
T9498 |
pobj |
dDAVP,to |
R1595 |
T9690 |
T9689 |
punct |
/,F204V |
R1596 |
T9691 |
T9682 |
punct |
;,was |
R1597 |
T9692 |
T9682 |
advmod |
however,was |
R1598 |
T9500 |
T9501 |
det |
some,activity |
R1599 |
T9693 |
T9682 |
punct |
", ",was |
R1600 |
T9694 |
T9695 |
det |
the,degree |
R1601 |
T9695 |
T9682 |
nsubj |
degree,was |
R1602 |
T9501 |
T9497 |
dobj |
activity,indicates |
R1603 |
T9696 |
T9695 |
prep |
of,degree |
R1604 |
T9697 |
T9696 |
pobj |
inflation,of |
R1605 |
T9502 |
T9501 |
amod |
residual,activity |
R1606 |
T9698 |
T9682 |
acomp |
variable,was |
R1607 |
T9699 |
T9682 |
prep |
in,was |
R1608 |
T9700 |
T9701 |
amod |
affected,mice |
R1609 |
T9503 |
T9501 |
prep |
of,activity |
R1610 |
T9701 |
T9699 |
pobj |
mice,in |
R1611 |
T9702 |
T9682 |
cc |
and,was |
R1612 |
T9703 |
T9682 |
conj |
worsened,was |
R1613 |
T9704 |
T9703 |
prep |
with,worsened |
R1614 |
T9504 |
T9505 |
det |
the,channel |
R1615 |
T9705 |
T9704 |
pobj |
age,with |
R1616 |
T9706 |
T9682 |
punct |
.,was |
R1617 |
T9505 |
T9503 |
pobj |
channel,of |
R1618 |
T9708 |
T9709 |
amod |
Severe,hydronephrosis |
R1619 |
T9709 |
T9710 |
nsubjpass |
hydronephrosis,observed |
R1620 |
T9506 |
T9505 |
compound |
mutant,channel |
R1621 |
T9711 |
T9710 |
aux |
has,observed |
R1622 |
T9712 |
T9710 |
advmod |
previously,observed |
R1623 |
T9507 |
T9505 |
compound |
AQP2,channel |
R1624 |
T9713 |
T9710 |
auxpass |
been,observed |
R1625 |
T9714 |
T9710 |
prep |
in,observed |
R1626 |
T9715 |
T9716 |
amod |
double,knock |
R1627 |
T9508 |
T9505 |
punct |
", ",channel |
R1628 |
T9716 |
T9720 |
amod |
knock,mice |
R1629 |
T9717 |
T9718 |
compound |
Aqp1,Aqp3 |
R1630 |
T9718 |
T9716 |
npadvmod |
Aqp3,knock |
R1631 |
T9719 |
T9718 |
punct |
/,Aqp3 |
R1632 |
T9720 |
T9714 |
pobj |
mice,in |
R1633 |
T9827 |
T9828 |
det |
the,features |
R1634 |
T9721 |
T9716 |
punct |
-,knock |
R1635 |
T9828 |
T9825 |
nsubj |
features,were |
R1636 |
T9722 |
T9716 |
prt |
out,knock |
R1637 |
T9723 |
T9724 |
punct |
[,17 |
R1638 |
T9829 |
T9828 |
amod |
morphologic,features |
R1639 |
T9724 |
T9710 |
parataxis |
17,observed |
R1640 |
T9725 |
T9724 |
punct |
],17 |
R1641 |
T9726 |
T9710 |
punct |
", ",observed |
R1642 |
T9830 |
T9828 |
prep |
of,features |
R1643 |
T9727 |
T9710 |
cc |
and,observed |
R1644 |
T9728 |
T9710 |
conj |
appears,observed |
R1645 |
T9729 |
T9728 |
prep |
at,appears |
R1646 |
T9831 |
T9832 |
det |
the,glomeruli |
R1647 |
T9730 |
T9731 |
nummod |
6,wk |
R1648 |
T9731 |
T9729 |
pobj |
wk,at |
R1649 |
T9732 |
T9710 |
punct |
.,observed |
R1650 |
T9832 |
T9830 |
pobj |
glomeruli,of |
R1651 |
T9734 |
T9735 |
advmod |
Even,at |
R1652 |
T9833 |
T9832 |
cc |
and,glomeruli |
R1653 |
T9735 |
T9736 |
prep |
at,had |
R1654 |
T9737 |
T9738 |
nummod |
4,wk |
R1655 |
T9834 |
T9835 |
amod |
proximal,distal |
R1656 |
T9738 |
T9735 |
pobj |
wk,at |
R1657 |
T9739 |
T9736 |
punct |
", ",had |
R1658 |
T9835 |
T9837 |
amod |
distal,tubules |
R1659 |
T9740 |
T9741 |
compound |
Aqp2F204V,F204V |
R1660 |
T9741 |
T9743 |
compound |
F204V,mice |
R1661 |
T9742 |
T9741 |
punct |
/,F204V |
R1662 |
T9743 |
T9736 |
nsubj |
mice,had |
R1663 |
T9836 |
T9835 |
punct |
/,distal |
R1664 |
T9744 |
T9736 |
dobj |
hydronephrosis,had |
R1665 |
T9745 |
T9736 |
punct |
.,had |
R1666 |
T9837 |
T9832 |
conj |
tubules,glomeruli |
R1667 |
T9747 |
T9748 |
amod |
Histologic,sections |
R1668 |
T9748 |
T9749 |
nsubj |
sections,demonstrated |
R1669 |
T9838 |
T9825 |
acomp |
unremarkable,were |
R1670 |
T9750 |
T9748 |
prep |
from,sections |
R1671 |
T9751 |
T9752 |
compound |
Aqp2F204V,F204V |
R1672 |
T9839 |
T9840 |
punct |
(,Figure |
R1673 |
T9752 |
T9754 |
compound |
F204V,mice |
R1674 |
T9753 |
T9752 |
punct |
/,F204V |
R1675 |
T9754 |
T9750 |
pobj |
mice,from |
R1676 |
T9840 |
T9825 |
parataxis |
Figure,were |
R1677 |
T9755 |
T9756 |
amod |
marked,dilatation |
R1678 |
T9756 |
T9749 |
dobj |
dilatation,demonstrated |
R1679 |
T9841 |
T9840 |
nummod |
2D,Figure |
R1680 |
T9757 |
T9756 |
prep |
of,dilatation |
R1681 |
T9758 |
T9759 |
det |
the,pelvis |
R1682 |
T9842 |
T9840 |
punct |
),Figure |
R1683 |
T9759 |
T9757 |
pobj |
pelvis,of |
R1684 |
T9760 |
T9759 |
amod |
renal,pelvis |
R1685 |
T9761 |
T9756 |
cc |
yet,dilatation |
R1686 |
T9762 |
T9763 |
amod |
normal,morphology |
R1687 |
T9843 |
T9825 |
punct |
.,were |
R1688 |
T9763 |
T9756 |
conj |
morphology,dilatation |
R1689 |
T9764 |
T9763 |
prep |
of,morphology |
R1690 |
T9765 |
T9766 |
det |
the,ureter |
R1691 |
T9845 |
T9846 |
mark |
As,shown |
R1692 |
T9766 |
T9764 |
pobj |
ureter,of |
R1693 |
T9767 |
T9768 |
punct |
(,2C |
R1694 |
T9768 |
T9749 |
parataxis |
2C,demonstrated |
R1695 |
T9846 |
T9847 |
advcl |
shown,revealed |
R1696 |
T9769 |
T9768 |
nmod |
Figure,2C |
R1697 |
T9770 |
T9768 |
cc |
and,2C |
R1698 |
T9771 |
T9768 |
conj |
2D,2C |
R1699 |
T9848 |
T9846 |
advmod |
previously,shown |
R1700 |
T9772 |
T9768 |
punct |
),2C |
R1701 |
T9773 |
T9749 |
punct |
.,demonstrated |
R1702 |
T9849 |
T9850 |
punct |
[,22 |
R1703 |
T9775 |
T9776 |
prep |
In,was |
R1704 |
T9777 |
T9775 |
amod |
particular,In |
R1705 |
T9778 |
T9776 |
punct |
", ",was |
R1706 |
T9779 |
T9780 |
det |
the,propria |
R1707 |
T9850 |
T9846 |
parataxis |
22,shown |
R1708 |
T9780 |
T9776 |
nsubj |
propria,was |
R1709 |
T9781 |
T9780 |
compound |
muscularis,propria |
R1710 |
T9782 |
T9783 |
preconj |
neither,hypertrophied |
R1711 |
T9851 |
T9850 |
nummod |
18,22 |
R1712 |
T9852 |
T9850 |
punct |
",",22 |
R1713 |
T9783 |
T9776 |
acomp |
hypertrophied,was |
R1714 |
T9853 |
T9850 |
punct |
],22 |
R1715 |
T9784 |
T9783 |
cc |
nor,hypertrophied |
R1716 |
T9785 |
T9783 |
conj |
thinned,hypertrophied |
R1717 |
T9854 |
T9847 |
punct |
", ",revealed |
R1718 |
T9786 |
T9776 |
punct |
.,was |
R1719 |
T9855 |
T9847 |
nsubj |
immunoblotting,revealed |
R1720 |
T9788 |
T9789 |
expl |
There,was |
R1721 |
T9790 |
T9791 |
det |
the,appearance |
R1722 |
T9856 |
T9857 |
nummod |
three,forms |
R1723 |
T9791 |
T9789 |
attr |
appearance,was |
R1724 |
T9792 |
T9791 |
amod |
normal,appearance |
R1725 |
T9857 |
T9847 |
dobj |
forms,revealed |
R1726 |
T9793 |
T9791 |
amod |
festooned,appearance |
R1727 |
T9794 |
T9791 |
prep |
of,appearance |
R1728 |
T9795 |
T9796 |
det |
the,urothelium |
R1729 |
T9796 |
T9794 |
pobj |
urothelium,of |
R1730 |
T9858 |
T9857 |
amod |
different,forms |
R1731 |
T9797 |
T9789 |
punct |
", ",was |
R1732 |
T9798 |
T9789 |
cc |
and,was |
R1733 |
T9859 |
T9857 |
prep |
of,forms |
R1734 |
T9799 |
T9800 |
det |
this,epithelium |
R1735 |
T9800 |
T9802 |
nsubj |
epithelium,was |
R1736 |
T9801 |
T9800 |
amod |
transitional,epithelium |
R1737 |
T9802 |
T9789 |
conj |
was,was |
R1738 |
T9803 |
T9802 |
prep |
of,was |
R1739 |
T9804 |
T9805 |
amod |
normal,thickness |
R1740 |
T9860 |
T9859 |
pobj |
AQP2,of |
R1741 |
T9805 |
T9803 |
pobj |
thickness,of |
R1742 |
T9806 |
T9802 |
punct |
.,was |
R1743 |
T9861 |
T9847 |
punct |
", ",revealed |
R1744 |
T9808 |
T9809 |
expl |
There,was |
R1745 |
T9810 |
T9809 |
attr |
thinning,was |
R1746 |
T9862 |
T9847 |
prep |
due,revealed |
R1747 |
T9811 |
T9810 |
prep |
of,thinning |
R1748 |
T9812 |
T9813 |
det |
the,kidney |
R1749 |
T9813 |
T9811 |
pobj |
kidney,of |
R1750 |
T9863 |
T9862 |
pcomp |
to,due |
R1751 |
T9814 |
T9815 |
mark |
as,measured |
R1752 |
T9815 |
T9809 |
advcl |
measured,was |
R1753 |
T9816 |
T9815 |
prep |
from,measured |
R1754 |
T9864 |
T9865 |
amod |
different,degrees |
R1755 |
T9817 |
T9818 |
amod |
renal,capsule |
R1756 |
T9818 |
T9816 |
pobj |
capsule,from |
R1757 |
T9819 |
T9816 |
prep |
to,from |
R1758 |
T9865 |
T9862 |
pobj |
degrees,due |
R1759 |
T9820 |
T9821 |
amod |
renal,pelvis |
R1760 |
T9821 |
T9819 |
pobj |
pelvis,to |
R1761 |
T9866 |
T9865 |
cc |
and,degrees |
R1762 |
T9822 |
T9809 |
punct |
.,was |
R1763 |
T9824 |
T9825 |
advmod |
However,were |
R1764 |
T9867 |
T9865 |
conj |
forms,degrees |
R1765 |
T9826 |
T9825 |
punct |
", ",were |
R1766 |
T9868 |
T9865 |
prep |
of,degrees |
R1767 |
T9869 |
T9868 |
pobj |
glycosylation,of |
R1768 |
T9870 |
T9871 |
punct |
(,Figure |
R1769 |
T9871 |
T9847 |
parataxis |
Figure,revealed |
R1770 |
T9872 |
T9871 |
nummod |
3A,Figure |
R1771 |
T9933 |
T9932 |
punct |
],22 |
R1772 |
T9873 |
T9871 |
punct |
),Figure |
R1773 |
T9934 |
T9911 |
punct |
.,is |
R1774 |
T9874 |
T9847 |
punct |
.,revealed |
R1775 |
T9936 |
T9937 |
prep |
Compared,reduced |
R1776 |
T9876 |
T9877 |
amod |
Previous,reports |
R1777 |
T9938 |
T9936 |
prep |
to,Compared |
R1778 |
T9939 |
T9938 |
pobj |
that,to |
R1779 |
T9940 |
T9939 |
prep |
from,that |
R1780 |
T9941 |
T9942 |
det |
the,kidneys |
R1781 |
T9877 |
T9878 |
nsubj |
reports,demonstrated |
R1782 |
T9942 |
T9940 |
pobj |
kidneys,from |
R1783 |
T9943 |
T9942 |
prep |
of,kidneys |
R1784 |
T9879 |
T9878 |
aux |
have,demonstrated |
R1785 |
T9944 |
T9945 |
amod |
wild,type |
R1786 |
T9945 |
T9947 |
compound |
type,animals |
R1787 |
T9946 |
T9945 |
punct |
-,type |
R1788 |
T9947 |
T9943 |
pobj |
animals,of |
R1789 |
T9948 |
T9937 |
punct |
", ",reduced |
R1790 |
T9949 |
T9937 |
nsubjpass |
AQP2,reduced |
R1791 |
T9880 |
T9881 |
mark |
that,appears |
R1792 |
T9950 |
T9949 |
prep |
from,AQP2 |
R1793 |
T9951 |
T9952 |
compound |
mutant,animals |
R1794 |
T9952 |
T9950 |
pobj |
animals,from |
R1795 |
T9881 |
T9878 |
ccomp |
appears,demonstrated |
R1796 |
T9953 |
T9937 |
auxpass |
was,reduced |
R1797 |
T9954 |
T9937 |
prep |
in,reduced |
R1798 |
T9955 |
T9956 |
preconj |
both,form |
R1799 |
T9882 |
T9883 |
amod |
nonglycosylated,protein |
R1800 |
T9956 |
T9954 |
pobj |
form,in |
R1801 |
T9957 |
T9956 |
det |
the,form |
R1802 |
T9883 |
T9881 |
nsubj |
protein,appears |
R1803 |
T9958 |
T9959 |
amod |
high,weight |
R1804 |
T9959 |
T9956 |
nmod |
weight,form |
R1805 |
T9960 |
T9959 |
amod |
molecular,weight |
R1806 |
T9884 |
T9881 |
prep |
as,appears |
R1807 |
T9961 |
T9956 |
punct |
", ",form |
R1808 |
T9962 |
T9956 |
amod |
diffuse,form |
R1809 |
T9963 |
T9956 |
cc |
and,form |
R1810 |
T9885 |
T9886 |
det |
a,band |
R1811 |
T9964 |
T9965 |
det |
the,form |
R1812 |
T9965 |
T9956 |
conj |
form,form |
R1813 |
T9966 |
T9967 |
amod |
lowest,weight |
R1814 |
T9886 |
T9884 |
pobj |
band,as |
R1815 |
T9967 |
T9965 |
compound |
weight,form |
R1816 |
T9968 |
T9967 |
amod |
molecular,weight |
R1817 |
T9969 |
T9937 |
punct |
", ",reduced |
R1818 |
T9887 |
T9888 |
nummod |
29,kDa |
R1819 |
T9970 |
T9937 |
cc |
but,reduced |
R1820 |
T9971 |
T9937 |
conj |
enriched,reduced |
R1821 |
T9888 |
T9886 |
compound |
kDa,band |
R1822 |
T9972 |
T9971 |
prep |
in,enriched |
R1823 |
T9973 |
T9974 |
det |
the,form |
R1824 |
T9974 |
T9972 |
pobj |
form,in |
R1825 |
T9889 |
T9881 |
punct |
", ",appears |
R1826 |
T9975 |
T9976 |
amod |
intermediate,weight |
R1827 |
T9976 |
T9974 |
compound |
weight,form |
R1828 |
T9977 |
T9976 |
amod |
molecular,weight |
R1829 |
T9890 |
T9891 |
mark |
while,runs |
R1830 |
T9978 |
T9979 |
punct |
(,Figure |
R1831 |
T9979 |
T9971 |
parataxis |
Figure,enriched |
R1832 |
T9980 |
T9979 |
nummod |
3A,Figure |
R1833 |
T9891 |
T9881 |
advcl |
runs,appears |
R1834 |
T9981 |
T9979 |
punct |
),Figure |
R1835 |
T9982 |
T9937 |
punct |
.,reduced |
R1836 |
T9892 |
T9893 |
amod |
complex,protein |
R1837 |
T9984 |
T9985 |
amod |
Heterozygous,animals |
R1838 |
T9985 |
T9986 |
nsubj |
animals,showed |
R1839 |
T9987 |
T9988 |
amod |
intermediate,amounts |
R1840 |
T9988 |
T9986 |
dobj |
amounts,showed |
R1841 |
T9893 |
T9891 |
nsubj |
protein,runs |
R1842 |
T9989 |
T9988 |
prep |
of,amounts |
R1843 |
T9990 |
T9991 |
det |
all,forms |
R1844 |
T9991 |
T9989 |
pobj |
forms,of |
R1845 |
T9894 |
T9893 |
amod |
glycosylated,protein |
R1846 |
T9992 |
T9991 |
nummod |
three,forms |
R1847 |
T9993 |
T9986 |
punct |
.,showed |
R1848 |
T9895 |
T9891 |
prep |
as,runs |
R1849 |
T9995 |
T9996 |
det |
The,nature |
R1850 |
T9996 |
T9997 |
nsubjpass |
nature,revealed |
R1851 |
T9896 |
T9897 |
det |
a,smear |
R1852 |
T9998 |
T9996 |
prep |
of,nature |
R1853 |
T9999 |
T10000 |
det |
these,forms |
R1854 |
T9897 |
T9895 |
pobj |
smear,as |
R1855 |
T10000 |
T9998 |
pobj |
forms,of |
R1856 |
T10001 |
T10000 |
amod |
glycosylated,forms |
R1857 |
T9898 |
T9897 |
prep |
between,smear |
R1858 |
T10002 |
T9997 |
auxpass |
was,revealed |
R1859 |
T10003 |
T9997 |
prep |
by,revealed |
R1860 |
T10004 |
T10003 |
pobj |
digestion,by |
R1861 |
T9899 |
T9900 |
nummod |
35,kDa |
R1862 |
T10005 |
T10004 |
prep |
with,digestion |
R1863 |
T10006 |
T10007 |
compound |
endoglycosidase,H |
R1864 |
T10007 |
T10005 |
pobj |
H,with |
R1865 |
T9900 |
T9898 |
pobj |
kDa,between |
R1866 |
T10008 |
T10007 |
punct |
", ",H |
R1867 |
T10009 |
T10010 |
dep |
which,cleaves |
R1868 |
T9901 |
T9899 |
cc |
and,35 |
R1869 |
T10010 |
T10007 |
relcl |
cleaves,H |
R1870 |
T10011 |
T10010 |
advmod |
specifically,cleaves |
R1871 |
T10012 |
T10013 |
npadvmod |
mannose,rich |
R1872 |
T9902 |
T9899 |
conj |
45,35 |
R1873 |
T10013 |
T10015 |
amod |
rich,carbohydrate |
R1874 |
T10014 |
T10013 |
punct |
-,rich |
R1875 |
T10015 |
T10010 |
dobj |
carbohydrate,cleaves |
R1876 |
T9903 |
T9878 |
punct |
.,demonstrated |
R1877 |
T10016 |
T10010 |
prep |
from,cleaves |
R1878 |
T10017 |
T10018 |
det |
the,backbone |
R1879 |
T10018 |
T10016 |
pobj |
backbone,from |
R1880 |
T9905 |
T9906 |
det |
A,form |
R1881 |
T10019 |
T10018 |
compound |
protein,backbone |
R1882 |
T9906 |
T9911 |
nsubj |
form,is |
R1883 |
T10020 |
T9997 |
punct |
.,revealed |
R1884 |
T9907 |
T9908 |
amod |
short,lived |
R1885 |
T10022 |
T10023 |
nsubj |
Treatment,affected |
R1886 |
T9908 |
T9906 |
amod |
lived,form |
R1887 |
T10024 |
T10022 |
prep |
of,Treatment |
R1888 |
T10025 |
T10026 |
amod |
endogenous,AQP2 |
R1889 |
T10026 |
T10024 |
pobj |
AQP2,of |
R1890 |
T9909 |
T9908 |
punct |
-,lived |
R1891 |
T10027 |
T10026 |
prep |
from,AQP2 |
R1892 |
T10028 |
T10027 |
pobj |
kidneys,from |
R1893 |
T10029 |
T10028 |
prep |
of,kidneys |
R1894 |
T10030 |
T10031 |
amod |
wild,type |
R1895 |
T10031 |
T10033 |
nmod |
type,animals |
R1896 |
T9910 |
T9906 |
amod |
intermediate,form |
R1897 |
T10032 |
T10031 |
punct |
-,type |
R1898 |
T10033 |
T10029 |
pobj |
animals,of |
R1899 |
T9912 |
T9906 |
prep |
of,form |
R1900 |
T10034 |
T10031 |
punct |
", ",type |
R1901 |
T10035 |
T10031 |
conj |
heterozygous,type |
R1902 |
T10036 |
T10035 |
punct |
", ",heterozygous |
R1903 |
T10037 |
T10035 |
cc |
and,heterozygous |
R1904 |
T9913 |
T9914 |
nummod |
31,kDa |
R1905 |
T10038 |
T10035 |
conj |
mutant,heterozygous |
R1906 |
T9914 |
T9912 |
pobj |
kDa,of |
R1907 |
T9915 |
T9906 |
acl |
representing,form |
R1908 |
T9916 |
T9917 |
nmod |
core,glycosylation |
R1909 |
T10039 |
T10023 |
advmod |
specifically,affected |
R1910 |
T10040 |
T10041 |
det |
the,form |
R1911 |
T9917 |
T9915 |
dobj |
glycosylation,representing |
R1912 |
T10041 |
T10023 |
dobj |
form,affected |
R1913 |
T10042 |
T10043 |
amod |
intermediate,weight |
R1914 |
T10043 |
T10041 |
compound |
weight,form |
R1915 |
T9918 |
T9917 |
punct |
", ",glycosylation |
R1916 |
T10044 |
T10043 |
amod |
molecular,weight |
R1917 |
T10045 |
T10046 |
punct |
(,Figure |
R1918 |
T9919 |
T9920 |
amod |
high,mannose |
R1919 |
T10046 |
T10023 |
parataxis |
Figure,affected |
R1920 |
T10047 |
T10046 |
nummod |
3B,Figure |
R1921 |
T10048 |
T10046 |
punct |
),Figure |
R1922 |
T9920 |
T9917 |
compound |
mannose,glycosylation |
R1923 |
T10049 |
T10023 |
punct |
.,affected |
R1924 |
T10051 |
T10052 |
det |
The,presence |
R1925 |
T9921 |
T9920 |
punct |
-,mannose |
R1926 |
T10052 |
T10053 |
nsubj |
presence,permits |
R1927 |
T9922 |
T9917 |
prep |
of,glycosylation |
R1928 |
T10054 |
T10052 |
prep |
of,presence |
R1929 |
T10055 |
T10056 |
det |
some,proteins |
R1930 |
T10056 |
T10054 |
pobj |
proteins,of |
R1931 |
T9923 |
T9922 |
pobj |
AQP2,of |
R1932 |
T10057 |
T10056 |
amod |
mature,proteins |
R1933 |
T10058 |
T10056 |
amod |
glycosylated,proteins |
R1934 |
T10059 |
T10060 |
punct |
(,kDa |
R1935 |
T9924 |
T9911 |
acomp |
apparent,is |
R1936 |
T10060 |
T10056 |
parataxis |
kDa,proteins |
R1937 |
T10061 |
T10062 |
quantmod |
35,45 |
R1938 |
T10062 |
T10060 |
nummod |
45,kDa |
R1939 |
T9925 |
T9924 |
prep |
from,apparent |
R1940 |
T10063 |
T10062 |
punct |
–,45 |
R1941 |
T10064 |
T10060 |
punct |
),kDa |
R1942 |
T9926 |
T9927 |
compound |
pulse,chase |
R1943 |
T10065 |
T10056 |
prep |
in,proteins |
R1944 |
T10066 |
T10067 |
compound |
Aqp2F204V,F204V |
R1945 |
T10067 |
T10069 |
compound |
F204V,mice |
R1946 |
T10068 |
T10067 |
punct |
/,F204V |
R1947 |
T10069 |
T10065 |
pobj |
mice,in |
R1948 |
T10070 |
T10053 |
advmod |
presumably,permits |
R1949 |
T9927 |
T9929 |
compound |
chase,labeling |
R1950 |
T10071 |
T10072 |
poss |
their,survival |
R1951 |
T10072 |
T10053 |
dobj |
survival,permits |
R1952 |
T10073 |
T10072 |
prep |
compared,survival |
R1953 |
T9928 |
T9927 |
punct |
-,chase |
R1954 |
T10074 |
T10073 |
prep |
to,compared |
R1955 |
T10075 |
T10076 |
compound |
Aqp2T126M,T126M |
R1956 |
T10076 |
T10078 |
compound |
T126M,mice |
R1957 |
T9929 |
T9930 |
compound |
labeling,experiments |
R1958 |
T10077 |
T10076 |
punct |
/,T126M |
R1959 |
T10078 |
T10074 |
pobj |
mice,to |
R1960 |
T10079 |
T10053 |
punct |
", ",permits |
R1961 |
T9930 |
T9925 |
pobj |
experiments,from |
R1962 |
T10080 |
T10053 |
cc |
and,permits |
R1963 |
T10081 |
T10053 |
conj |
is,permits |
R1964 |
T10082 |
T10081 |
acomp |
consistent,is |
R1965 |
T9931 |
T9932 |
punct |
[,22 |
R1966 |
T10083 |
T10082 |
prep |
with,consistent |
R1967 |
T10084 |
T10085 |
det |
a,response |
R1968 |
T9932 |
T9911 |
parataxis |
22,is |
R1969 |
T10085 |
T10083 |
pobj |
response,with |
R1970 |
T10086 |
T10085 |
amod |
diminished,response |
R1971 |
T10087 |
T10085 |
prep |
to,response |
R1972 |
T10088 |
T10087 |
pobj |
dDAVP,to |
R1973 |
T10146 |
T10147 |
prep |
In,fail |
R1974 |
T10089 |
T10053 |
punct |
.,permits |
R1975 |
T10091 |
T10092 |
prep |
In,postulated |
R1976 |
T10093 |
T10091 |
pobj |
humans,In |
R1977 |
T10148 |
T10146 |
amod |
general,In |
R1978 |
T10094 |
T10092 |
punct |
", ",postulated |
R1979 |
T10095 |
T10096 |
amod |
recessive,alleles |
R1980 |
T10096 |
T10092 |
nsubjpass |
alleles,postulated |
R1981 |
T10097 |
T10096 |
prep |
of,alleles |
R1982 |
T10149 |
T10147 |
punct |
", ",fail |
R1983 |
T10098 |
T10097 |
pobj |
Aqp2,of |
R1984 |
T10099 |
T10092 |
auxpass |
are,postulated |
R1985 |
T10100 |
T10101 |
aux |
to,cause |
R1986 |
T10150 |
T10151 |
amod |
such,alleles |
R1987 |
T10101 |
T10092 |
xcomp |
cause,postulated |
R1988 |
T10102 |
T10101 |
dobj |
NDI,cause |
R1989 |
T10103 |
T10104 |
mark |
because,translocate |
R1990 |
T10151 |
T10147 |
nsubj |
alleles,fail |
R1991 |
T10152 |
T10151 |
amod |
recessive,alleles |
R1992 |
T10104 |
T10101 |
advcl |
translocate,cause |
R1993 |
T10105 |
T10104 |
nsubj |
they,translocate |
R1994 |
T10153 |
T10147 |
punct |
", ",fail |
R1995 |
T10106 |
T10104 |
aux |
do,translocate |
R1996 |
T10107 |
T10104 |
neg |
not,translocate |
R1997 |
T10108 |
T10104 |
advmod |
properly,translocate |
R1998 |
T10109 |
T10104 |
prep |
to,translocate |
R1999 |
T10110 |
T10111 |
det |
the,surface |
R2000 |
T10154 |
T10155 |
advmod |
when,visualized |
R2001 |
T10111 |
T10109 |
pobj |
surface,to |
R2002 |
T10112 |
T10111 |
amod |
apical,surface |
R2003 |
T10113 |
T10111 |
compound |
cell,surface |
R2004 |
T10114 |
T10104 |
prep |
in,translocate |
R2005 |
T10155 |
T10147 |
advcl |
visualized,fail |
R2006 |
T10115 |
T10114 |
pobj |
response,in |
R2007 |
T10116 |
T10115 |
prep |
to,response |
R2008 |
T10156 |
T10155 |
advmod |
immunocytochemically,visualized |
R2009 |
T10117 |
T10116 |
pobj |
AVP,to |
R2010 |
T10118 |
T10092 |
punct |
.,postulated |
R2011 |
T10157 |
T10147 |
punct |
", ",fail |
R2012 |
T10120 |
T10121 |
det |
This,postulate |
R2013 |
T10121 |
T10122 |
nsubj |
postulate,comes |
R2014 |
T10158 |
T10159 |
aux |
to,localize |
R2015 |
T10123 |
T10124 |
advmod |
solely,from |
R2016 |
T10124 |
T10122 |
prep |
from,comes |
R2017 |
T10159 |
T10147 |
xcomp |
localize,fail |
R2018 |
T10125 |
T10126 |
advmod |
in,vitro |
R2019 |
T10126 |
T10127 |
amod |
vitro,studies |
R2020 |
T10127 |
T10124 |
pobj |
studies,from |
R2021 |
T10160 |
T10159 |
prep |
to,localize |
R2022 |
T10128 |
T10129 |
prep |
in,transfected |
R2023 |
T10129 |
T10127 |
relcl |
transfected,studies |
R2024 |
T10130 |
T10128 |
pobj |
which,in |
R2025 |
T10161 |
T10162 |
npadvmod |
AVP,responsive |
R2026 |
T10131 |
T10132 |
compound |
mutant,cDNAs |
R2027 |
T10132 |
T10129 |
nsubjpass |
cDNAs,transfected |
R2028 |
T10133 |
T10132 |
compound |
Aqp2,cDNAs |
R2029 |
T10162 |
T10164 |
amod |
responsive,vesicles |
R2030 |
T10134 |
T10132 |
acl |
corresponding,cDNAs |
R2031 |
T10135 |
T10134 |
prep |
to,corresponding |
R2032 |
T10136 |
T10137 |
amod |
human,mutations |
R2033 |
T10163 |
T10162 |
punct |
-,responsive |
R2034 |
T10137 |
T10135 |
pobj |
mutations,to |
R2035 |
T10138 |
T10137 |
compound |
disease,mutations |
R2036 |
T10164 |
T10160 |
pobj |
vesicles,to |
R2037 |
T10139 |
T10129 |
auxpass |
are,transfected |
R2038 |
T10140 |
T10129 |
prep |
into,transfected |
R2039 |
T10141 |
T10142 |
compound |
kidney,lines |
R2040 |
T10165 |
T10147 |
punct |
.,fail |
R2041 |
T10142 |
T10140 |
pobj |
lines,into |
R2042 |
T10143 |
T10142 |
compound |
cell,lines |
R2043 |
T10144 |
T10122 |
punct |
.,comes |
R2044 |
T10167 |
T10168 |
advmod |
Rather,trapped |
R2045 |
T10169 |
T10168 |
punct |
", ",trapped |
R2046 |
T10170 |
T10168 |
nsubjpass |
they,trapped |
R2047 |
T10171 |
T10168 |
auxpass |
get,trapped |
R2048 |
T10172 |
T10168 |
prep |
in,trapped |
R2049 |
T10250 |
T10237 |
parataxis |
row,translocated |
R2050 |
T10251 |
T10250 |
dep |
Figure,row |
R2051 |
T10173 |
T10174 |
det |
the,reticulum |
R2052 |
T10252 |
T10251 |
nummod |
4A,Figure |
R2053 |
T10253 |
T10250 |
punct |
", ",row |
R2054 |
T10174 |
T10172 |
pobj |
reticulum,in |
R2055 |
T10254 |
T10250 |
amod |
second,row |
R2056 |
T10255 |
T10250 |
punct |
),row |
R2057 |
T10256 |
T10237 |
punct |
.,translocated |
R2058 |
T10175 |
T10174 |
amod |
endoplasmic,reticulum |
R2059 |
T10258 |
T10259 |
prep |
In,distributed |
R2060 |
T10176 |
T10174 |
punct |
(,reticulum |
R2061 |
T10260 |
T10258 |
pobj |
kidneys,In |
R2062 |
T10261 |
T10260 |
acl |
taken,kidneys |
R2063 |
T10177 |
T10174 |
appos |
ER,reticulum |
R2064 |
T10262 |
T10261 |
prep |
from,taken |
R2065 |
T10263 |
T10264 |
compound |
mutant,animals |
R2066 |
T10264 |
T10262 |
pobj |
animals,from |
R2067 |
T10178 |
T10168 |
punct |
),trapped |
R2068 |
T10265 |
T10259 |
punct |
", ",distributed |
R2069 |
T10266 |
T10259 |
advmod |
however,distributed |
R2070 |
T10267 |
T10259 |
punct |
", ",distributed |
R2071 |
T10179 |
T10168 |
punct |
.,trapped |
R2072 |
T10268 |
T10259 |
nsubjpass |
AQP2,distributed |
R2073 |
T10269 |
T10259 |
auxpass |
was,distributed |
R2074 |
T10270 |
T10259 |
advmod |
randomly,distributed |
R2075 |
T10271 |
T10259 |
prep |
throughout,distributed |
R2076 |
T10181 |
T10182 |
poss |
Our,model |
R2077 |
T10272 |
T10273 |
det |
the,cell |
R2078 |
T10273 |
T10271 |
pobj |
cell,throughout |
R2079 |
T10274 |
T10259 |
prep |
in,distributed |
R2080 |
T10275 |
T10276 |
det |
the,state |
R2081 |
T10182 |
T10184 |
nsubj |
model,affords |
R2082 |
T10276 |
T10274 |
pobj |
state,in |
R2083 |
T10277 |
T10276 |
amod |
basal,state |
R2084 |
T10278 |
T10279 |
punct |
(,row |
R2085 |
T10183 |
T10182 |
compound |
mouse,model |
R2086 |
T10185 |
T10182 |
prep |
of,model |
R2087 |
T10279 |
T10259 |
parataxis |
row,distributed |
R2088 |
T10186 |
T10185 |
pobj |
NDI,of |
R2089 |
T10280 |
T10279 |
dep |
Figure,row |
R2090 |
T10281 |
T10280 |
nummod |
4A,Figure |
R2091 |
T10187 |
T10188 |
det |
the,opportunity |
R2092 |
T10282 |
T10279 |
punct |
", ",row |
R2093 |
T10283 |
T10279 |
amod |
third,row |
R2094 |
T10284 |
T10279 |
punct |
),row |
R2095 |
T10188 |
T10184 |
dobj |
opportunity,affords |
R2096 |
T10285 |
T10259 |
punct |
", ",distributed |
R2097 |
T10286 |
T10287 |
mark |
while,localized |
R2098 |
T10189 |
T10188 |
amod |
first,opportunity |
R2099 |
T10287 |
T10259 |
advcl |
localized,distributed |
R2100 |
T10288 |
T10287 |
nsubj |
AQP3,localized |
R2101 |
T10289 |
T10290 |
punct |
(,green |
R2102 |
T10290 |
T10288 |
parataxis |
green,AQP3 |
R2103 |
T10291 |
T10290 |
punct |
),green |
R2104 |
T10190 |
T10191 |
aux |
to,test |
R2105 |
T10292 |
T10287 |
advmod |
appropriately,localized |
R2106 |
T10293 |
T10287 |
prep |
to,localized |
R2107 |
T10294 |
T10295 |
det |
the,surface |
R2108 |
T10191 |
T10188 |
acl |
test,opportunity |
R2109 |
T10295 |
T10293 |
pobj |
surface,to |
R2110 |
T10296 |
T10295 |
amod |
basolateral,surface |
R2111 |
T10297 |
T10298 |
punct |
[,23 |
R2112 |
T10192 |
T10193 |
det |
this,hypothesis |
R2113 |
T10298 |
T10287 |
parataxis |
23,localized |
R2114 |
T10299 |
T10298 |
punct |
],23 |
R2115 |
T10300 |
T10259 |
punct |
.,distributed |
R2116 |
T10193 |
T10191 |
dobj |
hypothesis,test |
R2117 |
T10302 |
T10303 |
advmod |
Furthermore,failed |
R2118 |
T10194 |
T10191 |
prep |
in,test |
R2119 |
T10304 |
T10303 |
punct |
", ",failed |
R2120 |
T10305 |
T10303 |
prep |
upon,failed |
R2121 |
T10306 |
T10307 |
compound |
dDAVP,stimulation |
R2122 |
T10195 |
T10196 |
det |
a,animal |
R2123 |
T10307 |
T10305 |
pobj |
stimulation,upon |
R2124 |
T10308 |
T10303 |
punct |
", ",failed |
R2125 |
T10309 |
T10310 |
compound |
AQP2,F204V |
R2126 |
T10196 |
T10194 |
pobj |
animal,in |
R2127 |
T10310 |
T10303 |
nsubj |
F204V,failed |
R2128 |
T10311 |
T10310 |
punct |
-,F204V |
R2129 |
T10312 |
T10313 |
aux |
to,translocate |
R2130 |
T10197 |
T10196 |
amod |
mature,animal |
R2131 |
T10313 |
T10303 |
xcomp |
translocate,failed |
R2132 |
T10314 |
T10313 |
prep |
to,translocate |
R2133 |
T10198 |
T10184 |
punct |
.,affords |
R2134 |
T10315 |
T10316 |
det |
the,surface |
R2135 |
T10316 |
T10314 |
pobj |
surface,to |
R2136 |
T10317 |
T10316 |
compound |
cell,surface |
R2137 |
T10200 |
T10201 |
mark |
As,shown |
R2138 |
T10318 |
T10319 |
punct |
(,row |
R2139 |
T10319 |
T10303 |
parataxis |
row,failed |
R2140 |
T10320 |
T10319 |
dep |
Figure,row |
R2141 |
T10321 |
T10320 |
nummod |
4A,Figure |
R2142 |
T10322 |
T10319 |
punct |
", ",row |
R2143 |
T10201 |
T10202 |
advcl |
shown,localized |
R2144 |
T10323 |
T10319 |
amod |
bottom,row |
R2145 |
T10324 |
T10319 |
punct |
),row |
R2146 |
T10203 |
T10201 |
prep |
in,shown |
R2147 |
T10325 |
T10303 |
punct |
.,failed |
R2148 |
T10327 |
T10328 |
aux |
To,confirm |
R2149 |
T10328 |
T10329 |
advcl |
confirm,repeated |
R2150 |
T10204 |
T10203 |
pobj |
Figure,in |
R2151 |
T10330 |
T10331 |
det |
these,findings |
R2152 |
T10331 |
T10328 |
dobj |
findings,confirm |
R2153 |
T10332 |
T10329 |
punct |
", ",repeated |
R2154 |
T10333 |
T10334 |
det |
the,staining |
R2155 |
T10334 |
T10329 |
nsubjpass |
staining,repeated |
R2156 |
T10205 |
T10204 |
nummod |
4A,Figure |
R2157 |
T10335 |
T10329 |
auxpass |
was,repeated |
R2158 |
T10336 |
T10329 |
prep |
in,repeated |
R2159 |
T10337 |
T10336 |
pobj |
kidneys,in |
R2160 |
T10206 |
T10207 |
punct |
(,row |
R2161 |
T10338 |
T10337 |
acl |
taken,kidneys |
R2162 |
T10339 |
T10338 |
prep |
from,taken |
R2163 |
T10340 |
T10341 |
nummod |
two,mice |
R2164 |
T10341 |
T10339 |
pobj |
mice,from |
R2165 |
T10207 |
T10204 |
parataxis |
row,Figure |
R2166 |
T10342 |
T10341 |
amod |
further,mice |
R2167 |
T10343 |
T10338 |
prep |
for,taken |
R2168 |
T10208 |
T10207 |
amod |
top,row |
R2169 |
T10344 |
T10345 |
det |
each,class |
R2170 |
T10345 |
T10343 |
pobj |
class,for |
R2171 |
T10209 |
T10207 |
prep |
of,row |
R2172 |
T10346 |
T10345 |
punct |
", ",class |
R2173 |
T10347 |
T10348 |
amod |
wild,type |
R2174 |
T10348 |
T10345 |
appos |
type,class |
R2175 |
T10210 |
T10209 |
pobj |
photomicrographs,of |
R2176 |
T10349 |
T10348 |
punct |
-,type |
R2177 |
T10350 |
T10348 |
cc |
or,type |
R2178 |
T10351 |
T10348 |
conj |
mutant,type |
R2179 |
T10211 |
T10207 |
punct |
),row |
R2180 |
T10352 |
T10329 |
punct |
", ",repeated |
R2181 |
T10353 |
T10329 |
prep |
with,repeated |
R2182 |
T10354 |
T10353 |
cc |
or,with |
R2183 |
T10212 |
T10202 |
punct |
", ",localized |
R2184 |
T10355 |
T10353 |
conj |
without,with |
R2185 |
T10213 |
T10202 |
nsubj |
AQP2,localized |
R2186 |
T10214 |
T10213 |
punct |
(,AQP2 |
R2187 |
T10215 |
T10213 |
acl |
stained,AQP2 |
R2188 |
T10356 |
T10357 |
compound |
dDAVP,treatment |
R2189 |
T10357 |
T10355 |
pobj |
treatment,without |
R2190 |
T10216 |
T10215 |
oprd |
red,stained |
R2191 |
T10358 |
T10329 |
punct |
", ",repeated |
R2192 |
T10359 |
T10329 |
prep |
with,repeated |
R2193 |
T10217 |
T10213 |
punct |
),AQP2 |
R2194 |
T10360 |
T10361 |
amod |
identical,results |
R2195 |
T10361 |
T10359 |
pobj |
results,with |
R2196 |
T10362 |
T10329 |
punct |
.,repeated |
R2197 |
T10218 |
T10202 |
advmod |
normally,localized |
R2198 |
T10364 |
T10365 |
aux |
To,investigate |
R2199 |
T10365 |
T10366 |
advcl |
investigate,turned |
R2200 |
T10219 |
T10202 |
prep |
to,localized |
R2201 |
T10367 |
T10368 |
det |
the,mechanism |
R2202 |
T10220 |
T10221 |
det |
the,region |
R2203 |
T10368 |
T10365 |
dobj |
mechanism,investigate |
R2204 |
T10221 |
T10219 |
pobj |
region,to |
R2205 |
T10369 |
T10368 |
prep |
of,mechanism |
R2206 |
T10370 |
T10371 |
amod |
defective,translocation |
R2207 |
T10222 |
T10221 |
amod |
subapical,region |
R2208 |
T10371 |
T10369 |
pobj |
translocation,of |
R2209 |
T10372 |
T10371 |
prep |
of,translocation |
R2210 |
T10223 |
T10221 |
prep |
of,region |
R2211 |
T10373 |
T10374 |
compound |
AQP2,F204V |
R2212 |
T10374 |
T10372 |
pobj |
F204V,of |
R2213 |
T10375 |
T10374 |
punct |
-,F204V |
R2214 |
T10224 |
T10225 |
amod |
collecting,duct |
R2215 |
T10376 |
T10366 |
punct |
", ",turned |
R2216 |
T10377 |
T10366 |
nsubj |
we,turned |
R2217 |
T10225 |
T10226 |
compound |
duct,cells |
R2218 |
T10378 |
T10366 |
prep |
to,turned |
R2219 |
T10379 |
T10378 |
pobj |
transfection,to |
R2220 |
T10226 |
T10223 |
pobj |
cells,of |
R2221 |
T10380 |
T10379 |
prep |
of,transfection |
R2222 |
T10381 |
T10382 |
compound |
MDCK,cells |
R2223 |
T10382 |
T10380 |
pobj |
cells,of |
R2224 |
T10227 |
T10221 |
prep |
in,region |
R2225 |
T10383 |
T10366 |
punct |
.,turned |
R2226 |
T10228 |
T10227 |
pobj |
kidneys,in |
R2227 |
T10385 |
T10386 |
amod |
Stable,lines |
R2228 |
T10386 |
T10388 |
nsubjpass |
lines,established |
R2229 |
T10387 |
T10386 |
compound |
cell,lines |
R2230 |
T10229 |
T10228 |
prep |
of,kidneys |
R2231 |
T10389 |
T10386 |
acl |
expressing,lines |
R2232 |
T10390 |
T10391 |
nmod |
mouse,AQP2 |
R2233 |
T10230 |
T10231 |
amod |
wild,type |
R2234 |
T10391 |
T10389 |
dobj |
AQP2,expressing |
R2235 |
T10392 |
T10393 |
amod |
wild,type |
R2236 |
T10393 |
T10391 |
compound |
type,AQP2 |
R2237 |
T10231 |
T10233 |
compound |
type,mice |
R2238 |
T10394 |
T10393 |
punct |
-,type |
R2239 |
T10395 |
T10391 |
cc |
and,AQP2 |
R2240 |
T10232 |
T10231 |
punct |
-,type |
R2241 |
T10396 |
T10397 |
compound |
AQP2,F204V |
R2242 |
T10397 |
T10391 |
conj |
F204V,AQP2 |
R2243 |
T10398 |
T10397 |
punct |
-,F204V |
R2244 |
T10233 |
T10229 |
pobj |
mice,of |
R2245 |
T10399 |
T10388 |
auxpass |
were,established |
R2246 |
T10400 |
T10388 |
punct |
.,established |
R2247 |
T10234 |
T10202 |
punct |
.,localized |
R2248 |
T10402 |
T10403 |
nsubj |
Immunoblots,showed |
R2249 |
T10236 |
T10237 |
prep |
Upon,translocated |
R2250 |
T10404 |
T10402 |
prep |
of,Immunoblots |
R2251 |
T10405 |
T10406 |
compound |
protein,extracts |
R2252 |
T10406 |
T10404 |
pobj |
extracts,of |
R2253 |
T10407 |
T10406 |
prep |
from,extracts |
R2254 |
T10408 |
T10409 |
amod |
stable,lines |
R2255 |
T10409 |
T10407 |
pobj |
lines,from |
R2256 |
T10410 |
T10409 |
compound |
cell,lines |
R2257 |
T10238 |
T10236 |
pobj |
stimulation,Upon |
R2258 |
T10411 |
T10412 |
mark |
that,recapitulate |
R2259 |
T10412 |
T10403 |
ccomp |
recapitulate,showed |
R2260 |
T10413 |
T10414 |
compound |
MDCK,cells |
R2261 |
T10414 |
T10412 |
nsubj |
cells,recapitulate |
R2262 |
T10415 |
T10416 |
det |
the,defect |
R2263 |
T10239 |
T10238 |
prep |
with,stimulation |
R2264 |
T10416 |
T10412 |
dobj |
defect,recapitulate |
R2265 |
T10417 |
T10416 |
compound |
glycosylation,defect |
R2266 |
T10240 |
T10239 |
pobj |
dDAVP,with |
R2267 |
T10418 |
T10416 |
acl |
seen,defect |
R2268 |
T10419 |
T10418 |
prep |
in,seen |
R2269 |
T10420 |
T10421 |
compound |
mutant,mice |
R2270 |
T10241 |
T10237 |
punct |
", ",translocated |
R2271 |
T10421 |
T10419 |
pobj |
mice,in |
R2272 |
T10422 |
T10423 |
punct |
(,data |
R2273 |
T10423 |
T10403 |
meta |
data,showed |
R2274 |
T10424 |
T10423 |
amod |
unpublished,data |
R2275 |
T10242 |
T10237 |
nsubj |
AQP2,translocated |
R2276 |
T10425 |
T10423 |
punct |
),data |
R2277 |
T10426 |
T10403 |
punct |
.,showed |
R2278 |
T10243 |
T10237 |
prep |
to,translocated |
R2279 |
T10428 |
T10429 |
det |
The,protein |
R2280 |
T10429 |
T10433 |
nsubj |
protein,was |
R2281 |
T10244 |
T10243 |
cc |
or,to |
R2282 |
T10430 |
T10431 |
amod |
wild,type |
R2283 |
T10431 |
T10429 |
compound |
type,protein |
R2284 |
T10432 |
T10431 |
punct |
-,type |
R2285 |
T10245 |
T10243 |
conj |
near,to |
R2286 |
T10434 |
T10433 |
advmod |
again,was |
R2287 |
T10246 |
T10247 |
det |
the,surface |
R2288 |
T10435 |
T10433 |
acomp |
present,was |
R2289 |
T10436 |
T10433 |
prep |
in,was |
R2290 |
T10437 |
T10438 |
nummod |
three,forms |
R2291 |
T10247 |
T10245 |
pobj |
surface,near |
R2292 |
T10438 |
T10436 |
pobj |
forms,in |
R2293 |
T10439 |
T10438 |
amod |
different,forms |
R2294 |
T10248 |
T10247 |
compound |
cell,surface |
R2295 |
T10440 |
T10433 |
punct |
.,was |
R2296 |
T10442 |
T10443 |
nsubj |
Cells,lacked |
R2297 |
T10249 |
T10250 |
punct |
(,row |
R2298 |
T10444 |
T10442 |
acl |
expressing,Cells |
R2299 |
T10445 |
T10446 |
compound |
AQP2,F204V |
R2300 |
T10462 |
T10461 |
punct |
-,glycosylated |
R2301 |
T10446 |
T10444 |
dobj |
F204V,expressing |
R2302 |
T10447 |
T10446 |
punct |
-,F204V |
R2303 |
T10448 |
T10449 |
det |
the,form |
R2304 |
T10449 |
T10443 |
dobj |
form,lacked |
R2305 |
T10463 |
T10464 |
nummod |
31,kDa |
R2306 |
T10450 |
T10451 |
quantmod |
35,45 |
R2307 |
T10451 |
T10453 |
nummod |
45,kDa |
R2308 |
T10452 |
T10451 |
punct |
–,45 |
R2309 |
T10453 |
T10449 |
compound |
kDa,form |
R2310 |
T10454 |
T10443 |
cc |
and,lacked |
R2311 |
T10455 |
T10456 |
auxpass |
were,enriched |
R2312 |
T10464 |
T10459 |
compound |
kDa,form |
R2313 |
T10456 |
T10443 |
conj |
enriched,lacked |
R2314 |
T10457 |
T10456 |
prep |
in,enriched |
R2315 |
T10465 |
T10443 |
punct |
.,lacked |
R2316 |
T10458 |
T10459 |
det |
the,form |
R2317 |
T10467 |
T10468 |
prep |
In,appeared |
R2318 |
T10459 |
T10457 |
pobj |
form,in |
R2319 |
T10460 |
T10461 |
npadvmod |
core,glycosylated |
R2320 |
T10461 |
T10459 |
amod |
glycosylated,form |
R2321 |
T10469 |
T10470 |
amod |
transfected,cells |
R2322 |
T10470 |
T10467 |
pobj |
cells,In |
R2323 |
T10471 |
T10470 |
punct |
", ",cells |
R2324 |
T10567 |
T10568 |
prep |
Along,seen |
R2325 |
T10472 |
T10470 |
amod |
unstimulated,cells |
R2326 |
T10569 |
T10570 |
det |
the,axis |
R2327 |
T10570 |
T10567 |
pobj |
axis,Along |
R2328 |
T10473 |
T10470 |
compound |
MDCK,cells |
R2329 |
T10571 |
T10570 |
compound |
z,axis |
R2330 |
T10572 |
T10570 |
punct |
-,axis |
R2331 |
T10573 |
T10568 |
punct |
", ",seen |
R2332 |
T10474 |
T10468 |
punct |
", ",appeared |
R2333 |
T10574 |
T10575 |
det |
the,distribution |
R2334 |
T10475 |
T10476 |
amod |
wild,type |
R2335 |
T10476 |
T10478 |
compound |
type,AQP2 |
R2336 |
T10575 |
T10568 |
nsubjpass |
distribution,seen |
R2337 |
T10576 |
T10575 |
amod |
perinuclear,distribution |
R2338 |
T10477 |
T10476 |
punct |
-,type |
R2339 |
T10577 |
T10575 |
prep |
of,distribution |
R2340 |
T10578 |
T10579 |
compound |
AQP2,F204V |
R2341 |
T10478 |
T10468 |
nsubj |
AQP2,appeared |
R2342 |
T10579 |
T10577 |
pobj |
F204V,of |
R2343 |
T10580 |
T10579 |
punct |
-,F204V |
R2344 |
T10581 |
T10568 |
auxpass |
was,seen |
R2345 |
T10582 |
T10568 |
advmod |
clearly,seen |
R2346 |
T10479 |
T10478 |
punct |
(,AQP2 |
R2347 |
T10583 |
T10568 |
punct |
", ",seen |
R2348 |
T10584 |
T10568 |
cc |
and,seen |
R2349 |
T10585 |
T10586 |
det |
this,distribution |
R2350 |
T10480 |
T10478 |
acl |
stained,AQP2 |
R2351 |
T10586 |
T10587 |
nsubjpass |
distribution,altered |
R2352 |
T10587 |
T10568 |
conj |
altered,seen |
R2353 |
T10588 |
T10587 |
auxpass |
is,altered |
R2354 |
T10481 |
T10480 |
oprd |
green,stained |
R2355 |
T10589 |
T10587 |
neg |
not,altered |
R2356 |
T10590 |
T10587 |
agent |
by,altered |
R2357 |
T10482 |
T10478 |
punct |
),AQP2 |
R2358 |
T10591 |
T10590 |
pobj |
forskolin,by |
R2359 |
T10592 |
T10593 |
punct |
(,columns |
R2360 |
T10593 |
T10587 |
parataxis |
columns,altered |
R2361 |
T10594 |
T10593 |
dep |
Figure,columns |
R2362 |
T10595 |
T10594 |
nummod |
4B,Figure |
R2363 |
T10596 |
T10593 |
punct |
", ",columns |
R2364 |
T10483 |
T10468 |
prep |
in,appeared |
R2365 |
T10597 |
T10598 |
amod |
bottom,row |
R2366 |
T10598 |
T10593 |
dep |
row,columns |
R2367 |
T10599 |
T10593 |
punct |
", ",columns |
R2368 |
T10484 |
T10485 |
det |
a,pattern |
R2369 |
T10600 |
T10593 |
nummod |
two,columns |
R2370 |
T10601 |
T10593 |
amod |
right,columns |
R2371 |
T10602 |
T10593 |
punct |
),columns |
R2372 |
T10485 |
T10483 |
pobj |
pattern,in |
R2373 |
T10603 |
T10587 |
punct |
.,altered |
R2374 |
T10486 |
T10485 |
compound |
punctate,pattern |
R2375 |
T10605 |
T10606 |
det |
The,distribution |
R2376 |
T10606 |
T10608 |
nsubj |
distribution,is |
R2377 |
T10607 |
T10606 |
amod |
perinuclear,distribution |
R2378 |
T10487 |
T10485 |
acl |
distributed,pattern |
R2379 |
T10609 |
T10606 |
prep |
of,distribution |
R2380 |
T10610 |
T10611 |
compound |
AQP2,F204V |
R2381 |
T10488 |
T10487 |
prep |
throughout,distributed |
R2382 |
T10611 |
T10609 |
pobj |
F204V,of |
R2383 |
T10612 |
T10611 |
punct |
-,F204V |
R2384 |
T10489 |
T10490 |
det |
the,region |
R2385 |
T10613 |
T10608 |
acomp |
consistent,is |
R2386 |
T10614 |
T10613 |
prep |
with,consistent |
R2387 |
T10615 |
T10616 |
det |
an,compartmentalization |
R2388 |
T10616 |
T10614 |
pobj |
compartmentalization,with |
R2389 |
T10490 |
T10488 |
pobj |
region,throughout |
R2390 |
T10617 |
T10616 |
compound |
ER,compartmentalization |
R2391 |
T10618 |
T10608 |
punct |
.,is |
R2392 |
T10491 |
T10490 |
amod |
subapical,region |
R2393 |
T10620 |
T10621 |
aux |
To,test |
R2394 |
T10621 |
T10622 |
advcl |
test,co-stained |
R2395 |
T10492 |
T10493 |
punct |
(,photomicrographs |
R2396 |
T10623 |
T10624 |
det |
the,idea |
R2397 |
T10493 |
T10468 |
parataxis |
photomicrographs,appeared |
R2398 |
T10624 |
T10621 |
dobj |
idea,test |
R2399 |
T10625 |
T10626 |
mark |
that,localizes |
R2400 |
T10626 |
T10624 |
acl |
localizes,idea |
R2401 |
T10494 |
T10493 |
dep |
Figure,photomicrographs |
R2402 |
T10627 |
T10628 |
compound |
AQP2,F204V |
R2403 |
T10628 |
T10626 |
nsubj |
F204V,localizes |
R2404 |
T10629 |
T10628 |
punct |
-,F204V |
R2405 |
T10495 |
T10494 |
nummod |
4B,Figure |
R2406 |
T10630 |
T10626 |
prep |
to,localizes |
R2407 |
T10631 |
T10632 |
det |
the,ER |
R2408 |
T10496 |
T10493 |
punct |
", ",photomicrographs |
R2409 |
T10497 |
T10498 |
amod |
left,column |
R2410 |
T10632 |
T10630 |
pobj |
ER,to |
R2411 |
T10633 |
T10622 |
punct |
", ",co-stained |
R2412 |
T10634 |
T10622 |
nsubj |
we,co-stained |
R2413 |
T10635 |
T10622 |
dobj |
cells,co-stained |
R2414 |
T10636 |
T10635 |
acl |
transfected,cells |
R2415 |
T10498 |
T10493 |
compound |
column,photomicrographs |
R2416 |
T10637 |
T10636 |
prep |
with,transfected |
R2417 |
T10638 |
T10637 |
pobj |
Aqp2F204V,with |
R2418 |
T10499 |
T10493 |
punct |
),photomicrographs |
R2419 |
T10639 |
T10640 |
punct |
(,cDNA |
R2420 |
T10640 |
T10638 |
parataxis |
cDNA,Aqp2F204V |
R2421 |
T10500 |
T10468 |
punct |
", ",appeared |
R2422 |
T10641 |
T10640 |
punct |
),cDNA |
R2423 |
T10642 |
T10622 |
prep |
for,co-stained |
R2424 |
T10643 |
T10642 |
pobj |
AQP2,for |
R2425 |
T10501 |
T10468 |
advcl |
consistent,appeared |
R2426 |
T10644 |
T10643 |
cc |
and,AQP2 |
R2427 |
T10645 |
T10646 |
det |
an,marker |
R2428 |
T10646 |
T10643 |
conj |
marker,AQP2 |
R2429 |
T10502 |
T10501 |
prep |
with,consistent |
R2430 |
T10647 |
T10646 |
compound |
ER,marker |
R2431 |
T10648 |
T10646 |
punct |
", ",marker |
R2432 |
T10649 |
T10646 |
appos |
calnexin,marker |
R2433 |
T10503 |
T10504 |
amod |
vesicular,compartmentalization |
R2434 |
T10650 |
T10651 |
punct |
(,Figure |
R2435 |
T10651 |
T10622 |
parataxis |
Figure,co-stained |
R2436 |
T10652 |
T10651 |
nummod |
4C,Figure |
R2437 |
T10504 |
T10502 |
pobj |
compartmentalization,with |
R2438 |
T10653 |
T10651 |
punct |
),Figure |
R2439 |
T10654 |
T10622 |
punct |
.,co-stained |
R2440 |
T10505 |
T10468 |
punct |
.,appeared |
R2441 |
T10656 |
T10657 |
nsubjpass |
Colocalization,investigated |
R2442 |
T10658 |
T10656 |
prep |
of,Colocalization |
R2443 |
T10507 |
T10508 |
compound |
AQP2,F204V |
R2444 |
T10659 |
T10658 |
pobj |
calnexin,of |
R2445 |
T10660 |
T10656 |
prep |
with,Colocalization |
R2446 |
T10661 |
T10660 |
pobj |
AQP2,with |
R2447 |
T10662 |
T10657 |
auxpass |
was,investigated |
R2448 |
T10508 |
T10510 |
nsubj |
F204V,appeared |
R2449 |
T10663 |
T10657 |
advmod |
directly,investigated |
R2450 |
T10664 |
T10657 |
punct |
", ",investigated |
R2451 |
T10665 |
T10657 |
cc |
and,investigated |
R2452 |
T10509 |
T10508 |
punct |
-,F204V |
R2453 |
T10666 |
T10667 |
nsubjpass |
it,found |
R2454 |
T10667 |
T10657 |
conj |
found,investigated |
R2455 |
T10668 |
T10667 |
auxpass |
was,found |
R2456 |
T10511 |
T10510 |
punct |
", ",appeared |
R2457 |
T10669 |
T10670 |
mark |
that,colocalized |
R2458 |
T10670 |
T10667 |
ccomp |
colocalized,found |
R2459 |
T10671 |
T10672 |
nummod |
80,% |
R2460 |
T10672 |
T10670 |
nsubj |
%,colocalized |
R2461 |
T10512 |
T10510 |
prep |
on,appeared |
R2462 |
T10513 |
T10514 |
det |
the,hand |
R2463 |
T10673 |
T10672 |
prep |
of,% |
R2464 |
T10514 |
T10512 |
pobj |
hand,on |
R2465 |
T10674 |
T10675 |
det |
all,protein |
R2466 |
T10675 |
T10673 |
pobj |
protein,of |
R2467 |
T10676 |
T10677 |
compound |
AQP2,F204V |
R2468 |
T10515 |
T10514 |
amod |
other,hand |
R2469 |
T10677 |
T10675 |
compound |
F204V,protein |
R2470 |
T10678 |
T10677 |
punct |
-,F204V |
R2471 |
T10679 |
T10670 |
prep |
with,colocalized |
R2472 |
T10516 |
T10510 |
punct |
", ",appeared |
R2473 |
T10680 |
T10679 |
pobj |
calnexin,with |
R2474 |
T10681 |
T10667 |
punct |
.,found |
R2475 |
T10517 |
T10510 |
prep |
in,appeared |
R2476 |
T10683 |
T10684 |
det |
The,% |
R2477 |
T10684 |
T10687 |
nsubj |
%,appeared |
R2478 |
T10518 |
T10519 |
det |
a,pattern |
R2479 |
T10685 |
T10684 |
amod |
remaining,% |
R2480 |
T10686 |
T10684 |
nummod |
20,% |
R2481 |
T10519 |
T10517 |
pobj |
pattern,in |
R2482 |
T10688 |
T10687 |
prep |
at,appeared |
R2483 |
T10689 |
T10690 |
det |
the,periphery |
R2484 |
T10520 |
T10521 |
npadvmod |
punctate,perinuclear |
R2485 |
T10690 |
T10688 |
pobj |
periphery,at |
R2486 |
T10691 |
T10690 |
prep |
of,periphery |
R2487 |
T10692 |
T10693 |
det |
the,ER |
R2488 |
T10521 |
T10519 |
amod |
perinuclear,pattern |
R2489 |
T10693 |
T10691 |
pobj |
ER,of |
R2490 |
T10694 |
T10687 |
punct |
", ",appeared |
R2491 |
T10695 |
T10687 |
advcl |
representing,appeared |
R2492 |
T10522 |
T10521 |
cc |
but,perinuclear |
R2493 |
T10696 |
T10697 |
compound |
AQP2,F204V |
R2494 |
T10697 |
T10695 |
dobj |
F204V,representing |
R2495 |
T10698 |
T10697 |
punct |
-,F204V |
R2496 |
T10523 |
T10524 |
punct |
(,column |
R2497 |
T10699 |
T10700 |
dep |
that,progressed |
R2498 |
T10700 |
T10697 |
relcl |
progressed,F204V |
R2499 |
T10524 |
T10510 |
parataxis |
column,appeared |
R2500 |
T10701 |
T10700 |
aux |
had,progressed |
R2501 |
T10702 |
T10700 |
advmod |
potentially,progressed |
R2502 |
T10703 |
T10700 |
prep |
beyond,progressed |
R2503 |
T10525 |
T10524 |
dep |
Figure,column |
R2504 |
T10704 |
T10705 |
det |
the,ER |
R2505 |
T10705 |
T10703 |
pobj |
ER,beyond |
R2506 |
T10706 |
T10687 |
punct |
.,appeared |
R2507 |
T10526 |
T10525 |
nummod |
4B,Figure |
R2508 |
T10708 |
T10709 |
det |
This,escape |
R2509 |
T10709 |
T10712 |
nsubj |
escape,was |
R2510 |
T10527 |
T10524 |
punct |
", ",column |
R2511 |
T10710 |
T10709 |
punct |
“,escape |
R2512 |
T10711 |
T10709 |
compound |
ER,escape |
R2513 |
T10528 |
T10524 |
amod |
third,column |
R2514 |
T10713 |
T10709 |
punct |
”,escape |
R2515 |
T10714 |
T10712 |
acomp |
consistent,was |
R2516 |
T10715 |
T10714 |
prep |
with,consistent |
R2517 |
T10716 |
T10717 |
det |
the,proportion |
R2518 |
T10717 |
T10715 |
pobj |
proportion,with |
R2519 |
T10529 |
T10524 |
punct |
),column |
R2520 |
T10718 |
T10717 |
amod |
small,proportion |
R2521 |
T10530 |
T10510 |
punct |
.,appeared |
R2522 |
T10719 |
T10717 |
prep |
of,proportion |
R2523 |
T10720 |
T10721 |
amod |
mature,F204V |
R2524 |
T10721 |
T10719 |
pobj |
F204V,of |
R2525 |
T10532 |
T10533 |
prep |
Upon,translocated |
R2526 |
T10722 |
T10721 |
punct |
", ",F204V |
R2527 |
T10723 |
T10724 |
amod |
complex,glycosylated |
R2528 |
T10724 |
T10721 |
amod |
glycosylated,F204V |
R2529 |
T10725 |
T10721 |
punct |
", ",F204V |
R2530 |
T10534 |
T10532 |
pobj |
stimulation,Upon |
R2531 |
T10726 |
T10721 |
compound |
AQP2,F204V |
R2532 |
T10727 |
T10721 |
punct |
-,F204V |
R2533 |
T10728 |
T10717 |
prep |
in,proportion |
R2534 |
T10535 |
T10534 |
prep |
with,stimulation |
R2535 |
T10729 |
T10730 |
compound |
mutant,kidneys |
R2536 |
T10730 |
T10728 |
pobj |
kidneys,in |
R2537 |
T10731 |
T10732 |
punct |
(,see |
R2538 |
T10536 |
T10535 |
pobj |
forskolin,with |
R2539 |
T10732 |
T10712 |
parataxis |
see,was |
R254 |
T2464 |
T2465 |
amod |
Nephrogenic,insipidus |
R2540 |
T10733 |
T10732 |
dobj |
Figure,see |
R2541 |
T10537 |
T10533 |
punct |
", ",translocated |
R2542 |
T10734 |
T10733 |
nummod |
3A,Figure |
R2543 |
T10735 |
T10732 |
punct |
),see |
R2544 |
T10736 |
T10712 |
punct |
.,was |
R2545 |
T10538 |
T10539 |
det |
a,activator |
R2546 |
T10738 |
T10739 |
nsubjpass |
Animals,affected |
R2547 |
T10539 |
T10533 |
nsubj |
activator,translocated |
R2548 |
T10740 |
T10738 |
amod |
heterozygous,Animals |
R2549 |
T10741 |
T10740 |
prep |
for,heterozygous |
R255 |
T2465 |
T2467 |
nsubj |
insipidus,is |
R2550 |
T10742 |
T10743 |
det |
the,mutation |
R2551 |
T10540 |
T10541 |
npadvmod |
cAMP,dependent |
R2552 |
T10743 |
T10741 |
pobj |
mutation,for |
R2553 |
T10744 |
T10743 |
compound |
Aqp2F204V,mutation |
R2554 |
T10745 |
T10739 |
auxpass |
were,affected |
R2555 |
T10541 |
T10539 |
amod |
dependent,activator |
R2556 |
T10746 |
T10739 |
neg |
not,affected |
R2557 |
T10747 |
T10739 |
prep |
in,affected |
R2558 |
T10748 |
T10749 |
poss |
their,production |
R2559 |
T10542 |
T10541 |
punct |
-,dependent |
R256 |
T2466 |
T2465 |
compound |
diabetes,insipidus |
R2560 |
T10749 |
T10747 |
pobj |
production,in |
R2561 |
T10750 |
T10749 |
compound |
urine,production |
R2562 |
T10751 |
T10749 |
cc |
or,production |
R2563 |
T10543 |
T10544 |
compound |
protein,kinase |
R2564 |
T10752 |
T10753 |
compound |
urine,osmolality |
R2565 |
T10753 |
T10749 |
conj |
osmolality,production |
R2566 |
T10754 |
T10755 |
punct |
(,see |
R2567 |
T10755 |
T10739 |
parataxis |
see,affected |
R2568 |
T10756 |
T10757 |
nmod |
Figure,1C |
R2569 |
T10757 |
T10755 |
dobj |
1C,see |
R257 |
T2468 |
T2465 |
punct |
(,insipidus |
R2570 |
T10544 |
T10539 |
compound |
kinase,activator |
R2571 |
T10758 |
T10757 |
cc |
and,1C |
R2572 |
T10759 |
T10757 |
conj |
1D,1C |
R2573 |
T10760 |
T10755 |
punct |
),see |
R2574 |
T10545 |
T10539 |
punct |
", ",activator |
R2575 |
T10761 |
T10739 |
punct |
.,affected |
R2576 |
T10763 |
T10764 |
nsubjpass |
It,shown |
R2577 |
T10546 |
T10547 |
amod |
wild,type |
R2578 |
T10765 |
T10764 |
aux |
has,shown |
R2579 |
T10766 |
T10764 |
advmod |
also,shown |
R258 |
T2469 |
T2465 |
appos |
NDI,insipidus |
R2580 |
T10547 |
T10549 |
compound |
type,AQP2 |
R2581 |
T10767 |
T10764 |
auxpass |
been,shown |
R2582 |
T10768 |
T10769 |
mark |
that,interact |
R2583 |
T10769 |
T10764 |
ccomp |
interact,shown |
R2584 |
T10548 |
T10547 |
punct |
-,type |
R2585 |
T10770 |
T10771 |
det |
a,allele |
R2586 |
T10771 |
T10769 |
nsubj |
allele,interact |
R2587 |
T10772 |
T10771 |
amod |
recessive,allele |
R2588 |
T10549 |
T10539 |
appos |
AQP2,activator |
R2589 |
T10773 |
T10771 |
compound |
NDI,allele |
R259 |
T2470 |
T2467 |
punct |
),is |
R2590 |
T10774 |
T10771 |
punct |
", ",allele |
R2591 |
T10775 |
T10776 |
compound |
AQP2,R187C |
R2592 |
T10550 |
T10533 |
prep |
to,translocated |
R2593 |
T10776 |
T10771 |
appos |
R187C,allele |
R2594 |
T10777 |
T10776 |
punct |
-,R187C |
R2595 |
T10778 |
T10769 |
punct |
", ",interact |
R2596 |
T10551 |
T10552 |
det |
the,surface |
R2597 |
T10552 |
T10550 |
pobj |
surface,to |
R2598 |
T10553 |
T10552 |
amod |
apical,surface |
R2599 |
T10779 |
T10769 |
aux |
does,interact |
R260 |
T2471 |
T2472 |
det |
a,disease |
R2600 |
T10554 |
T10552 |
prep |
of,surface |
R2601 |
T10780 |
T10769 |
neg |
not,interact |
R2602 |
T10781 |
T10769 |
prep |
with,interact |
R2603 |
T10782 |
T10783 |
amod |
wild,type |
R2604 |
T10555 |
T10556 |
amod |
polarized,cells |
R2605 |
T10783 |
T10785 |
compound |
type,protein |
R2606 |
T10784 |
T10783 |
punct |
-,type |
R2607 |
T10556 |
T10554 |
pobj |
cells,of |
R2608 |
T10785 |
T10781 |
pobj |
protein,with |
R2609 |
T10786 |
T10769 |
prep |
in,interact |
R261 |
T2472 |
T2467 |
attr |
disease,is |
R2610 |
T10787 |
T10786 |
pobj |
oocytes,in |
R2611 |
T10557 |
T10556 |
compound |
MDCK,cells |
R2612 |
T10788 |
T10789 |
punct |
[,24 |
R2613 |
T10789 |
T10769 |
parataxis |
24,interact |
R2614 |
T10790 |
T10789 |
punct |
],24 |
R2615 |
T10558 |
T10559 |
punct |
(,column |
R2616 |
T10791 |
T10769 |
punct |
", ",interact |
R2617 |
T10792 |
T10769 |
cc |
nor,interact |
R2618 |
T10793 |
T10794 |
aux |
does,homo-oligomerize |
R2619 |
T10794 |
T10769 |
conj |
homo-oligomerize,interact |
R262 |
T2473 |
T2472 |
acl |
characterized,disease |
R2620 |
T10795 |
T10794 |
nsubj |
it,homo-oligomerize |
R2621 |
T10796 |
T10794 |
prep |
in,homo-oligomerize |
R2622 |
T10559 |
T10533 |
parataxis |
column,translocated |
R2623 |
T10797 |
T10798 |
compound |
MDCK,cells |
R2624 |
T10798 |
T10796 |
pobj |
cells,in |
R2625 |
T10799 |
T10800 |
punct |
[,22 |
R2626 |
T10560 |
T10559 |
dep |
Figure,column |
R2627 |
T10800 |
T10764 |
parataxis |
22,shown |
R2628 |
T10801 |
T10800 |
punct |
],22 |
R2629 |
T10802 |
T10764 |
punct |
.,shown |
R263 |
T2474 |
T2473 |
agent |
by,characterized |
R2630 |
T10561 |
T10560 |
nummod |
4B,Figure |
R2631 |
T10804 |
T10805 |
advmod |
Therefore,examined |
R2632 |
T10562 |
T10559 |
punct |
", ",column |
R2633 |
T10563 |
T10559 |
amod |
second,column |
R2634 |
T10806 |
T10805 |
punct |
", ",examined |
R2635 |
T10564 |
T10559 |
punct |
),column |
R2636 |
T10807 |
T10805 |
nsubjpass |
kidneys,examined |
R2637 |
T10808 |
T10807 |
prep |
from,kidneys |
R2638 |
T10565 |
T10533 |
punct |
.,translocated |
R2639 |
T10809 |
T10810 |
amod |
heterozygous,animals |
R264 |
T2475 |
T2476 |
amod |
excessive,urination |
R2640 |
T10810 |
T10808 |
pobj |
animals,from |
R2641 |
T10811 |
T10805 |
auxpass |
were,examined |
R2642 |
T10885 |
T10884 |
prep |
by,undetectable |
R2643 |
T10812 |
T10805 |
prep |
for,examined |
R2644 |
T10813 |
T10812 |
pobj |
evidence,for |
R2645 |
T10814 |
T10813 |
prep |
of,evidence |
R2646 |
T10815 |
T10816 |
nummod |
two,populations |
R2647 |
T10886 |
T10885 |
pobj |
immunocytochemistry,by |
R2648 |
T10816 |
T10814 |
pobj |
populations,of |
R2649 |
T10817 |
T10816 |
prep |
of,populations |
R265 |
T2476 |
T2474 |
pobj |
urination,by |
R2650 |
T10818 |
T10819 |
compound |
AQP2,protein |
R2651 |
T10887 |
T10868 |
punct |
.,reflect |
R2652 |
T10819 |
T10817 |
pobj |
protein,of |
R2653 |
T10820 |
T10805 |
punct |
.,examined |
R2654 |
T10889 |
T10890 |
advmod |
Alternatively,alter |
R2655 |
T10822 |
T10823 |
advmod |
Surprisingly,revealed |
R2656 |
T10824 |
T10823 |
punct |
", ",revealed |
R2657 |
T10891 |
T10890 |
punct |
", ",alter |
R2658 |
T10825 |
T10826 |
amod |
immunohistochemical,staining |
R2659 |
T10826 |
T10823 |
nsubj |
staining,revealed |
R266 |
T2477 |
T2476 |
cc |
and,urination |
R2660 |
T10827 |
T10826 |
prep |
of,staining |
R2661 |
T10828 |
T10829 |
nmod |
kidney,ducts |
R2662 |
T10892 |
T10893 |
det |
the,presence |
R2663 |
T10829 |
T10827 |
pobj |
ducts,of |
R2664 |
T10830 |
T10829 |
amod |
collecting,ducts |
R2665 |
T10831 |
T10829 |
prep |
from,ducts |
R2666 |
T10893 |
T10890 |
nsubj |
presence,alter |
R2667 |
T10832 |
T10833 |
nmod |
Aqp2F204V,mice |
R2668 |
T10833 |
T10831 |
pobj |
mice,from |
R2669 |
T10834 |
T10832 |
punct |
/,Aqp2F204V |
R267 |
T2478 |
T2476 |
conj |
thirst,urination |
R2670 |
T10835 |
T10832 |
punct |
+,Aqp2F204V |
R2671 |
T10836 |
T10837 |
det |
a,pattern |
R2672 |
T10837 |
T10823 |
dobj |
pattern,revealed |
R2673 |
T10894 |
T10893 |
prep |
of,presence |
R2674 |
T10838 |
T10839 |
advmod |
remarkably,similar |
R2675 |
T10839 |
T10837 |
amod |
similar,pattern |
R2676 |
T10840 |
T10839 |
prep |
to,similar |
R2677 |
T10895 |
T10896 |
amod |
wild,type |
R2678 |
T10841 |
T10842 |
amod |
wild,type |
R2679 |
T10842 |
T10840 |
pobj |
type,to |
R268 |
T2479 |
T2473 |
punct |
", ",characterized |
R2680 |
T10843 |
T10844 |
punct |
(,Figure |
R2681 |
T10844 |
T10823 |
parataxis |
Figure,revealed |
R2682 |
T10845 |
T10844 |
nummod |
5A,Figure |
R2683 |
T10846 |
T10844 |
punct |
),Figure |
R2684 |
T10847 |
T10823 |
punct |
.,revealed |
R2685 |
T10896 |
T10898 |
compound |
type,protein |
R2686 |
T10849 |
T10850 |
nsubj |
AQP2,translocated |
R2687 |
T10897 |
T10896 |
punct |
-,type |
R2688 |
T10851 |
T10850 |
advmod |
completely,translocated |
R2689 |
T10852 |
T10850 |
prep |
to,translocated |
R269 |
T2480 |
T2473 |
prep |
despite,characterized |
R2690 |
T10898 |
T10894 |
pobj |
protein,of |
R2691 |
T10853 |
T10854 |
det |
the,surface |
R2692 |
T10854 |
T10852 |
pobj |
surface,to |
R2693 |
T10855 |
T10854 |
amod |
apical,surface |
R2694 |
T10856 |
T10854 |
compound |
cell,surface |
R2695 |
T10899 |
T10890 |
aux |
may,alter |
R2696 |
T10857 |
T10850 |
prep |
upon,translocated |
R2697 |
T10858 |
T10859 |
compound |
dDAVP,stimulation |
R2698 |
T10859 |
T10857 |
pobj |
stimulation,upon |
R2699 |
T10900 |
T10901 |
det |
the,localization |
R270 |
T2481 |
T2482 |
amod |
normal,production |
R2700 |
T10860 |
T10850 |
punct |
.,translocated |
R2701 |
T10901 |
T10890 |
dobj |
localization,alter |
R2702 |
T10862 |
T10863 |
det |
This,pattern |
R2703 |
T10863 |
T10868 |
nsubj |
pattern,reflect |
R2704 |
T10864 |
T10865 |
amod |
wild,type |
R2705 |
T10902 |
T10901 |
prep |
of,localization |
R2706 |
T10865 |
T10863 |
compound |
type,pattern |
R2707 |
T10866 |
T10865 |
punct |
-,type |
R2708 |
T10867 |
T10863 |
compound |
staining,pattern |
R2709 |
T10903 |
T10904 |
det |
the,protein |
R271 |
T2482 |
T2480 |
pobj |
production,despite |
R2710 |
T10869 |
T10868 |
aux |
may,reflect |
R2711 |
T10904 |
T10902 |
pobj |
protein,of |
R2712 |
T10870 |
T10868 |
advmod |
simply,reflect |
R2713 |
T10871 |
T10872 |
det |
the,fact |
R2714 |
T10872 |
T10868 |
dobj |
fact,reflect |
R2715 |
T10873 |
T10874 |
mark |
that,makes |
R2716 |
T10905 |
T10904 |
compound |
mutant,protein |
R2717 |
T10874 |
T10872 |
acl |
makes,fact |
R2718 |
T10875 |
T10874 |
csubj |
decreasing,makes |
R2719 |
T10876 |
T10877 |
det |
the,amount |
R272 |
T2483 |
T2482 |
prep |
of,production |
R2720 |
T10906 |
T10890 |
punct |
.,alter |
R2721 |
T10877 |
T10875 |
dobj |
amount,decreasing |
R2722 |
T10878 |
T10877 |
prep |
of,amount |
R2723 |
T10879 |
T10880 |
compound |
mutant,protein |
R2724 |
T10880 |
T10878 |
pobj |
protein,of |
R2725 |
T10881 |
T10875 |
prep |
by,decreasing |
R2726 |
T10882 |
T10881 |
pobj |
half,by |
R2727 |
T10908 |
T10909 |
advmod |
Indeed,proposed |
R2728 |
T10883 |
T10884 |
nsubj |
it,undetectable |
R2729 |
T10884 |
T10874 |
ccomp |
undetectable,makes |
R273 |
T2484 |
T2485 |
det |
the,hormone |
R2730 |
T10910 |
T10909 |
punct |
", ",proposed |
R2731 |
T10911 |
T10909 |
nsubj |
Hendriks,proposed |
R2732 |
T10912 |
T10913 |
advmod |
et,al. |
R2733 |
T10913 |
T10911 |
advmod |
al.,Hendriks |
R2734 |
T10991 |
T10980 |
nsubj |
type,rescue |
R2735 |
T10914 |
T10915 |
det |
a,mechanism |
R2736 |
T10992 |
T10991 |
amod |
wild,type |
R2737 |
T10915 |
T10909 |
dobj |
mechanism,proposed |
R2738 |
T10993 |
T10980 |
aux |
may,rescue |
R2739 |
T10994 |
T10995 |
det |
the,protein |
R274 |
T2485 |
T2483 |
pobj |
hormone,of |
R2740 |
T10916 |
T10915 |
punct |
“,mechanism |
R2741 |
T10995 |
T10980 |
dobj |
protein,rescue |
R2742 |
T10996 |
T10995 |
compound |
mutant,protein |
R2743 |
T10997 |
T10998 |
mark |
as,suggested |
R2744 |
T10917 |
T10918 |
nmod |
piggy,back |
R2745 |
T10998 |
T10980 |
advcl |
suggested,rescue |
R2746 |
T10999 |
T10998 |
agent |
by,suggested |
R2747 |
T10918 |
T10915 |
nmod |
back,mechanism |
R2748 |
T11000 |
T11001 |
det |
the,distribution |
R2749 |
T11001 |
T10999 |
pobj |
distribution,by |
R275 |
T2486 |
T2485 |
amod |
antidiuretic,hormone |
R2750 |
T11002 |
T11001 |
amod |
subcellular,distribution |
R2751 |
T11003 |
T11001 |
prep |
of,distribution |
R2752 |
T10919 |
T10918 |
punct |
-,back |
R2753 |
T11004 |
T11005 |
compound |
AQP2,protein |
R2754 |
T11005 |
T11003 |
pobj |
protein,of |
R2755 |
T10920 |
T10915 |
punct |
”,mechanism |
R2756 |
T11006 |
T10980 |
punct |
.,rescue |
R2757 |
T11008 |
T11009 |
aux |
To,test |
R2758 |
T10921 |
T10922 |
aux |
to,explain |
R2759 |
T11009 |
T11010 |
advcl |
test,looked |
R276 |
T2487 |
T2488 |
compound |
arginine,vasopressin |
R2760 |
T10922 |
T10909 |
advcl |
explain,proposed |
R2761 |
T11011 |
T11012 |
det |
this,idea |
R2762 |
T11012 |
T11009 |
dobj |
idea,test |
R2763 |
T11013 |
T11010 |
punct |
", ",looked |
R2764 |
T11014 |
T11010 |
nsubj |
we,looked |
R2765 |
T10923 |
T10924 |
det |
the,transport |
R2766 |
T11015 |
T11010 |
advmod |
first,looked |
R2767 |
T11016 |
T11010 |
prep |
for,looked |
R2768 |
T10924 |
T10922 |
dobj |
transport,explain |
R2769 |
T11017 |
T11018 |
det |
an,interaction |
R277 |
T2488 |
T2485 |
appos |
vasopressin,hormone |
R2770 |
T11018 |
T11016 |
pobj |
interaction,for |
R2771 |
T11019 |
T11018 |
prep |
between,interaction |
R2772 |
T10925 |
T10924 |
prep |
of,transport |
R2773 |
T11020 |
T11021 |
nmod |
mutant,proteins |
R2774 |
T11021 |
T11019 |
pobj |
proteins,between |
R2775 |
T11022 |
T11020 |
cc |
and,mutant |
R2776 |
T11023 |
T11024 |
amod |
wild,type |
R2777 |
T11024 |
T11020 |
conj |
type,mutant |
R2778 |
T10926 |
T10927 |
amod |
nonglycosylated,subunits |
R2779 |
T11025 |
T11024 |
punct |
-,type |
R278 |
T2489 |
T2488 |
punct |
(,vasopressin |
R2780 |
T11026 |
T11010 |
prep |
in,looked |
R2781 |
T11027 |
T11028 |
amod |
transfected,cells |
R2782 |
T10927 |
T10925 |
pobj |
subunits,of |
R2783 |
T11028 |
T11026 |
pobj |
cells,in |
R2784 |
T11029 |
T11028 |
compound |
MDCK,cells |
R2785 |
T11030 |
T11031 |
punct |
(,Figure |
R2786 |
T10928 |
T10927 |
prep |
of,subunits |
R2787 |
T11031 |
T11010 |
parataxis |
Figure,looked |
R2788 |
T11032 |
T11031 |
nummod |
5B,Figure |
R2789 |
T11033 |
T11031 |
punct |
),Figure |
R279 |
T2490 |
T2488 |
appos |
AVP,vasopressin |
R2790 |
T11034 |
T11010 |
punct |
.,looked |
R2791 |
T10929 |
T10928 |
pobj |
AQP2,of |
R2792 |
T11036 |
T11037 |
compound |
MDCK,cells |
R2793 |
T10930 |
T10924 |
prep |
to,transport |
R2794 |
T11037 |
T11038 |
nsubjpass |
cells,transfected |
R2795 |
T11039 |
T11040 |
advmod |
stably,expressing |
R2796 |
T10931 |
T10932 |
det |
the,surface |
R2797 |
T11040 |
T11037 |
acl |
expressing,cells |
R2798 |
T11041 |
T11042 |
amod |
wild,type |
R2799 |
T10932 |
T10930 |
pobj |
surface,to |
R280 |
T2491 |
T2467 |
punct |
),is |
R2800 |
T11042 |
T11044 |
compound |
type,AQP2 |
R2801 |
T11043 |
T11042 |
punct |
-,type |
R2802 |
T11044 |
T11040 |
dobj |
AQP2,expressing |
R2803 |
T10933 |
T10932 |
compound |
cell,surface |
R2804 |
T11045 |
T11038 |
auxpass |
were,transfected |
R2805 |
T11046 |
T11038 |
advmod |
transiently,transfected |
R2806 |
T11047 |
T11038 |
prep |
with,transfected |
R2807 |
T10934 |
T10924 |
prep |
by,transport |
R2808 |
T11048 |
T11049 |
compound |
GFP,constructs |
R2809 |
T11049 |
T11047 |
pobj |
constructs,with |
R281 |
T2492 |
T2493 |
punct |
[,1 |
R2810 |
T11050 |
T11049 |
compound |
expression,constructs |
R2811 |
T10935 |
T10936 |
amod |
glycosylated,subunits |
R2812 |
T11051 |
T11049 |
acl |
encoding,constructs |
R2813 |
T11052 |
T11053 |
npadvmod |
GFP,tagged |
R2814 |
T10936 |
T10934 |
pobj |
subunits,by |
R2815 |
T11053 |
T11055 |
amod |
tagged,AQP2 |
R2816 |
T11054 |
T11053 |
punct |
-,tagged |
R2817 |
T11055 |
T11051 |
dobj |
AQP2,encoding |
R2818 |
T10937 |
T10938 |
punct |
[,22 |
R2819 |
T11056 |
T11057 |
amod |
wild,type |
R282 |
T2493 |
T2467 |
parataxis |
1,is |
R2820 |
T11057 |
T11055 |
compound |
type,AQP2 |
R2821 |
T11058 |
T11057 |
punct |
-,type |
R2822 |
T10938 |
T10922 |
parataxis |
22,explain |
R2823 |
T11059 |
T11055 |
punct |
", ",AQP2 |
R2824 |
T11060 |
T11061 |
compound |
AQP2,F204V |
R2825 |
T11061 |
T11055 |
conj |
F204V,AQP2 |
R2826 |
T11062 |
T11061 |
punct |
-,F204V |
R2827 |
T11063 |
T11061 |
punct |
", ",F204V |
R2828 |
T11064 |
T11061 |
cc |
or,F204V |
R2829 |
T10939 |
T10938 |
punct |
],22 |
R283 |
T2494 |
T2493 |
punct |
],1 |
R2830 |
T11065 |
T11061 |
conj |
GFP,F204V |
R2831 |
T11066 |
T11065 |
advmod |
alone,GFP |
R2832 |
T10940 |
T10909 |
punct |
.,proposed |
R2833 |
T10942 |
T10943 |
nsubjpass |
It,shown |
R2834 |
T11067 |
T11038 |
punct |
.,transfected |
R2835 |
T10944 |
T10943 |
aux |
has,shown |
R2836 |
T11069 |
T11070 |
nsubj |
Antibodies,coimmunoprecipitated |
R2837 |
T11071 |
T11069 |
prep |
against,Antibodies |
R2838 |
T11072 |
T11071 |
pobj |
GFP,against |
R2839 |
T10945 |
T10943 |
advmod |
also,shown |
R284 |
T2495 |
T2467 |
punct |
.,is |
R2840 |
T11073 |
T11074 |
amod |
wild,type |
R2841 |
T11074 |
T11076 |
compound |
type,AQP2 |
R2842 |
T10946 |
T10943 |
auxpass |
been,shown |
R2843 |
T11075 |
T11074 |
punct |
-,type |
R2844 |
T11076 |
T11070 |
dobj |
AQP2,coimmunoprecipitated |
R2845 |
T11077 |
T11078 |
advmod |
when,transfected |
R2846 |
T10947 |
T10948 |
mark |
that,rescue |
R2847 |
T11078 |
T11070 |
advcl |
transfected,coimmunoprecipitated |
R2848 |
T11079 |
T11080 |
compound |
AQP2,GFP |
R2849 |
T10948 |
T10943 |
ccomp |
rescue,shown |
R285 |
T2497 |
T2498 |
det |
The,forms |
R2850 |
T11080 |
T11078 |
nsubjpass |
GFP,transfected |
R2851 |
T11081 |
T11080 |
punct |
-,GFP |
R2852 |
T11082 |
T11080 |
cc |
or,GFP |
R2853 |
T10949 |
T10950 |
amod |
wild,type |
R2854 |
T11083 |
T11084 |
compound |
AQP2,GFP |
R2855 |
T11084 |
T11080 |
conj |
GFP,GFP |
R2856 |
T11085 |
T11084 |
punct |
-,GFP |
R2857 |
T10950 |
T10952 |
compound |
type,protein |
R2858 |
T11086 |
T11084 |
compound |
F204V,GFP |
R2859 |
T11087 |
T11084 |
punct |
-,GFP |
R286 |
T2498 |
T2500 |
nsubj |
forms,are |
R2860 |
T10951 |
T10950 |
punct |
-,type |
R2861 |
T11088 |
T11078 |
auxpass |
was,transfected |
R2862 |
T11089 |
T11078 |
advmod |
transiently,transfected |
R2863 |
T11090 |
T11078 |
punct |
", ",transfected |
R2864 |
T10952 |
T10948 |
nsubj |
protein,rescue |
R2865 |
T11091 |
T11078 |
cc |
but,transfected |
R2866 |
T11092 |
T11091 |
neg |
not,but |
R2867 |
T11093 |
T11094 |
advmod |
when,transfected |
R2868 |
T10953 |
T10952 |
compound |
AQP2,protein |
R2869 |
T11094 |
T11078 |
conj |
transfected,transfected |
R287 |
T2499 |
T2498 |
amod |
inherited,forms |
R2870 |
T11095 |
T11094 |
nsubjpass |
GFP,transfected |
R2871 |
T10954 |
T10948 |
aux |
can,rescue |
R2872 |
T11096 |
T11095 |
prep |
by,GFP |
R2873 |
T10955 |
T10956 |
det |
a,protein |
R2874 |
T10956 |
T10948 |
dobj |
protein,rescue |
R2875 |
T10957 |
T10958 |
npadvmod |
translocation,defective |
R2876 |
T11097 |
T11096 |
pobj |
itself,by |
R2877 |
T11098 |
T11094 |
auxpass |
was,transfected |
R2878 |
T11099 |
T11094 |
advmod |
transiently,transfected |
R2879 |
T11100 |
T11094 |
prep |
into,transfected |
R288 |
T2501 |
T2502 |
advmod |
either,linked |
R2880 |
T11101 |
T11102 |
compound |
MDCK,cells |
R2881 |
T10958 |
T10956 |
amod |
defective,protein |
R2882 |
T11102 |
T11100 |
pobj |
cells,into |
R2883 |
T11103 |
T11104 |
advmod |
stably,expressing |
R2884 |
T11104 |
T11102 |
acl |
expressing,cells |
R2885 |
T10959 |
T10958 |
punct |
-,defective |
R2886 |
T11105 |
T11106 |
amod |
wild,type |
R2887 |
T11106 |
T11108 |
compound |
type,AQP2 |
R2888 |
T11107 |
T11106 |
punct |
-,type |
R2889 |
T10960 |
T10956 |
compound |
mutant,protein |
R289 |
T2502 |
T2500 |
acomp |
linked,are |
R2890 |
T11108 |
T11104 |
dobj |
AQP2,expressing |
R2891 |
T11109 |
T11110 |
punct |
(,blots |
R2892 |
T10961 |
T10956 |
punct |
", ",protein |
R2893 |
T11110 |
T11070 |
parataxis |
blots,coimmunoprecipitated |
R2894 |
T11111 |
T11110 |
dep |
Figure,blots |
R2895 |
T11112 |
T11111 |
nummod |
5B,Figure |
R2896 |
T10962 |
T10963 |
compound |
AQP2,P262L |
R2897 |
T11113 |
T11110 |
punct |
", ",blots |
R2898 |
T11114 |
T11110 |
amod |
upper,blots |
R2899 |
T11115 |
T11110 |
punct |
),blots |
R290 |
T2503 |
T2502 |
npadvmod |
X,linked |
R2900 |
T10963 |
T10956 |
appos |
P262L,protein |
R2901 |
T11116 |
T11070 |
punct |
.,coimmunoprecipitated |
R2902 |
T10964 |
T10963 |
punct |
-,P262L |
R2903 |
T11118 |
T11119 |
compound |
Western,blot |
R2904 |
T11119 |
T11120 |
nsubj |
blot,showed |
R2905 |
T10965 |
T10948 |
punct |
", ",rescue |
R2906 |
T11121 |
T11119 |
prep |
of,blot |
R2907 |
T11122 |
T11123 |
amod |
total,membranes |
R2908 |
T11123 |
T11121 |
pobj |
membranes,of |
R2909 |
T10966 |
T10967 |
advmod |
when,coexpressed |
R291 |
T2504 |
T2502 |
punct |
-,linked |
R2910 |
T11124 |
T11125 |
mark |
that,expressed |
R2911 |
T11125 |
T11120 |
ccomp |
expressed,showed |
R2912 |
T11126 |
T11127 |
amod |
wild,type |
R2913 |
T10967 |
T10948 |
advcl |
coexpressed,rescue |
R2914 |
T11127 |
T11129 |
compound |
type,AQP2 |
R2915 |
T11128 |
T11127 |
punct |
-,type |
R2916 |
T11129 |
T11125 |
nsubjpass |
AQP2,expressed |
R2917 |
T10968 |
T10969 |
det |
the,two |
R2918 |
T11130 |
T11125 |
auxpass |
is,expressed |
R2919 |
T11131 |
T11125 |
advmod |
equivalently,expressed |
R292 |
T2505 |
T2502 |
prep |
as,linked |
R2920 |
T10969 |
T10967 |
nsubjpass |
two,coexpressed |
R2921 |
T11132 |
T11125 |
prep |
in,expressed |
R2922 |
T11133 |
T11134 |
det |
all,cases |
R2923 |
T11134 |
T11132 |
pobj |
cases,in |
R2924 |
T11135 |
T11134 |
nummod |
three,cases |
R2925 |
T10970 |
T10967 |
auxpass |
are,coexpressed |
R2926 |
T11136 |
T11137 |
punct |
(,blots |
R2927 |
T11137 |
T11120 |
parataxis |
blots,showed |
R2928 |
T11138 |
T11137 |
dep |
Figure,blots |
R2929 |
T11139 |
T11138 |
nummod |
5B,Figure |
R293 |
T2506 |
T2507 |
det |
a,consequence |
R2930 |
T11140 |
T11137 |
punct |
", ",blots |
R2931 |
T11141 |
T11137 |
amod |
lower,blots |
R2932 |
T10971 |
T10967 |
prep |
in,coexpressed |
R2933 |
T11142 |
T11137 |
punct |
),blots |
R2934 |
T11143 |
T11120 |
punct |
.,showed |
R2935 |
T11145 |
T11146 |
mark |
If,interacting |
R2936 |
T10972 |
T10973 |
compound |
MDCK,cells |
R2937 |
T10973 |
T10971 |
pobj |
cells,in |
R2938 |
T11146 |
T11155 |
advcl |
interacting,is |
R2939 |
T10974 |
T10975 |
punct |
[,25 |
R294 |
T2507 |
T2505 |
pobj |
consequence,as |
R2940 |
T11147 |
T11148 |
amod |
wild,type |
R2941 |
T11148 |
T11150 |
nmod |
type,proteins |
R2942 |
T11149 |
T11148 |
punct |
-,type |
R2943 |
T11150 |
T11146 |
nsubj |
proteins,interacting |
R2944 |
T10975 |
T10943 |
parataxis |
25,shown |
R2945 |
T11151 |
T11148 |
cc |
and,type |
R2946 |
T11152 |
T11148 |
conj |
mutant,type |
R2947 |
T11153 |
T11146 |
aux |
are,interacting |
R2948 |
T10976 |
T10975 |
punct |
],25 |
R2949 |
T11154 |
T11146 |
advmod |
indeed,interacting |
R295 |
T2508 |
T2507 |
prep |
of,consequence |
R2950 |
T11156 |
T11146 |
prep |
in,interacting |
R2951 |
T10977 |
T10943 |
punct |
.,shown |
R2952 |
T11157 |
T11158 |
det |
the,cell |
R2953 |
T11158 |
T11156 |
pobj |
cell,in |
R2954 |
T11159 |
T11155 |
punct |
", ",is |
R2955 |
T10979 |
T10980 |
prep |
In,rescue |
R2956 |
T11160 |
T11161 |
det |
this,interaction |
R2957 |
T11161 |
T11155 |
nsubj |
interaction,is |
R2958 |
T11162 |
T11155 |
acomp |
sufficient,is |
R2959 |
T11163 |
T11164 |
aux |
to,rescue |
R296 |
T2509 |
T2508 |
pobj |
mutation,of |
R2960 |
T10981 |
T10982 |
det |
the,ducts |
R2961 |
T11164 |
T11162 |
xcomp |
rescue,sufficient |
R2962 |
T11165 |
T11166 |
det |
the,localization |
R2963 |
T11166 |
T11164 |
dobj |
localization,rescue |
R2964 |
T10982 |
T10979 |
pobj |
ducts,In |
R2965 |
T11167 |
T11166 |
prep |
of,localization |
R2966 |
T11168 |
T11169 |
compound |
mutant,protein |
R2967 |
T11169 |
T11167 |
pobj |
protein,of |
R2968 |
T11170 |
T11155 |
punct |
?,is |
R2969 |
T10983 |
T10982 |
amod |
collecting,ducts |
R297 |
T2510 |
T2509 |
prep |
of,mutation |
R2970 |
T11172 |
T11173 |
aux |
To,answer |
R2971 |
T11173 |
T11174 |
advcl |
answer,used |
R2972 |
T10984 |
T10982 |
prep |
from,ducts |
R2973 |
T11175 |
T11176 |
det |
this,question |
R2974 |
T11176 |
T11173 |
dobj |
question,answer |
R2975 |
T10985 |
T10986 |
nmod |
Aqp2F204V,mice |
R2976 |
T11177 |
T11174 |
punct |
", ",used |
R2977 |
T11178 |
T11174 |
nsubj |
we,used |
R2978 |
T10986 |
T10984 |
pobj |
mice,from |
R2979 |
T11179 |
T11180 |
compound |
MDCK,cells |
R298 |
T2511 |
T2512 |
det |
the,gene |
R2980 |
T11180 |
T11174 |
dobj |
cells,used |
R2981 |
T11181 |
T11182 |
advmod |
stably,transfected |
R2982 |
T11182 |
T11180 |
acl |
transfected,cells |
R2983 |
T11183 |
T11182 |
prep |
with,transfected |
R2984 |
T11184 |
T11185 |
amod |
wild,type |
R2985 |
T10987 |
T10985 |
punct |
/,Aqp2F204V |
R2986 |
T11185 |
T11187 |
compound |
type,AQP2 |
R2987 |
T11186 |
T11185 |
punct |
-,type |
R2988 |
T11187 |
T11183 |
pobj |
AQP2,with |
R2989 |
T10988 |
T10985 |
punct |
+,Aqp2F204V |
R299 |
T2512 |
T2510 |
pobj |
gene,of |
R2990 |
T11188 |
T11187 |
acl |
expressing,AQP2 |
R2991 |
T11189 |
T11188 |
dobj |
vector,expressing |
R2992 |
T11190 |
T11188 |
cc |
or,expressing |
R2993 |
T10989 |
T10980 |
punct |
", ",rescue |
R2994 |
T11191 |
T11188 |
conj |
with,expressing |
R2995 |
T11192 |
T11193 |
amod |
empty,vector |
R2996 |
T11193 |
T11191 |
pobj |
vector,with |
R2997 |
T10990 |
T10991 |
det |
the,type |
R2998 |
T11194 |
T11174 |
punct |
.,used |
R2999 |
T11196 |
T11197 |
prep |
On,transfected |
R300 |
T2513 |
T2512 |
compound |
Avpr2,gene |
R3000 |
T11203 |
T11197 |
advmod |
transiently,transfected |
R3001 |
T11198 |
T11196 |
pobj |
top,On |
R3002 |
T11199 |
T11198 |
prep |
of,top |
R3003 |
T11200 |
T11199 |
pobj |
these,of |
R3004 |
T11201 |
T11197 |
punct |
", ",transfected |
R3005 |
T11204 |
T11205 |
nmod |
AQP2,GFP |
R3006 |
T11202 |
T11197 |
nsubj |
we,transfected |
R3007 |
T11205 |
T11207 |
nmod |
GFP,constructs |
R3008 |
T11206 |
T11205 |
punct |
-,GFP |
R3009 |
T11207 |
T11197 |
dobj |
constructs,transfected |
R301 |
T2514 |
T2515 |
punct |
[,2 |
R3010 |
T11208 |
T11205 |
cc |
or,GFP |
R3011 |
T11308 |
T11306 |
compound |
F204V,GFP |
R3012 |
T11309 |
T11306 |
punct |
-,GFP |
R3013 |
T11209 |
T11210 |
compound |
AQP2,GFP |
R3014 |
T11310 |
T11295 |
prep |
to,localized |
R3015 |
T11311 |
T11312 |
det |
the,surface |
R3016 |
T11312 |
T11310 |
pobj |
surface,to |
R3017 |
T11210 |
T11205 |
conj |
GFP,GFP |
R3018 |
T11313 |
T11312 |
amod |
apical,surface |
R3019 |
T11314 |
T11295 |
prep |
to,localized |
R302 |
T2515 |
T2502 |
parataxis |
2,linked |
R3020 |
T11211 |
T11210 |
punct |
-,GFP |
R3021 |
T11315 |
T11316 |
amod |
varying,degrees |
R3022 |
T11316 |
T11314 |
pobj |
degrees,to |
R3023 |
T11317 |
T11318 |
punct |
(,images |
R3024 |
T11212 |
T11210 |
compound |
F204V,GFP |
R3025 |
T11318 |
T11295 |
parataxis |
images,localized |
R3026 |
T11319 |
T11318 |
dep |
Figure,images |
R3027 |
T11320 |
T11319 |
nummod |
5C,Figure |
R3028 |
T11213 |
T11210 |
punct |
-,GFP |
R3029 |
T11321 |
T11318 |
punct |
", ",images |
R303 |
T2516 |
T2515 |
punct |
],2 |
R3030 |
T11322 |
T11318 |
amod |
lower,images |
R3031 |
T11214 |
T11207 |
compound |
expression,constructs |
R3032 |
T11323 |
T11318 |
amod |
right,images |
R3033 |
T11324 |
T11325 |
punct |
[,i |
R3034 |
T11325 |
T11318 |
parataxis |
i,images |
R3035 |
T11215 |
T11197 |
punct |
.,transfected |
R3036 |
T11326 |
T11327 |
punct |
–,iii |
R3037 |
T11327 |
T11325 |
prep |
iii,i |
R3038 |
T11217 |
T11218 |
compound |
AQP2,GFP |
R3039 |
T11328 |
T11325 |
punct |
],i |
R304 |
T2517 |
T2502 |
punct |
", ",linked |
R3040 |
T11329 |
T11318 |
punct |
),images |
R3041 |
T11330 |
T11295 |
punct |
.,localized |
R3042 |
T11218 |
T11220 |
nsubj |
GFP,localized |
R3043 |
T11332 |
T11333 |
det |
The,images |
R3044 |
T11333 |
T11336 |
nsubj |
images,shows |
R3045 |
T11219 |
T11218 |
punct |
-,GFP |
R3046 |
T11334 |
T11335 |
amod |
lower,right |
R3047 |
T11335 |
T11333 |
amod |
right,images |
R3048 |
T11221 |
T11220 |
prep |
to,localized |
R3049 |
T11337 |
T11333 |
prep |
of,images |
R305 |
T2518 |
T2502 |
cc |
or,linked |
R3050 |
T11338 |
T11337 |
pobj |
Figure,of |
R3051 |
T11339 |
T11338 |
nummod |
5C,Figure |
R3052 |
T11222 |
T11223 |
det |
the,surface |
R3053 |
T11340 |
T11341 |
nummod |
three,cells |
R3054 |
T11341 |
T11336 |
dobj |
cells,shows |
R3055 |
T11342 |
T11341 |
prep |
from,cells |
R3056 |
T11223 |
T11221 |
pobj |
surface,to |
R3057 |
T11343 |
T11344 |
det |
a,transfection |
R3058 |
T11344 |
T11342 |
pobj |
transfection,from |
R3059 |
T11345 |
T11344 |
amod |
single,transfection |
R306 |
T2519 |
T2502 |
conj |
autosomal,linked |
R3060 |
T11224 |
T11223 |
amod |
apical,surface |
R3061 |
T11346 |
T11336 |
punct |
.,shows |
R3062 |
T11348 |
T11349 |
det |
The,first |
R3063 |
T11225 |
T11220 |
prep |
upon,localized |
R3064 |
T11349 |
T11350 |
nsubj |
first,is |
R3065 |
T11226 |
T11227 |
compound |
forskolin,stimulation |
R3066 |
T11351 |
T11352 |
det |
a,cell |
R3067 |
T11352 |
T11350 |
attr |
cell,is |
R3068 |
T11353 |
T11352 |
amod |
nontransfected,cell |
R3069 |
T11227 |
T11225 |
pobj |
stimulation,upon |
R307 |
T2520 |
T2521 |
amod |
due,to |
R3070 |
T11354 |
T11355 |
dep |
that,shows |
R3071 |
T11355 |
T11352 |
relcl |
shows,cell |
R3072 |
T11356 |
T11357 |
det |
the,localization |
R3073 |
T11228 |
T11229 |
mark |
whether,transfected |
R3074 |
T11357 |
T11355 |
dobj |
localization,shows |
R3075 |
T11358 |
T11357 |
prep |
of,localization |
R3076 |
T11359 |
T11360 |
det |
the,AQP2 |
R3077 |
T11229 |
T11220 |
advcl |
transfected,localized |
R3078 |
T11360 |
T11358 |
pobj |
AQP2,of |
R3079 |
T11230 |
T11229 |
nsubjpass |
it,transfected |
R308 |
T2521 |
T2519 |
prep |
to,autosomal |
R3080 |
T11361 |
T11362 |
advmod |
stably,expressing |
R3081 |
T11231 |
T11229 |
auxpass |
was,transfected |
R3082 |
T11362 |
T11360 |
amod |
expressing,AQP2 |
R3083 |
T11363 |
T11364 |
amod |
wild,type |
R3084 |
T11232 |
T11229 |
advmod |
transiently,transfected |
R3085 |
T11364 |
T11360 |
compound |
type,AQP2 |
R3086 |
T11365 |
T11364 |
punct |
-,type |
R3087 |
T11366 |
T11360 |
punct |
", ",AQP2 |
R3088 |
T11367 |
T11368 |
dep |
which,is |
R3089 |
T11368 |
T11360 |
relcl |
is,AQP2 |
R309 |
T2522 |
T2521 |
pobj |
mutation,to |
R3090 |
T11233 |
T11229 |
prep |
into,transfected |
R3091 |
T11369 |
T11368 |
acomp |
apical,is |
R3092 |
T11370 |
T11368 |
prep |
upon,is |
R3093 |
T11371 |
T11372 |
compound |
forskolin,stimulation |
R3094 |
T11234 |
T11235 |
npadvmod |
vector,only |
R3095 |
T11372 |
T11370 |
pobj |
stimulation,upon |
R3096 |
T11373 |
T11350 |
punct |
.,is |
R3097 |
T11235 |
T11237 |
amod |
only,cells |
R3098 |
T11375 |
T11376 |
det |
The,two |
R3099 |
T11376 |
T11378 |
nsubj |
two,show |
R310 |
T2523 |
T2522 |
prep |
of,mutation |
R3100 |
T11377 |
T11376 |
amod |
next,two |
R3101 |
T11236 |
T11235 |
punct |
-,only |
R3102 |
T11379 |
T11378 |
dobj |
expression,show |
R3103 |
T11380 |
T11379 |
prep |
of,expression |
R3104 |
T11237 |
T11233 |
pobj |
cells,into |
R3105 |
T11381 |
T11382 |
preconj |
both,AQP2 |
R3106 |
T11382 |
T11380 |
pobj |
AQP2,of |
R3107 |
T11238 |
T11239 |
punct |
(,images |
R3108 |
T11383 |
T11382 |
det |
the,AQP2 |
R3109 |
T11384 |
T11382 |
amod |
stable,AQP2 |
R311 |
T2524 |
T2525 |
det |
the,gene |
R3110 |
T11385 |
T11386 |
amod |
wild,type |
R3111 |
T11239 |
T11237 |
parataxis |
images,cells |
R3112 |
T11386 |
T11382 |
compound |
type,AQP2 |
R3113 |
T11387 |
T11386 |
punct |
-,type |
R3114 |
T11388 |
T11382 |
cc |
and,AQP2 |
R3115 |
T11240 |
T11239 |
dep |
Figure,images |
R3116 |
T11389 |
T11390 |
det |
the,GFP |
R3117 |
T11390 |
T11382 |
conj |
GFP,AQP2 |
R3118 |
T11391 |
T11390 |
amod |
transient,GFP |
R3119 |
T11241 |
T11240 |
nummod |
5C,Figure |
R312 |
T2525 |
T2523 |
pobj |
gene,of |
R3120 |
T11392 |
T11390 |
compound |
AQP2,GFP |
R3121 |
T11393 |
T11390 |
punct |
-,GFP |
R3122 |
T11394 |
T11390 |
compound |
F204V,GFP |
R3123 |
T11242 |
T11239 |
punct |
", ",images |
R3124 |
T11395 |
T11390 |
punct |
-,GFP |
R3125 |
T11396 |
T11378 |
punct |
.,show |
R3126 |
T11243 |
T11239 |
amod |
upper,images |
R3127 |
T11398 |
T11399 |
prep |
In,was |
R3128 |
T11399 |
T11411 |
ccomp |
was,were |
R3129 |
T11244 |
T11239 |
amod |
left,images |
R313 |
T2526 |
T2525 |
compound |
Aqp2,gene |
R3130 |
T11400 |
T11398 |
pobj |
cell,In |
R3131 |
T11401 |
T11400 |
punct |
(,cell |
R3132 |
T11402 |
T11400 |
nummod |
ii,cell |
R3133 |
T11403 |
T11400 |
punct |
),cell |
R3134 |
T11245 |
T11239 |
punct |
),images |
R3135 |
T11404 |
T11399 |
punct |
", ",was |
R3136 |
T11405 |
T11399 |
nsubj |
localization,was |
R3137 |
T11406 |
T11405 |
prep |
of,localization |
R3138 |
T11407 |
T11408 |
amod |
wild,type |
R3139 |
T11408 |
T11410 |
compound |
type,AQP2 |
R314 |
T2527 |
T2528 |
punct |
[,3 |
R3140 |
T11409 |
T11408 |
punct |
-,type |
R3141 |
T11246 |
T11233 |
cc |
or,into |
R3142 |
T11410 |
T11406 |
pobj |
AQP2,of |
R3143 |
T11412 |
T11399 |
acomp |
indistinguishable,was |
R3144 |
T11247 |
T11233 |
conj |
into,into |
R3145 |
T11248 |
T11249 |
amod |
wild,type |
R3146 |
T11249 |
T11251 |
compound |
type,cells |
R3147 |
T11413 |
T11412 |
prep |
from,indistinguishable |
R3148 |
T11414 |
T11415 |
compound |
AQP2,GFP |
R3149 |
T11250 |
T11249 |
punct |
-,type |
R315 |
T2528 |
T2519 |
parataxis |
3,autosomal |
R3150 |
T11251 |
T11247 |
pobj |
cells,into |
R3151 |
T11415 |
T11413 |
pobj |
GFP,from |
R3152 |
T11416 |
T11415 |
punct |
-,GFP |
R3153 |
T11252 |
T11251 |
compound |
AQP2,cells |
R3154 |
T11417 |
T11415 |
compound |
F204V,GFP |
R3155 |
T11418 |
T11415 |
punct |
-,GFP |
R3156 |
T11419 |
T11411 |
punct |
;,were |
R3157 |
T11253 |
T11254 |
punct |
(,Figure |
R3158 |
T11420 |
T11411 |
nsubj |
both,were |
R3159 |
T11421 |
T11411 |
acomp |
apical,were |
R316 |
T2529 |
T2528 |
punct |
],3 |
R3160 |
T11254 |
T11251 |
parataxis |
Figure,cells |
R3161 |
T11422 |
T11411 |
prep |
upon,were |
R3162 |
T11423 |
T11424 |
compound |
forskolin,stimulation |
R3163 |
T11255 |
T11254 |
nummod |
5C,Figure |
R3164 |
T11424 |
T11422 |
pobj |
stimulation,upon |
R3165 |
T11425 |
T11411 |
punct |
.,were |
R3166 |
T11256 |
T11254 |
punct |
", ",Figure |
R3167 |
T11427 |
T11428 |
mark |
Although,was |
R3168 |
T11428 |
T11431 |
advcl |
was,localized |
R3169 |
T11257 |
T11258 |
amod |
upper,right |
R317 |
T2530 |
T2500 |
punct |
.,are |
R3170 |
T11429 |
T11430 |
det |
the,effect |
R3171 |
T11430 |
T11428 |
nsubj |
effect,was |
R3172 |
T11258 |
T11254 |
amod |
right,Figure |
R3173 |
T11432 |
T11428 |
acomp |
subtle,was |
R3174 |
T11433 |
T11428 |
prep |
in,was |
R3175 |
T11259 |
T11254 |
punct |
),Figure |
R3176 |
T11434 |
T11433 |
pobj |
cell,in |
R3177 |
T11435 |
T11434 |
punct |
(,cell |
R3178 |
T11436 |
T11434 |
nummod |
iii,cell |
R3179 |
T11260 |
T11220 |
punct |
.,localized |
R318 |
T2532 |
T2533 |
nsubj |
Aquaporin,is |
R3180 |
T11437 |
T11434 |
punct |
),cell |
R3181 |
T11438 |
T11431 |
punct |
", ",localized |
R3182 |
T11439 |
T11440 |
compound |
AQP2,GFP |
R3183 |
T11262 |
T11263 |
compound |
AQP2,GFP |
R3184 |
T11440 |
T11431 |
nsubjpass |
GFP,localized |
R3185 |
T11441 |
T11440 |
punct |
-,GFP |
R3186 |
T11442 |
T11440 |
compound |
F204V,GFP |
R3187 |
T11443 |
T11440 |
punct |
-,GFP |
R3188 |
T11444 |
T11431 |
auxpass |
was,localized |
R3189 |
T11445 |
T11431 |
advmod |
partly,localized |
R319 |
T2534 |
T2532 |
punct |
-,Aquaporin |
R3190 |
T11446 |
T11431 |
prep |
to,localized |
R3191 |
T11263 |
T11267 |
nsubj |
GFP,showed |
R3192 |
T11447 |
T11448 |
det |
the,surface |
R3193 |
T11448 |
T11446 |
pobj |
surface,to |
R3194 |
T11449 |
T11448 |
amod |
apical,surface |
R3195 |
T11264 |
T11263 |
punct |
-,GFP |
R3196 |
T11450 |
T11431 |
punct |
.,localized |
R3197 |
T11452 |
T11453 |
advmod |
Generally,was |
R3198 |
T11265 |
T11263 |
compound |
F204V,GFP |
R3199 |
T11454 |
T11453 |
punct |
", ",was |
R320 |
T2535 |
T2532 |
nummod |
2,Aquaporin |
R3200 |
T11266 |
T11263 |
punct |
-,GFP |
R3201 |
T11455 |
T11456 |
det |
the,localization |
R3202 |
T11456 |
T11453 |
nsubj |
localization,was |
R3203 |
T11457 |
T11456 |
prep |
of,localization |
R3204 |
T11268 |
T11267 |
punct |
", ",showed |
R3205 |
T11458 |
T11459 |
compound |
AQP2,GFP |
R3206 |
T11459 |
T11457 |
pobj |
GFP,of |
R3207 |
T11460 |
T11459 |
punct |
-,GFP |
R3208 |
T11461 |
T11459 |
compound |
F204V,GFP |
R3209 |
T11269 |
T11270 |
advmod |
when,expressed |
R321 |
T2536 |
T2532 |
punct |
(,Aquaporin |
R3210 |
T11462 |
T11459 |
punct |
-,GFP |
R3211 |
T11463 |
T11453 |
advmod |
clearly,was |
R3212 |
T11464 |
T11465 |
advmod |
more,apical |
R3213 |
T11270 |
T11267 |
advcl |
expressed,showed |
R3214 |
T11465 |
T11453 |
acomp |
apical,was |
R3215 |
T11466 |
T11467 |
advmod |
when,expressed |
R3216 |
T11467 |
T11453 |
advcl |
expressed,was |
R3217 |
T11271 |
T11270 |
prep |
by,expressed |
R3218 |
T11468 |
T11469 |
amod |
wild,type |
R3219 |
T11469 |
T11471 |
compound |
type,AQP2 |
R322 |
T2537 |
T2532 |
appos |
AQP2,Aquaporin |
R3220 |
T11470 |
T11469 |
punct |
-,type |
R3221 |
T11272 |
T11273 |
amod |
transient,transfection |
R3222 |
T11471 |
T11467 |
nsubjpass |
AQP2,expressed |
R3223 |
T11472 |
T11467 |
auxpass |
was,expressed |
R3224 |
T11473 |
T11467 |
advmod |
also,expressed |
R3225 |
T11273 |
T11271 |
pobj |
transfection,by |
R3226 |
T11474 |
T11453 |
punct |
.,was |
R3227 |
T11274 |
T11270 |
prep |
into,expressed |
R3228 |
T11476 |
T11477 |
aux |
To,confirm |
R3229 |
T11477 |
T11478 |
advcl |
confirm,transfected |
R323 |
T2538 |
T2533 |
punct |
),is |
R3230 |
T11275 |
T11276 |
npadvmod |
vector,only |
R3231 |
T11479 |
T11480 |
det |
these,results |
R3232 |
T11480 |
T11477 |
dobj |
results,confirm |
R3233 |
T11276 |
T11277 |
amod |
only,cells |
R3234 |
T11481 |
T11477 |
advmod |
biochemically,confirm |
R3235 |
T11482 |
T11478 |
punct |
", ",transfected |
R3236 |
T11483 |
T11478 |
nsubj |
we,transfected |
R3237 |
T11277 |
T11274 |
pobj |
cells,into |
R3238 |
T11484 |
T11485 |
det |
the,lines |
R3239 |
T11485 |
T11478 |
dobj |
lines,transfected |
R324 |
T2539 |
T2540 |
det |
a,protein |
R3240 |
T11486 |
T11485 |
amod |
same,lines |
R3241 |
T11487 |
T11485 |
compound |
cell,lines |
R3242 |
T11488 |
T11485 |
punct |
(,lines |
R3243 |
T11278 |
T11267 |
punct |
", ",showed |
R3244 |
T11489 |
T11490 |
amod |
wild,type |
R3245 |
T11490 |
T11492 |
compound |
type,AQP2 |
R3246 |
T11491 |
T11490 |
punct |
-,type |
R3247 |
T11279 |
T11280 |
det |
a,pattern |
R3248 |
T11492 |
T11485 |
appos |
AQP2,lines |
R3249 |
T11493 |
T11492 |
cc |
or,AQP2 |
R325 |
T2540 |
T2533 |
attr |
protein,is |
R3250 |
T11494 |
T11492 |
conj |
vector,AQP2 |
R3251 |
T11280 |
T11267 |
dobj |
pattern,showed |
R3252 |
T11495 |
T11485 |
punct |
),lines |
R3253 |
T11496 |
T11478 |
prep |
with,transfected |
R3254 |
T11497 |
T11498 |
compound |
F204V,GFP |
R3255 |
T11281 |
T11280 |
amod |
diffuse,pattern |
R3256 |
T11498 |
T11496 |
pobj |
GFP,with |
R3257 |
T11499 |
T11498 |
punct |
-,GFP |
R3258 |
T11500 |
T11478 |
punct |
", ",transfected |
R3259 |
T11282 |
T11280 |
amod |
cytoplasmic,pattern |
R326 |
T2541 |
T2542 |
npadvmod |
pore,forming |
R3260 |
T11501 |
T11478 |
conj |
biotinylated,transfected |
R3261 |
T11283 |
T11280 |
compound |
distribution,pattern |
R3262 |
T11502 |
T11503 |
compound |
surface,proteins |
R3263 |
T11284 |
T11285 |
punct |
(,left |
R3264 |
T11503 |
T11501 |
dobj |
proteins,biotinylated |
R3265 |
T11504 |
T11501 |
prep |
after,biotinylated |
R3266 |
T11505 |
T11506 |
compound |
forskolin,stimulation |
R3267 |
T11285 |
T11267 |
parataxis |
left,showed |
R3268 |
T11506 |
T11504 |
pobj |
stimulation,after |
R3269 |
T11507 |
T11501 |
punct |
", ",biotinylated |
R327 |
T2542 |
T2540 |
amod |
forming,protein |
R3270 |
T11286 |
T11285 |
dep |
Figure,left |
R3271 |
T11508 |
T11501 |
cc |
and,biotinylated |
R3272 |
T11509 |
T11501 |
conj |
precipitated,biotinylated |
R3273 |
T11510 |
T11511 |
det |
the,proteins |
R3274 |
T11287 |
T11286 |
nummod |
5C,Figure |
R3275 |
T11511 |
T11509 |
dobj |
proteins,precipitated |
R3276 |
T11512 |
T11511 |
amod |
biotinylated,proteins |
R3277 |
T11288 |
T11285 |
punct |
", ",left |
R3278 |
T11513 |
T11514 |
punct |
(,Figure |
R3279 |
T11514 |
T11509 |
parataxis |
Figure,precipitated |
R328 |
T2543 |
T2542 |
punct |
-,forming |
R3280 |
T11515 |
T11514 |
nummod |
5D,Figure |
R3281 |
T11289 |
T11285 |
amod |
lower,left |
R3282 |
T11516 |
T11514 |
punct |
),Figure |
R3283 |
T11517 |
T11478 |
punct |
.,transfected |
R3284 |
T11290 |
T11285 |
punct |
),left |
R3285 |
T11291 |
T11267 |
punct |
.,showed |
R3286 |
T11293 |
T11294 |
advmod |
When,expressed |
R3287 |
T11519 |
T11520 |
compound |
AQP2,GFP |
R3288 |
T11520 |
T11524 |
nsubjpass |
GFP,expressed |
R3289 |
T11294 |
T11295 |
advcl |
expressed,localized |
R329 |
T2544 |
T2540 |
acl |
belonging,protein |
R3290 |
T11521 |
T11520 |
punct |
-,GFP |
R3291 |
T11522 |
T11520 |
compound |
F204V,GFP |
R3292 |
T11523 |
T11520 |
punct |
-,GFP |
R3293 |
T11525 |
T11524 |
auxpass |
is,expressed |
R3294 |
T11296 |
T11294 |
prep |
in,expressed |
R3295 |
T11526 |
T11527 |
advmod |
approximately,equally |
R3296 |
T11527 |
T11524 |
advmod |
equally,expressed |
R3297 |
T11528 |
T11524 |
prep |
in,expressed |
R3298 |
T11529 |
T11530 |
det |
both,lines |
R3299 |
T11530 |
T11528 |
pobj |
lines,in |
R330 |
T2545 |
T2544 |
prep |
to,belonging |
R3300 |
T11297 |
T11298 |
amod |
wild,type |
R3301 |
T11531 |
T11530 |
compound |
cell,lines |
R3302 |
T11532 |
T11533 |
punct |
(,cells |
R3303 |
T11533 |
T11524 |
parataxis |
cells,expressed |
R3304 |
T11298 |
T11300 |
compound |
type,cells |
R3305 |
T11534 |
T11533 |
dep |
Figure,cells |
R3306 |
T11535 |
T11534 |
nummod |
5D,Figure |
R3307 |
T11536 |
T11533 |
punct |
", ",cells |
R3308 |
T11299 |
T11298 |
punct |
-,type |
R3309 |
T11537 |
T11533 |
amod |
total,cells |
R331 |
T2546 |
T2547 |
det |
a,family |
R3310 |
T11538 |
T11533 |
punct |
),cells |
R3311 |
T11300 |
T11296 |
pobj |
cells,in |
R3312 |
T11539 |
T11524 |
punct |
", ",expressed |
R3313 |
T11540 |
T11524 |
cc |
but,expressed |
R3314 |
T11541 |
T11542 |
auxpass |
is,biotinylated |
R3315 |
T11301 |
T11300 |
compound |
AQP2,cells |
R3316 |
T11542 |
T11524 |
conj |
biotinylated,expressed |
R3317 |
T11543 |
T11544 |
advmod |
only,expressed |
R3318 |
T11544 |
T11542 |
ccomp |
expressed,biotinylated |
R3319 |
T11302 |
T11295 |
punct |
", ",localized |
R332 |
T2547 |
T2545 |
pobj |
family,to |
R3320 |
T11545 |
T11544 |
advmod |
when,expressed |
R3321 |
T11546 |
T11547 |
amod |
wild,type |
R3322 |
T11547 |
T11549 |
compound |
type,AQP2 |
R3323 |
T11303 |
T11295 |
advmod |
however,localized |
R3324 |
T11548 |
T11547 |
punct |
-,type |
R3325 |
T11549 |
T11544 |
nsubjpass |
AQP2,expressed |
R3326 |
T11550 |
T11544 |
auxpass |
is,expressed |
R3327 |
T11304 |
T11295 |
punct |
", ",localized |
R3328 |
T11551 |
T11544 |
advmod |
also,expressed |
R3329 |
T11552 |
T11553 |
punct |
(,Figure |
R333 |
T2548 |
T2547 |
prep |
of,family |
R3330 |
T11553 |
T11542 |
parataxis |
Figure,biotinylated |
R3331 |
T11305 |
T11306 |
compound |
AQP2,GFP |
R3332 |
T11554 |
T11553 |
nummod |
5D,Figure |
R3333 |
T11555 |
T11553 |
punct |
", ",Figure |
R3334 |
T11556 |
T11557 |
npadvmod |
surface,biotinylated |
R3335 |
T11306 |
T11295 |
nsubj |
GFP,localized |
R3336 |
T11557 |
T11553 |
amod |
biotinylated,Figure |
R3337 |
T11558 |
T11553 |
punct |
),Figure |
R3338 |
T11559 |
T11524 |
punct |
.,expressed |
R3339 |
T11307 |
T11306 |
punct |
-,GFP |
R334 |
T2549 |
T2550 |
compound |
water,channels |
R3340 |
T11561 |
T11562 |
mark |
Since,are |
R3341 |
T11562 |
T11567 |
advcl |
are,indicate |
R3342 |
T11563 |
T11564 |
advmod |
only,proteins |
R3343 |
T11564 |
T11562 |
nsubj |
proteins,are |
R3344 |
T11565 |
T11566 |
compound |
cell,surface |
R3345 |
T11566 |
T11564 |
compound |
surface,proteins |
R3346 |
T11568 |
T11562 |
acomp |
accessible,are |
R3347 |
T11569 |
T11568 |
prep |
to,accessible |
R3348 |
T11570 |
T11569 |
pobj |
biotin,to |
R3349 |
T11571 |
T11567 |
punct |
", ",indicate |
R335 |
T2550 |
T2548 |
pobj |
channels,of |
R3350 |
T11572 |
T11573 |
det |
these,results |
R3351 |
T11573 |
T11567 |
nsubj |
results,indicate |
R3352 |
T11574 |
T11575 |
mark |
that,transported |
R3353 |
T11575 |
T11567 |
ccomp |
transported,indicate |
R3354 |
T11576 |
T11577 |
compound |
AQP2,F204V |
R3355 |
T11577 |
T11575 |
nsubjpass |
F204V,transported |
R3356 |
T11578 |
T11577 |
punct |
-,F204V |
R3357 |
T11579 |
T11575 |
auxpass |
is,transported |
R3358 |
T11580 |
T11575 |
prep |
to,transported |
R3359 |
T11581 |
T11582 |
det |
the,surface |
R336 |
T2551 |
T2552 |
punct |
[,4 |
R3360 |
T11582 |
T11580 |
pobj |
surface,to |
R3361 |
T11583 |
T11582 |
compound |
cell,surface |
R3362 |
T11584 |
T11585 |
advmod |
when,is |
R3363 |
T11585 |
T11575 |
advcl |
is,transported |
R3364 |
T11586 |
T11587 |
amod |
wild,type |
R3365 |
T11587 |
T11589 |
compound |
type,AQP2 |
R3366 |
T11588 |
T11587 |
punct |
-,type |
R3367 |
T11589 |
T11585 |
nsubj |
AQP2,is |
R3368 |
T11590 |
T11585 |
acomp |
present,is |
R3369 |
T11591 |
T11585 |
punct |
", ",is |
R337 |
T2552 |
T2533 |
parataxis |
4,is |
R3370 |
T11592 |
T11585 |
cc |
but,is |
R3371 |
T11593 |
T11592 |
neg |
not,but |
R3372 |
T11594 |
T11585 |
conj |
on,is |
R3373 |
T11595 |
T11596 |
poss |
its,own |
R3374 |
T11596 |
T11594 |
pobj |
own,on |
R3375 |
T11597 |
T11567 |
punct |
.,indicate |
R3378 |
T14172 |
T14173 |
compound |
Aqp2F204,F204V |
R3379 |
T14173 |
T14175 |
compound |
F204V,mice |
R338 |
T2553 |
T2552 |
punct |
],4 |
R3380 |
T14174 |
T14173 |
punct |
/,F204V |
R3381 |
T14175 |
T14176 |
nsubj |
mice,are |
R3382 |
T14177 |
T14176 |
acomp |
viable,are |
R3383 |
T14178 |
T14176 |
cc |
and,are |
R3384 |
T14179 |
T14176 |
conj |
grow,are |
R3385 |
T14180 |
T14179 |
cc |
and,grow |
R3386 |
T14181 |
T14179 |
conj |
reproduce,grow |
R3387 |
T14182 |
T14181 |
advmod |
normally,reproduce |
R3388 |
T14183 |
T14176 |
punct |
.,are |
R3389 |
T14185 |
T14186 |
nsubj |
They,are |
R339 |
T2554 |
T2533 |
punct |
", ",is |
R3390 |
T14187 |
T14186 |
punct |
", ",are |
R3391 |
T14188 |
T14186 |
advmod |
however,are |
R3392 |
T14189 |
T14186 |
punct |
", ",are |
R3393 |
T14190 |
T14191 |
advmod |
severely,defective |
R3394 |
T14191 |
T14186 |
acomp |
defective,are |
R3395 |
T14192 |
T14191 |
prep |
in,defective |
R3396 |
T14193 |
T14194 |
poss |
their,ability |
R3397 |
T14194 |
T14192 |
pobj |
ability,in |
R3398 |
T14195 |
T14196 |
aux |
to,concentrate |
R3399 |
T14196 |
T14194 |
acl |
concentrate,ability |
R340 |
T2555 |
T2533 |
cc |
and,is |
R3400 |
T14197 |
T14196 |
dobj |
urine,concentrate |
R3401 |
T14198 |
T14186 |
punct |
", ",are |
R3402 |
T14199 |
T14186 |
advcl |
leading,are |
R3403 |
T14200 |
T14199 |
prep |
to,leading |
R3404 |
T14201 |
T14202 |
amod |
increased,output |
R3405 |
T14202 |
T14200 |
pobj |
output,to |
R3406 |
T14203 |
T14202 |
compound |
urine,output |
R3407 |
T14204 |
T14202 |
cc |
and,output |
R3408 |
T14205 |
T14206 |
compound |
water,intake |
R3409 |
T14206 |
T14202 |
conj |
intake,output |
R341 |
T2556 |
T2557 |
nsubjpass |
it,expressed |
R3410 |
T14207 |
T14186 |
punct |
", ",are |
R3411 |
T14208 |
T14209 |
advmod |
thus,making |
R3412 |
T14209 |
T14186 |
advcl |
making,are |
R3413 |
T14210 |
T14211 |
nsubj |
them,model |
R3414 |
T14211 |
T14209 |
ccomp |
model,making |
R3415 |
T14212 |
T14211 |
det |
the,model |
R3416 |
T14213 |
T14211 |
amod |
first,model |
R3417 |
T14214 |
T14211 |
compound |
mouse,model |
R3418 |
T14215 |
T14211 |
prep |
of,model |
R3419 |
T14216 |
T14215 |
pobj |
NDI,of |
R342 |
T2557 |
T2533 |
conj |
expressed,is |
R3420 |
T14217 |
T14218 |
aux |
to,survive |
R3421 |
T14218 |
T14211 |
advcl |
survive,model |
R3422 |
T14219 |
T14218 |
prep |
to,survive |
R3423 |
T14220 |
T14219 |
pobj |
maturity,to |
R3424 |
T14221 |
T14186 |
punct |
.,are |
R3425 |
T14223 |
T14224 |
prep |
In,caused |
R3426 |
T14225 |
T14223 |
pobj |
humans,In |
R3427 |
T14226 |
T14224 |
punct |
", ",caused |
R3428 |
T14227 |
T14224 |
nsubjpass |
NDI,caused |
R3429 |
T14228 |
T14224 |
auxpass |
is,caused |
R343 |
T2558 |
T2557 |
auxpass |
is,expressed |
R3430 |
T14229 |
T14224 |
agent |
by,caused |
R3431 |
T14230 |
T14229 |
pobj |
mutations,by |
R3432 |
T14231 |
T14230 |
prep |
in,mutations |
R3433 |
T14232 |
T14231 |
pobj |
Avpr2,in |
R3434 |
T14233 |
T14232 |
cc |
or,Avpr2 |
R3435 |
T14234 |
T14232 |
conj |
Aqp2,Avpr2 |
R3436 |
T14235 |
T14224 |
punct |
.,caused |
R3437 |
T14237 |
T14238 |
nsubj |
Knockout,gave |
R3438 |
T14239 |
T14237 |
prep |
of,Knockout |
R3439 |
T14240 |
T14241 |
det |
the,gene |
R344 |
T2559 |
T2557 |
prep |
in,expressed |
R3440 |
T14241 |
T14239 |
pobj |
gene,of |
R3441 |
T14242 |
T14243 |
npadvmod |
X,linked |
R3442 |
T14243 |
T14241 |
amod |
linked,gene |
R3443 |
T14244 |
T14243 |
punct |
-,linked |
R3444 |
T14245 |
T14241 |
compound |
Avpr2,gene |
R3445 |
T14246 |
T14237 |
prep |
in,Knockout |
R3446 |
T14247 |
T14246 |
pobj |
mice,in |
R3447 |
T14248 |
T14249 |
punct |
[,15 |
R3448 |
T14249 |
T14237 |
parataxis |
15,Knockout |
R3449 |
T14250 |
T14249 |
punct |
],15 |
R345 |
T2560 |
T2561 |
amod |
collecting,duct |
R3450 |
T14251 |
T14252 |
det |
an,phenotype |
R3451 |
T14252 |
T14238 |
dobj |
phenotype,gave |
R3452 |
T14253 |
T14254 |
npadvmod |
NDI,like |
R3453 |
T14254 |
T14252 |
amod |
like,phenotype |
R3454 |
T14255 |
T14254 |
punct |
-,like |
R3455 |
T14256 |
T14238 |
prep |
in,gave |
R3456 |
T14257 |
T14258 |
amod |
male,neonates |
R3457 |
T14258 |
T14256 |
pobj |
neonates,in |
R3458 |
T14259 |
T14258 |
punct |
", ",neonates |
R3459 |
T14260 |
T14258 |
amod |
hemizygous,neonates |
R346 |
T2561 |
T2563 |
nmod |
duct,cells |
R3460 |
T14261 |
T14238 |
punct |
", ",gave |
R3461 |
T14262 |
T14238 |
cc |
but,gave |
R3462 |
T14263 |
T14264 |
det |
the,phenotype |
R3463 |
T14264 |
T14265 |
nsubjpass |
phenotype,assessed |
R3464 |
T14265 |
T14238 |
conj |
assessed,gave |
R3465 |
T14266 |
T14265 |
aux |
could,assessed |
R3466 |
T14267 |
T14265 |
neg |
not,assessed |
R3467 |
T14268 |
T14265 |
auxpass |
be,assessed |
R3468 |
T14269 |
T14265 |
prep |
in,assessed |
R3469 |
T14270 |
T14269 |
pobj |
adults,in |
R347 |
T2562 |
T2561 |
punct |
-,duct |
R3470 |
T14271 |
T14272 |
mark |
as,died |
R3471 |
T14272 |
T14265 |
advcl |
died,assessed |
R3472 |
T14273 |
T14274 |
det |
the,mice |
R3473 |
T14274 |
T14272 |
nsubj |
mice,died |
R3474 |
T14275 |
T14272 |
prep |
within,died |
R3475 |
T14276 |
T14277 |
nummod |
1,wk |
R3476 |
T14277 |
T14275 |
pobj |
wk,within |
R3477 |
T14278 |
T14277 |
prep |
of,wk |
R3478 |
T14279 |
T14278 |
pobj |
birth,of |
R3479 |
T14280 |
T14265 |
punct |
.,assessed |
R348 |
T2563 |
T2559 |
pobj |
cells,in |
R3480 |
T14282 |
T14283 |
det |
The,females |
R3481 |
T14283 |
T14286 |
nsubj |
females,showed |
R3482 |
T14284 |
T14283 |
amod |
adult,females |
R3483 |
T14285 |
T14283 |
amod |
heterozygous,females |
R3484 |
T14287 |
T14288 |
det |
a,tendency |
R3485 |
T14288 |
T14286 |
dobj |
tendency,showed |
R3486 |
T14289 |
T14288 |
amod |
mild,tendency |
R3487 |
T14290 |
T14288 |
prep |
toward,tendency |
R3488 |
T14291 |
T14292 |
amod |
increased,output |
R3489 |
T14292 |
T14290 |
pobj |
output,toward |
R349 |
T2564 |
T2563 |
amod |
principal,cells |
R3490 |
T14293 |
T14292 |
amod |
urinary,output |
R3491 |
T14294 |
T14292 |
cc |
and,output |
R3492 |
T14295 |
T14296 |
compound |
water,intake |
R3493 |
T14296 |
T14292 |
conj |
intake,output |
R3494 |
T14297 |
T14292 |
cc |
and,output |
R3495 |
T14298 |
T14299 |
amod |
decreased,osmolality |
R3496 |
T14299 |
T14292 |
conj |
osmolality,output |
R3497 |
T14300 |
T14299 |
compound |
urine,osmolality |
R3498 |
T14301 |
T14286 |
punct |
.,showed |
R3499 |
T14303 |
T14304 |
nsubjpass |
Knockout,reported |
R350 |
T2565 |
T2557 |
prep |
in,expressed |
R3500 |
T14305 |
T14303 |
prep |
of,Knockout |
R3501 |
T14306 |
T14307 |
det |
the,gene |
R3502 |
T14307 |
T14305 |
pobj |
gene,of |
R3503 |
T14308 |
T14307 |
compound |
mouse,gene |
R3504 |
T14309 |
T14307 |
compound |
Aqp2,gene |
R3505 |
T14310 |
T14304 |
aux |
has,reported |
R3506 |
T14311 |
T14304 |
neg |
not,reported |
R3507 |
T14312 |
T14304 |
auxpass |
been,reported |
R3508 |
T14313 |
T14304 |
punct |
.,reported |
R3509 |
T14315 |
T14316 |
det |
A,in |
R351 |
T2566 |
T2567 |
det |
the,kidney |
R3510 |
T14316 |
T14319 |
nsubjpass |
in,made |
R3511 |
T14317 |
T14316 |
compound |
knock,in |
R3512 |
T14318 |
T14316 |
punct |
-,in |
R3513 |
T14320 |
T14316 |
prep |
of,in |
R3514 |
T14321 |
T14322 |
det |
a,mutation |
R3515 |
T14322 |
T14320 |
pobj |
mutation,of |
R3516 |
T14323 |
T14322 |
amod |
human,mutation |
R3517 |
T14324 |
T14325 |
npadvmod |
disease,causing |
R3518 |
T14325 |
T14322 |
amod |
causing,mutation |
R3519 |
T14326 |
T14325 |
punct |
-,causing |
R352 |
T2567 |
T2565 |
pobj |
kidney,in |
R3520 |
T14327 |
T14322 |
punct |
(,mutation |
R3521 |
T14328 |
T14322 |
appos |
T126M,mutation |
R3522 |
T14329 |
T14322 |
punct |
),mutation |
R3523 |
T14330 |
T14319 |
punct |
", ",made |
R3524 |
T14331 |
T14319 |
advmod |
however,made |
R3525 |
T14332 |
T14319 |
punct |
", ",made |
R3526 |
T14333 |
T14319 |
aux |
has,made |
R3527 |
T14334 |
T14319 |
auxpass |
been,made |
R3528 |
T14335 |
T14336 |
punct |
[,18 |
R3529 |
T14336 |
T14319 |
parataxis |
18,made |
R353 |
T2568 |
T2569 |
punct |
[,5 |
R3530 |
T14337 |
T14336 |
punct |
],18 |
R3531 |
T14338 |
T14319 |
punct |
.,made |
R3532 |
T14340 |
T14341 |
det |
These,mice |
R3533 |
T14341 |
T14342 |
nsubj |
mice,have |
R3534 |
T14343 |
T14344 |
det |
a,defect |
R3535 |
T14344 |
T14342 |
dobj |
defect,have |
R3536 |
T14345 |
T14344 |
amod |
severe,defect |
R3537 |
T14346 |
T14347 |
npadvmod |
urine,concentrating |
R3538 |
T14347 |
T14344 |
amod |
concentrating,defect |
R3539 |
T14348 |
T14347 |
punct |
-,concentrating |
R354 |
T2569 |
T2557 |
parataxis |
5,expressed |
R3540 |
T14349 |
T14344 |
acl |
resulting,defect |
R3541 |
T14350 |
T14349 |
prep |
in,resulting |
R3542 |
T14351 |
T14350 |
pobj |
dehydration,in |
R3543 |
T14352 |
T14351 |
cc |
and,dehydration |
R3544 |
T14353 |
T14351 |
conj |
death,dehydration |
R3545 |
T14354 |
T14349 |
prep |
within,resulting |
R3546 |
T14355 |
T14356 |
nummod |
1,wk |
R3547 |
T14356 |
T14354 |
pobj |
wk,within |
R3548 |
T14357 |
T14356 |
prep |
of,wk |
R3549 |
T14358 |
T14357 |
pobj |
birth,of |
R355 |
T2570 |
T2569 |
punct |
],5 |
R3550 |
T14359 |
T14342 |
punct |
.,have |
R3551 |
T14361 |
T14362 |
advmod |
Curiously,localize |
R3552 |
T14363 |
T14362 |
punct |
", ",localize |
R3553 |
T14364 |
T14365 |
compound |
AQP2,T126M |
R3554 |
T14365 |
T14362 |
nsubj |
T126M,localize |
R3555 |
T14366 |
T14365 |
punct |
-,T126M |
R3556 |
T14367 |
T14362 |
aux |
does,localize |
R3557 |
T14368 |
T14362 |
advmod |
properly,localize |
R3558 |
T14369 |
T14362 |
prep |
in,localize |
R3559 |
T14370 |
T14371 |
advmod |
at,least |
R356 |
T2571 |
T2557 |
punct |
.,expressed |
R3560 |
T14371 |
T14372 |
advmod |
least,subset |
R3561 |
T14372 |
T14369 |
pobj |
subset,in |
R3562 |
T14373 |
T14372 |
det |
a,subset |
R3563 |
T14374 |
T14372 |
prep |
of,subset |
R3564 |
T14375 |
T14374 |
pobj |
cells,of |
R3565 |
T14376 |
T14362 |
punct |
.,localize |
R3566 |
T14378 |
T14379 |
det |
The,morphology |
R3567 |
T14379 |
T14384 |
nsubj |
morphology,makes |
R3568 |
T14380 |
T14381 |
advmod |
grossly,abnormal |
R3569 |
T14381 |
T14379 |
amod |
abnormal,morphology |
R357 |
T2573 |
T2574 |
advmod |
Generally,permit |
R3570 |
T14382 |
T14383 |
amod |
collecting,duct |
R3571 |
T14383 |
T14379 |
compound |
duct,morphology |
R3572 |
T14385 |
T14386 |
nsubj |
it,impossible |
R3573 |
T14386 |
T14384 |
ccomp |
impossible,makes |
R3574 |
T14387 |
T14388 |
aux |
to,pinpoint |
R3575 |
T14388 |
T14386 |
advcl |
pinpoint,impossible |
R3576 |
T14389 |
T14390 |
det |
the,defect |
R3577 |
T14390 |
T14388 |
dobj |
defect,pinpoint |
R3578 |
T14391 |
T14390 |
amod |
molecular,defect |
R3579 |
T14392 |
T14388 |
prep |
in,pinpoint |
R358 |
T2575 |
T2576 |
det |
these,proteins |
R3580 |
T14393 |
T14394 |
det |
these,mice |
R3581 |
T14394 |
T14392 |
pobj |
mice,in |
R3582 |
T14395 |
T14394 |
amod |
knock,mice |
R3583 |
T14396 |
T14395 |
punct |
-,knock |
R3584 |
T14397 |
T14395 |
prt |
in,knock |
R3585 |
T14398 |
T14384 |
punct |
.,makes |
R3586 |
T14400 |
T14401 |
det |
The,in |
R3587 |
T14401 |
T14405 |
nsubj |
in,shows |
R3588 |
T14402 |
T14401 |
compound |
T126M,in |
R3589 |
T14403 |
T14401 |
compound |
knock,in |
R359 |
T2576 |
T2574 |
nsubj |
proteins,permit |
R3590 |
T14404 |
T14401 |
punct |
-,in |
R3591 |
T14406 |
T14405 |
advmod |
clearly,shows |
R3592 |
T14407 |
T14408 |
mark |
that,is |
R3593 |
T14408 |
T14405 |
ccomp |
is,shows |
R3594 |
T14409 |
T14408 |
nsubj |
Aqp2,is |
R3595 |
T14410 |
T14411 |
det |
an,gene |
R3596 |
T14411 |
T14408 |
attr |
gene,is |
R3597 |
T14412 |
T14411 |
amod |
essential,gene |
R3598 |
T14413 |
T14414 |
punct |
[,18 |
R3599 |
T14414 |
T14405 |
parataxis |
18,shows |
R360 |
T2577 |
T2578 |
det |
the,passage |
R3600 |
T14415 |
T14414 |
punct |
],18 |
R3601 |
T14416 |
T14405 |
punct |
.,shows |
R3602 |
T14418 |
T14419 |
det |
The,fact |
R3603 |
T14419 |
T14420 |
nsubj |
fact,shows |
R3604 |
T14421 |
T14422 |
mark |
that,survive |
R3605 |
T14422 |
T14419 |
acl |
survive,fact |
R3606 |
T14423 |
T14424 |
poss |
our,mice |
R3607 |
T14424 |
T14422 |
nsubj |
mice,survive |
R3608 |
T14425 |
T14426 |
preconj |
either,possesses |
R3609 |
T14426 |
T14420 |
advcl |
possesses,shows |
R361 |
T2578 |
T2574 |
dobj |
passage,permit |
R3610 |
T14427 |
T14426 |
mark |
that,possesses |
R3611 |
T14428 |
T14429 |
compound |
AQP2,F204V |
R3612 |
T14429 |
T14426 |
nsubj |
F204V,possesses |
R3613 |
T14430 |
T14429 |
punct |
-,F204V |
R3614 |
T14431 |
T14432 |
det |
some,ability |
R3615 |
T14432 |
T14426 |
dobj |
ability,possesses |
R3616 |
T14433 |
T14432 |
amod |
residual,ability |
R3617 |
T14434 |
T14435 |
npadvmod |
water,transporting |
R3618 |
T14435 |
T14432 |
amod |
transporting,ability |
R3619 |
T14436 |
T14426 |
cc |
or,possesses |
R362 |
T2579 |
T2578 |
prep |
of,passage |
R3620 |
T14437 |
T14438 |
mark |
that,are |
R3621 |
T14438 |
T14426 |
conj |
are,possesses |
R3622 |
T14439 |
T14438 |
expl |
there,are |
R3623 |
T14440 |
T14441 |
npadvmod |
AVP,independent |
R3624 |
T14441 |
T14443 |
amod |
independent,pathways |
R3625 |
T14442 |
T14441 |
punct |
-,independent |
R3626 |
T14443 |
T14438 |
attr |
pathways,are |
R3627 |
T14444 |
T14443 |
prep |
for,pathways |
R3628 |
T14445 |
T14446 |
compound |
water,reabsorption |
R3629 |
T14446 |
T14444 |
pobj |
reabsorption,for |
R363 |
T2580 |
T2579 |
pobj |
water,of |
R3630 |
T14447 |
T14420 |
punct |
.,shows |
R3631 |
T14449 |
T14450 |
amod |
Residual,activity |
R3632 |
T14450 |
T14451 |
nsubj |
activity,is |
R3633 |
T14452 |
T14450 |
prep |
of,activity |
R3634 |
T14453 |
T14454 |
compound |
AQP2,F204V |
R3635 |
T14454 |
T14452 |
pobj |
F204V,of |
R3636 |
T14455 |
T14454 |
punct |
-,F204V |
R3637 |
T14456 |
T14451 |
acomp |
likely,is |
R3638 |
T14457 |
T14451 |
punct |
", ",is |
R3639 |
T14458 |
T14459 |
mark |
as,show |
R364 |
T2581 |
T2578 |
prep |
through,passage |
R3640 |
T14459 |
T14451 |
advcl |
show,is |
R3641 |
T14460 |
T14461 |
compound |
mutant,animals |
R3642 |
T14461 |
T14459 |
nsubj |
animals,show |
R3643 |
T14462 |
T14463 |
det |
some,response |
R3644 |
T14463 |
T14459 |
dobj |
response,show |
R3645 |
T14464 |
T14463 |
amod |
small,response |
R3646 |
T14465 |
T14463 |
prep |
to,response |
R3647 |
T14466 |
T14465 |
pobj |
dDAVP,to |
R3648 |
T14467 |
T14459 |
punct |
", ",show |
R3649 |
T14468 |
T14469 |
mark |
although,remains |
R365 |
T2582 |
T2583 |
det |
the,membrane |
R3650 |
T14469 |
T14459 |
advcl |
remains,show |
R3651 |
T14470 |
T14471 |
npadvmod |
dDAVP,stimulated |
R3652 |
T14471 |
T14473 |
amod |
stimulated,osmolality |
R3653 |
T14472 |
T14471 |
punct |
-,stimulated |
R3654 |
T14473 |
T14469 |
nsubj |
osmolality,remains |
R3655 |
T14474 |
T14473 |
compound |
urine,osmolality |
R3656 |
T14475 |
T14476 |
advmod |
quite,low |
R3657 |
T14476 |
T14469 |
acomp |
low,remains |
R3658 |
T14477 |
T14451 |
punct |
.,is |
R3659 |
T14479 |
T14480 |
nsubj |
Immunostaining,shows |
R366 |
T2583 |
T2581 |
pobj |
membrane,through |
R3660 |
T14481 |
T14479 |
prep |
of,Immunostaining |
R3661 |
T14482 |
T14481 |
pobj |
kidney,of |
R3662 |
T14483 |
T14484 |
mark |
that,transport |
R3663 |
T14484 |
T14480 |
ccomp |
transport,shows |
R3664 |
T14485 |
T14486 |
compound |
AQP2,F204V |
R3665 |
T14486 |
T14484 |
nsubj |
F204V,transport |
R3666 |
T14487 |
T14486 |
punct |
-,F204V |
R3667 |
T14488 |
T14484 |
aux |
does,transport |
R3668 |
T14489 |
T14484 |
neg |
not,transport |
R3669 |
T14490 |
T14484 |
advmod |
efficiently,transport |
R367 |
T2584 |
T2583 |
compound |
plasma,membrane |
R3670 |
T14491 |
T14484 |
dobj |
water,transport |
R3671 |
T14492 |
T14484 |
punct |
", ",transport |
R3672 |
T14493 |
T14494 |
mark |
because,fails |
R3673 |
T14494 |
T14484 |
advcl |
fails,transport |
R3674 |
T14495 |
T14494 |
nsubj |
it,fails |
R3675 |
T14496 |
T14497 |
aux |
to,localize |
R3676 |
T14497 |
T14494 |
xcomp |
localize,fails |
R3677 |
T14498 |
T14497 |
prep |
to,localize |
R3678 |
T14499 |
T14500 |
det |
the,surface |
R3679 |
T14500 |
T14498 |
pobj |
surface,to |
R368 |
T2585 |
T2583 |
punct |
(,membrane |
R3680 |
T14501 |
T14500 |
amod |
apical,surface |
R3681 |
T14502 |
T14500 |
compound |
cell,surface |
R3682 |
T14503 |
T14497 |
prep |
after,localize |
R3683 |
T14504 |
T14505 |
compound |
dDAVP,treatment |
R3684 |
T14505 |
T14503 |
pobj |
treatment,after |
R3685 |
T14506 |
T14480 |
punct |
.,shows |
R3686 |
T14508 |
T14509 |
det |
Some,activity |
R3687 |
T14509 |
T14511 |
nsubj |
activity,imply |
R3688 |
T14510 |
T14509 |
amod |
residual,activity |
R3689 |
T14512 |
T14509 |
prep |
of,activity |
R369 |
T2586 |
T2583 |
appos |
PM,membrane |
R3690 |
T14513 |
T14512 |
pobj |
AQP2,of |
R3691 |
T14514 |
T14511 |
aux |
would,imply |
R3692 |
T14515 |
T14516 |
mark |
that,getting |
R3693 |
T14516 |
T14511 |
ccomp |
getting,imply |
R3694 |
T14517 |
T14518 |
det |
some,portion |
R3695 |
T14518 |
T14516 |
nsubj |
portion,getting |
R3696 |
T14519 |
T14518 |
amod |
small,portion |
R3697 |
T14520 |
T14518 |
punct |
", ",portion |
R3698 |
T14521 |
T14518 |
amod |
undetectable,portion |
R3699 |
T14522 |
T14518 |
prep |
of,portion |
R370 |
T2587 |
T2583 |
punct |
),membrane |
R3700 |
T14523 |
T14524 |
det |
the,protein |
R3701 |
T14524 |
T14522 |
pobj |
protein,of |
R3702 |
T14525 |
T14524 |
compound |
mutant,protein |
R3703 |
T14526 |
T14516 |
aux |
is,getting |
R3704 |
T14527 |
T14516 |
prep |
to,getting |
R3705 |
T14528 |
T14529 |
det |
the,surface |
R3706 |
T14529 |
T14527 |
pobj |
surface,to |
R3707 |
T14530 |
T14529 |
compound |
cell,surface |
R3708 |
T14531 |
T14511 |
punct |
.,imply |
R3709 |
T14533 |
T14534 |
det |
The,experiment |
R371 |
T2588 |
T2583 |
prep |
of,membrane |
R3710 |
T14534 |
T14537 |
nsubj |
experiment,suggests |
R3711 |
T14535 |
T14534 |
compound |
surface,experiment |
R3712 |
T14536 |
T14534 |
compound |
biotinylation,experiment |
R3713 |
T14538 |
T14539 |
punct |
(,Figure |
R3714 |
T14539 |
T14534 |
parataxis |
Figure,experiment |
R3715 |
T14540 |
T14539 |
nummod |
5D,Figure |
R3716 |
T14541 |
T14539 |
punct |
),Figure |
R3717 |
T14542 |
T14543 |
mark |
that,gets |
R3718 |
T14543 |
T14537 |
ccomp |
gets,suggests |
R3719 |
T14544 |
T14545 |
det |
no,protein |
R372 |
T2589 |
T2588 |
pobj |
cells,of |
R3720 |
T14545 |
T14543 |
nsubj |
protein,gets |
R3721 |
T14546 |
T14545 |
compound |
mutant,protein |
R3722 |
T14547 |
T14543 |
prep |
to,gets |
R3723 |
T14548 |
T14549 |
det |
the,surface |
R3724 |
T14549 |
T14547 |
pobj |
surface,to |
R3725 |
T14550 |
T14537 |
punct |
", ",suggests |
R3726 |
T14551 |
T14537 |
cc |
but,suggests |
R3727 |
T14552 |
T14553 |
nsubj |
this,reflect |
R3728 |
T14553 |
T14537 |
conj |
reflect,suggests |
R3729 |
T14554 |
T14553 |
aux |
does,reflect |
R373 |
T2590 |
T2589 |
punct |
", ",cells |
R3730 |
T14555 |
T14553 |
neg |
not,reflect |
R3731 |
T14556 |
T14553 |
advmod |
necessarily,reflect |
R3732 |
T14557 |
T14558 |
det |
the,situation |
R3733 |
T14558 |
T14553 |
dobj |
situation,reflect |
R3734 |
T14559 |
T14560 |
advmod |
in,vivo |
R3735 |
T14560 |
T14558 |
advmod |
vivo,situation |
R3736 |
T14561 |
T14553 |
punct |
.,reflect |
R3737 |
T14563 |
T14564 |
mark |
While,be |
R3738 |
T14564 |
T14572 |
advcl |
be,shows |
R3739 |
T14565 |
T14566 |
det |
this,fraction |
R374 |
T2591 |
T2592 |
dep |
several,carry |
R3740 |
T14566 |
T14564 |
nsubj |
fraction,be |
R3741 |
T14567 |
T14566 |
amod |
small,fraction |
R3742 |
T14568 |
T14566 |
prep |
of,fraction |
R3743 |
T14569 |
T14568 |
pobj |
protein,of |
R3744 |
T14570 |
T14564 |
aux |
may,be |
R3745 |
T14571 |
T14564 |
neg |
not,be |
R3746 |
T14573 |
T14564 |
acomp |
detectable,be |
R3747 |
T14574 |
T14564 |
prep |
by,be |
R3748 |
T14575 |
T14574 |
pobj |
immunofluorescence,by |
R3749 |
T14576 |
T14572 |
punct |
", ",shows |
R375 |
T2592 |
T2589 |
relcl |
carry,cells |
R3750 |
T14577 |
T14578 |
compound |
Western,blotting |
R3751 |
T14578 |
T14572 |
nsubj |
blotting,shows |
R3752 |
T14579 |
T14580 |
mark |
that,progress |
R3753 |
T14580 |
T14572 |
ccomp |
progress,shows |
R3754 |
T14581 |
T14582 |
det |
some,protein |
R3755 |
T14582 |
T14580 |
nsubj |
protein,progress |
R3756 |
T14583 |
T14582 |
compound |
mutant,protein |
R3757 |
T14584 |
T14580 |
aux |
does,progress |
R3758 |
T14585 |
T14580 |
prep |
beyond,progress |
R3759 |
T14586 |
T14587 |
det |
the,ER |
R376 |
T2593 |
T2591 |
prep |
of,several |
R3760 |
T14587 |
T14585 |
pobj |
ER,beyond |
R3761 |
T14588 |
T14589 |
punct |
(,species |
R3762 |
T14589 |
T14572 |
parataxis |
species,shows |
R3763 |
T14590 |
T14591 |
quantmod |
35,45 |
R3764 |
T14591 |
T14593 |
nummod |
45,kDa |
R3765 |
T14592 |
T14591 |
punct |
–,45 |
R3766 |
T14593 |
T14589 |
compound |
kDa,species |
R3767 |
T14594 |
T14589 |
prep |
in,species |
R3768 |
T14595 |
T14594 |
pobj |
Figure,in |
R3769 |
T14596 |
T14595 |
nummod |
3A,Figure |
R377 |
T2594 |
T2593 |
pobj |
which,of |
R3770 |
T14597 |
T14589 |
punct |
),species |
R3771 |
T14598 |
T14572 |
punct |
.,shows |
R3772 |
T14600 |
T14601 |
prep |
Compared,is |
R3773 |
T14602 |
T14600 |
prep |
to,Compared |
R3774 |
T14603 |
T14604 |
amod |
wild,type |
R3775 |
T14604 |
T14602 |
pobj |
type,to |
R3776 |
T14605 |
T14604 |
punct |
-,type |
R3777 |
T14606 |
T14601 |
punct |
", ",is |
R3778 |
T14607 |
T14608 |
compound |
mutant,protein |
R3779 |
T14608 |
T14601 |
nsubj |
protein,is |
R378 |
T2595 |
T2592 |
prt |
out,carry |
R3780 |
T14609 |
T14601 |
acomp |
enriched,is |
R3781 |
T14610 |
T14609 |
prep |
in,enriched |
R3782 |
T14611 |
T14612 |
det |
the,form |
R3783 |
T14612 |
T14610 |
pobj |
form,in |
R3784 |
T14613 |
T14614 |
amod |
high,mannose |
R3785 |
T14614 |
T14612 |
nmod |
mannose,form |
R3786 |
T14615 |
T14614 |
punct |
-,mannose |
R3787 |
T14616 |
T14612 |
punct |
", ",form |
R3788 |
T14617 |
T14618 |
npadvmod |
core,glycosylated |
R3789 |
T14618 |
T14612 |
amod |
glycosylated,form |
R379 |
T2596 |
T2597 |
det |
this,role |
R3790 |
T14619 |
T14618 |
punct |
-,glycosylated |
R3791 |
T14620 |
T14621 |
punct |
(,kDa |
R3792 |
T14621 |
T14612 |
parataxis |
kDa,form |
R3793 |
T14622 |
T14621 |
nummod |
31,kDa |
R3794 |
T14623 |
T14621 |
punct |
),kDa |
R3795 |
T14624 |
T14609 |
cc |
and,enriched |
R3796 |
T14625 |
T14609 |
conj |
deficient,enriched |
R3797 |
T14626 |
T14625 |
prep |
in,deficient |
R3798 |
T14627 |
T14628 |
amod |
nonglycosylated,forms |
R3799 |
T14628 |
T14626 |
pobj |
forms,in |
R380 |
T2597 |
T2592 |
dobj |
role,carry |
R3800 |
T14629 |
T14630 |
punct |
(,kDa |
R3801 |
T14630 |
T14627 |
parataxis |
kDa,nonglycosylated |
R3802 |
T14631 |
T14630 |
nummod |
29,kDa |
R3803 |
T14632 |
T14630 |
punct |
),kDa |
R3804 |
T14633 |
T14627 |
cc |
and,nonglycosylated |
R3805 |
T14634 |
T14635 |
amod |
complex,glycosylated |
R3806 |
T14635 |
T14627 |
conj |
glycosylated,nonglycosylated |
R3807 |
T14636 |
T14637 |
punct |
(,kDa |
R3808 |
T14637 |
T14635 |
parataxis |
kDa,glycosylated |
R3809 |
T14638 |
T14639 |
quantmod |
35,45 |
R381 |
T2598 |
T2599 |
advmod |
specifically,in |
R3810 |
T14639 |
T14637 |
nummod |
45,kDa |
R3811 |
T14640 |
T14639 |
punct |
–,45 |
R3812 |
T14641 |
T14637 |
punct |
),kDa |
R3813 |
T14642 |
T14601 |
punct |
.,is |
R3814 |
T14644 |
T14645 |
det |
The,presence |
R3815 |
T14645 |
T14646 |
nsubj |
presence,indicates |
R3816 |
T14647 |
T14645 |
prep |
of,presence |
R3817 |
T14648 |
T14649 |
det |
a,amount |
R3818 |
T14649 |
T14647 |
pobj |
amount,of |
R3819 |
T14650 |
T14649 |
amod |
reduced,amount |
R382 |
T2599 |
T2592 |
prep |
in,carry |
R3820 |
T14651 |
T14650 |
cc |
but,reduced |
R3821 |
T14652 |
T14650 |
conj |
detectable,reduced |
R3822 |
T14653 |
T14649 |
prep |
of,amount |
R3823 |
T14654 |
T14653 |
pobj |
protein,of |
R3824 |
T14655 |
T14654 |
prep |
in,protein |
R3825 |
T14656 |
T14657 |
det |
the,range |
R3826 |
T14657 |
T14655 |
pobj |
range,in |
R3827 |
T14658 |
T14659 |
quantmod |
35,45 |
R3828 |
T14659 |
T14661 |
nummod |
45,kDa |
R3829 |
T14660 |
T14659 |
punct |
–,45 |
R383 |
T2600 |
T2601 |
det |
the,process |
R3830 |
T14661 |
T14657 |
compound |
kDa,range |
R3831 |
T14662 |
T14663 |
mark |
that,transported |
R3832 |
T14663 |
T14646 |
ccomp |
transported,indicates |
R3833 |
T14664 |
T14665 |
compound |
mutant,protein |
R3834 |
T14665 |
T14663 |
nsubjpass |
protein,transported |
R3835 |
T14666 |
T14663 |
auxpass |
is,transported |
R3836 |
T14667 |
T14663 |
prep |
out,transported |
R3837 |
T14668 |
T14667 |
prep |
of,out |
R3838 |
T14669 |
T14670 |
det |
the,ER |
R3839 |
T14670 |
T14668 |
pobj |
ER,of |
R384 |
T2601 |
T2599 |
pobj |
process,in |
R3840 |
T14671 |
T14663 |
punct |
", ",transported |
R3841 |
T14672 |
T14673 |
cc |
but,with |
R3842 |
T14673 |
T14663 |
prep |
with,transported |
R3843 |
T14674 |
T14675 |
advmod |
greatly,reduced |
R3844 |
T14675 |
T14676 |
amod |
reduced,efficiency |
R3845 |
T14676 |
T14673 |
pobj |
efficiency,with |
R3846 |
T14677 |
T14646 |
punct |
.,indicates |
R3847 |
T14679 |
T14680 |
nsubj |
Colocalization,shows |
R3848 |
T14681 |
T14679 |
prep |
of,Colocalization |
R3849 |
T14682 |
T14683 |
compound |
AQP2,F204V |
R385 |
T2602 |
T2601 |
prep |
of,process |
R3850 |
T14683 |
T14681 |
pobj |
F204V,of |
R3851 |
T14684 |
T14683 |
punct |
-,F204V |
R3852 |
T14685 |
T14679 |
prep |
with,Colocalization |
R3853 |
T14686 |
T14687 |
det |
the,protein |
R3854 |
T14687 |
T14685 |
pobj |
protein,with |
R3855 |
T14688 |
T14687 |
compound |
ER,protein |
R3856 |
T14689 |
T14687 |
appos |
calnexin,protein |
R3857 |
T14690 |
T14679 |
prep |
in,Colocalization |
R3858 |
T14691 |
T14692 |
amod |
transfected,cells |
R3859 |
T14692 |
T14690 |
pobj |
cells,in |
R386 |
T2603 |
T2604 |
compound |
water,reabsorption |
R3860 |
T14693 |
T14692 |
compound |
MDCK,cells |
R3861 |
T14694 |
T14695 |
mark |
that,progress |
R3862 |
T14695 |
T14680 |
ccomp |
progress,shows |
R3863 |
T14696 |
T14695 |
punct |
", ",progress |
R3864 |
T14697 |
T14698 |
mark |
while,trapped |
R3865 |
T14698 |
T14695 |
advcl |
trapped,progress |
R3866 |
T14738 |
T14737 |
prep |
of,fraction |
R3867 |
T14699 |
T14698 |
nsubjpass |
most,trapped |
R3868 |
T14739 |
T14740 |
compound |
mutant,protein |
R3869 |
T14700 |
T14699 |
prep |
of,most |
R387 |
T2604 |
T2602 |
pobj |
reabsorption,of |
R3870 |
T14740 |
T14738 |
pobj |
protein,of |
R3871 |
T14741 |
T14734 |
prep |
beyond,transport |
R3872 |
T14701 |
T14702 |
det |
the,protein |
R3873 |
T14742 |
T14743 |
det |
the,ER |
R3874 |
T14743 |
T14741 |
pobj |
ER,beyond |
R3875 |
T14744 |
T14734 |
prep |
in,transport |
R3876 |
T14702 |
T14700 |
pobj |
protein,of |
R3877 |
T14745 |
T14746 |
compound |
MDCK,cells |
R3878 |
T14746 |
T14744 |
pobj |
cells,in |
R3879 |
T14747 |
T14718 |
advmod |
all,are |
R388 |
T2605 |
T2604 |
prep |
from,reabsorption |
R3880 |
T14703 |
T14702 |
compound |
mutant,protein |
R3881 |
T14748 |
T14718 |
acomp |
consistent,are |
R3882 |
T14749 |
T14748 |
prep |
with,consistent |
R3883 |
T14750 |
T14751 |
det |
the,notion |
R3884 |
T14704 |
T14698 |
auxpass |
is,trapped |
R3885 |
T14751 |
T14749 |
pobj |
notion,with |
R3886 |
T14752 |
T14753 |
mark |
that,is |
R3887 |
T14753 |
T14751 |
advcl |
is,notion |
R3888 |
T14705 |
T14698 |
prep |
in,trapped |
R3889 |
T14754 |
T14755 |
compound |
AQP2,F204V |
R389 |
T2606 |
T2605 |
pobj |
urine,from |
R3890 |
T14755 |
T14757 |
compound |
F204V,misfolding |
R3891 |
T14756 |
T14755 |
punct |
-,F204V |
R3892 |
T14706 |
T14707 |
det |
the,ER |
R3893 |
T14757 |
T14753 |
nsubj |
misfolding,is |
R3894 |
T14758 |
T14753 |
acomp |
limited,is |
R3895 |
T14759 |
T14753 |
cc |
and,is |
R3896 |
T14760 |
T14761 |
mark |
that,retain |
R3897 |
T14761 |
T14753 |
conj |
retain,is |
R3898 |
T14762 |
T14761 |
nsubj |
it,retain |
R3899 |
T14707 |
T14705 |
pobj |
ER,in |
R390 |
T2607 |
T2604 |
prep |
in,reabsorption |
R3900 |
T14763 |
T14761 |
aux |
may,retain |
R3901 |
T14764 |
T14765 |
det |
some,activity |
R3902 |
T14765 |
T14761 |
dobj |
activity,retain |
R3903 |
T14708 |
T14695 |
punct |
", ",progress |
R3904 |
T14766 |
T14765 |
amod |
residual,activity |
R3905 |
T14767 |
T14768 |
npadvmod |
water,transporting |
R3906 |
T14709 |
T14695 |
nsubj |
some,progress |
R3907 |
T14768 |
T14765 |
amod |
transporting,activity |
R3908 |
T14769 |
T14718 |
punct |
.,are |
R3909 |
T14771 |
T14772 |
advmod |
Evidently,is |
R391 |
T2608 |
T2609 |
det |
the,kidney |
R3910 |
T14710 |
T14695 |
aux |
does,progress |
R3911 |
T14773 |
T14774 |
det |
this,activity |
R3912 |
T14774 |
T14772 |
nsubj |
activity,is |
R3913 |
T14711 |
T14695 |
prep |
beyond,progress |
R3914 |
T14775 |
T14774 |
amod |
residual,activity |
R3915 |
T14712 |
T14713 |
det |
the,ER |
R3916 |
T14776 |
T14772 |
acomp |
sufficient,is |
R3917 |
T14777 |
T14776 |
prep |
for,sufficient |
R3918 |
T14713 |
T14711 |
pobj |
ER,beyond |
R3919 |
T14778 |
T14779 |
det |
the,viability |
R392 |
T2609 |
T2607 |
pobj |
kidney,in |
R3920 |
T14779 |
T14777 |
pobj |
viability,for |
R3921 |
T14780 |
T14779 |
cc |
and,viability |
R3922 |
T14714 |
T14680 |
punct |
.,shows |
R3923 |
T14781 |
T14779 |
conj |
growth,viability |
R3924 |
T14782 |
T14779 |
prep |
of,viability |
R3925 |
T14783 |
T14784 |
compound |
mutant,animals |
R3926 |
T14716 |
T14717 |
amod |
Diminished,response |
R3927 |
T14784 |
T14782 |
pobj |
animals,of |
R3928 |
T14785 |
T14772 |
punct |
.,is |
R3929 |
T14787 |
T14788 |
amod |
Reduced,efficiency |
R393 |
T2610 |
T2574 |
punct |
.,permit |
R3930 |
T14717 |
T14718 |
nsubj |
response,are |
R3931 |
T14788 |
T14789 |
nsubj |
efficiency,explain |
R3932 |
T14790 |
T14788 |
prep |
in,efficiency |
R3933 |
T14719 |
T14717 |
prep |
to,response |
R3934 |
T14791 |
T14790 |
pcomp |
exiting,in |
R3935 |
T14792 |
T14793 |
det |
the,ER |
R3936 |
T14793 |
T14791 |
dobj |
ER,exiting |
R3937 |
T14794 |
T14789 |
aux |
may,explain |
R3938 |
T14720 |
T14719 |
pobj |
dDAVP,to |
R3939 |
T14795 |
T14796 |
advmod |
why,enriched |
R394 |
T2612 |
T2613 |
nsubjpass |
It,established |
R3940 |
T14796 |
T14789 |
ccomp |
enriched,explain |
R3941 |
T14797 |
T14798 |
compound |
AQP2,F204V |
R3942 |
T14721 |
T14717 |
punct |
", ",response |
R3943 |
T14798 |
T14796 |
nsubjpass |
F204V,enriched |
R3944 |
T14799 |
T14798 |
punct |
-,F204V |
R3945 |
T14800 |
T14796 |
auxpass |
is,enriched |
R3946 |
T14801 |
T14796 |
prep |
in,enriched |
R3947 |
T14802 |
T14803 |
det |
the,form |
R3948 |
T14803 |
T14801 |
pobj |
form,in |
R3949 |
T14722 |
T14723 |
amod |
diminished,abundance |
R395 |
T2614 |
T2613 |
aux |
has,established |
R3950 |
T14804 |
T14805 |
nummod |
31,kDa |
R3951 |
T14805 |
T14803 |
nmod |
kDa,form |
R3952 |
T14806 |
T14807 |
amod |
high,mannose |
R3953 |
T14807 |
T14803 |
nmod |
mannose,form |
R3954 |
T14723 |
T14717 |
conj |
abundance,response |
R3955 |
T14808 |
T14807 |
punct |
-,mannose |
R3956 |
T14809 |
T14803 |
amod |
glycosylated,form |
R3957 |
T14810 |
T14789 |
punct |
.,explain |
R3958 |
T14724 |
T14723 |
prep |
of,abundance |
R3959 |
T14725 |
T14726 |
amod |
mature,protein |
R396 |
T2615 |
T2613 |
auxpass |
been,established |
R3960 |
T14812 |
T14813 |
det |
The,oligosaccharide |
R3961 |
T14813 |
T14818 |
nsubjpass |
oligosaccharide,added |
R3962 |
T14814 |
T14815 |
amod |
high,mannose |
R3963 |
T14815 |
T14813 |
compound |
mannose,oligosaccharide |
R3964 |
T14816 |
T14815 |
punct |
-,mannose |
R3965 |
T14726 |
T14724 |
pobj |
protein,of |
R3966 |
T14817 |
T14813 |
compound |
core,oligosaccharide |
R3967 |
T14727 |
T14726 |
amod |
glycosylated,protein |
R3968 |
T14819 |
T14818 |
auxpass |
is,added |
R3969 |
T14820 |
T14818 |
prep |
in,added |
R397 |
T2616 |
T2617 |
mark |
that,tetramerize |
R3970 |
T14821 |
T14822 |
det |
the,ER |
R3971 |
T14728 |
T14723 |
prep |
in,abundance |
R3972 |
T14822 |
T14820 |
pobj |
ER,in |
R3973 |
T14823 |
T14818 |
cc |
and,added |
R3974 |
T14824 |
T14825 |
auxpass |
is,modified |
R3975 |
T14729 |
T14730 |
compound |
mutant,animals |
R3976 |
T14825 |
T14818 |
conj |
modified,added |
R3977 |
T14826 |
T14825 |
advmod |
later,modified |
R3978 |
T14730 |
T14728 |
pobj |
animals,in |
R3979 |
T14827 |
T14825 |
cc |
and,modified |
R398 |
T2617 |
T2613 |
ccomp |
tetramerize,established |
R3980 |
T14828 |
T14825 |
conj |
elaborated,modified |
R3981 |
T14829 |
T14828 |
prep |
in,elaborated |
R3982 |
T14731 |
T14723 |
punct |
", ",abundance |
R3983 |
T14830 |
T14831 |
det |
the,apparatus |
R3984 |
T14831 |
T14829 |
pobj |
apparatus,in |
R3985 |
T14732 |
T14723 |
cc |
and,abundance |
R3986 |
T14832 |
T14831 |
compound |
Golgi,apparatus |
R3987 |
T14833 |
T14834 |
punct |
[,26 |
R3988 |
T14834 |
T14825 |
parataxis |
26,modified |
R3989 |
T14733 |
T14734 |
det |
the,transport |
R399 |
T2618 |
T2617 |
nsubj |
aquaporins,tetramerize |
R3990 |
T14835 |
T14834 |
punct |
],26 |
R3991 |
T14836 |
T14818 |
punct |
.,added |
R3992 |
T14734 |
T14723 |
conj |
transport,abundance |
R3993 |
T14838 |
T14839 |
det |
The,increase |
R3994 |
T14839 |
T14840 |
nsubj |
increase,reflect |
R3995 |
T14735 |
T14734 |
prep |
of,transport |
R3996 |
T14841 |
T14839 |
prep |
in,increase |
R3997 |
T14842 |
T14843 |
det |
the,form |
R3998 |
T14843 |
T14841 |
pobj |
form,in |
R3999 |
T14736 |
T14737 |
det |
a,fraction |
R400 |
T2619 |
T2617 |
punct |
", ",tetramerize |
R4000 |
T14737 |
T14735 |
pobj |
fraction,of |
R4001 |
T14950 |
T14949 |
aux |
can,explain |
R4002 |
T14844 |
T14845 |
amod |
high,mannose |
R4003 |
T14845 |
T14843 |
nmod |
mannose,form |
R4004 |
T14846 |
T14845 |
punct |
-,mannose |
R4005 |
T14847 |
T14843 |
amod |
glycosylated,form |
R4006 |
T14951 |
T14949 |
neg |
not,explain |
R4007 |
T14848 |
T14843 |
prep |
of,form |
R4008 |
T14849 |
T14850 |
compound |
AQP2,F204V |
R4009 |
T14850 |
T14848 |
pobj |
F204V,of |
R401 |
T2620 |
T2621 |
mark |
although,functional |
R4010 |
T14952 |
T14953 |
det |
the,lack |
R4011 |
T14851 |
T14850 |
punct |
-,F204V |
R4012 |
T14852 |
T14840 |
aux |
may,reflect |
R4013 |
T14853 |
T14840 |
advmod |
simply,reflect |
R4014 |
T14953 |
T14949 |
dobj |
lack,explain |
R4015 |
T14854 |
T14855 |
poss |
its,presence |
R4016 |
T14954 |
T14953 |
prep |
of,lack |
R4017 |
T14855 |
T14840 |
dobj |
presence,reflect |
R4018 |
T14856 |
T14855 |
amod |
prolonged,presence |
R4019 |
T14857 |
T14855 |
prep |
in,presence |
R402 |
T2621 |
T2617 |
advcl |
functional,tetramerize |
R4020 |
T14858 |
T14859 |
det |
the,ER |
R4021 |
T14955 |
T14956 |
det |
any,protein |
R4022 |
T14859 |
T14857 |
pobj |
ER,in |
R4023 |
T14860 |
T14855 |
cc |
and,presence |
R4024 |
T14861 |
T14855 |
conj |
exposure,presence |
R4025 |
T14956 |
T14954 |
pobj |
protein,of |
R4026 |
T14957 |
T14958 |
npadvmod |
ER,retained |
R4027 |
T14862 |
T14861 |
prep |
to,exposure |
R4028 |
T14863 |
T14864 |
compound |
oligosaccharyl,transferase |
R4029 |
T14864 |
T14862 |
pobj |
transferase,to |
R403 |
T2622 |
T2621 |
prep |
as,functional |
R4030 |
T14958 |
T14956 |
amod |
retained,protein |
R4031 |
T14865 |
T14840 |
punct |
.,reflect |
R4032 |
T14867 |
T14868 |
mark |
While,explains |
R4033 |
T14959 |
T14958 |
punct |
-,retained |
R4034 |
T14868 |
T14873 |
advcl |
explains,is |
R4035 |
T14960 |
T14956 |
compound |
mutant,protein |
R4036 |
T14869 |
T14870 |
amod |
improper,localization |
R4037 |
T14870 |
T14868 |
nsubj |
localization,explains |
R4038 |
T14871 |
T14870 |
prep |
of,localization |
R4039 |
T14961 |
T14949 |
punct |
.,explain |
R404 |
T2623 |
T2624 |
det |
a,monomer |
R4040 |
T14872 |
T14871 |
pobj |
AQP2,of |
R4041 |
T14963 |
T14964 |
advmod |
Rather,suggests |
R4042 |
T14874 |
T14875 |
det |
the,phenotype |
R4043 |
T14875 |
T14868 |
dobj |
phenotype,explains |
R4044 |
T14876 |
T14875 |
prep |
of,phenotype |
R4045 |
T14877 |
T14878 |
amod |
homozygous,mice |
R4046 |
T14878 |
T14876 |
pobj |
mice,of |
R4047 |
T14965 |
T14964 |
punct |
", ",suggests |
R4048 |
T14879 |
T14878 |
compound |
mutant,mice |
R4049 |
T14880 |
T14873 |
punct |
", ",is |
R405 |
T2624 |
T2622 |
pobj |
monomer,as |
R4050 |
T14881 |
T14882 |
det |
the,lack |
R4051 |
T14882 |
T14873 |
nsubj |
lack,is |
R4052 |
T14883 |
T14882 |
amod |
complete,lack |
R4053 |
T14884 |
T14882 |
prep |
of,lack |
R4054 |
T14885 |
T14886 |
det |
a,phenotype |
R4055 |
T14886 |
T14884 |
pobj |
phenotype,of |
R4056 |
T14966 |
T14967 |
det |
the,phenotype |
R4057 |
T14887 |
T14882 |
prep |
in,lack |
R4058 |
T14888 |
T14889 |
amod |
heterozygous,mice |
R4059 |
T14889 |
T14887 |
pobj |
mice,in |
R406 |
T2625 |
T2617 |
punct |
", ",tetramerize |
R4060 |
T14967 |
T14964 |
nsubj |
phenotype,suggests |
R4061 |
T14890 |
T14891 |
advmod |
more,difficult |
R4062 |
T14891 |
T14873 |
acomp |
difficult,is |
R4063 |
T14892 |
T14893 |
aux |
to,explain |
R4064 |
T14968 |
T14967 |
prep |
of,phenotype |
R4065 |
T14893 |
T14891 |
advcl |
explain,difficult |
R4066 |
T14894 |
T14873 |
punct |
.,is |
R4067 |
T14969 |
T14970 |
det |
the,animals |
R4068 |
T14896 |
T14897 |
advmod |
Physiologically,have |
R4069 |
T14970 |
T14968 |
pobj |
animals,of |
R407 |
T2626 |
T2617 |
prep |
before,tetramerize |
R4070 |
T14898 |
T14897 |
punct |
", ",have |
R4071 |
T14899 |
T14900 |
amod |
heterozygous,mice |
R4072 |
T14900 |
T14897 |
nsubj |
mice,have |
R4073 |
T14971 |
T14970 |
nmod |
Aqp2F204V,animals |
R4074 |
T14901 |
T14902 |
det |
no,symptoms |
R4075 |
T14902 |
T14897 |
dobj |
symptoms,have |
R4076 |
T14903 |
T14904 |
punct |
(,see |
R4077 |
T14972 |
T14971 |
punct |
/,Aqp2F204V |
R4078 |
T14904 |
T14897 |
parataxis |
see,have |
R4079 |
T14905 |
T14904 |
dobj |
Figure,see |
R408 |
T2627 |
T2628 |
poss |
their,insertion |
R4080 |
T14973 |
T14971 |
punct |
+,Aqp2F204V |
R4081 |
T14906 |
T14905 |
nummod |
1C,Figure |
R4082 |
T14907 |
T14904 |
punct |
),see |
R4083 |
T14908 |
T14897 |
punct |
", ",have |
R4084 |
T14909 |
T14897 |
cc |
and,have |
R4085 |
T14974 |
T14975 |
mark |
that,rescued |
R4086 |
T14910 |
T14911 |
nsubj |
they,are |
R4087 |
T14911 |
T14897 |
conj |
are,have |
R4088 |
T14975 |
T14964 |
ccomp |
rescued,suggests |
R4089 |
T14912 |
T14911 |
acomp |
indistinguishable,are |
R409 |
T2628 |
T2626 |
pobj |
insertion,before |
R4090 |
T14913 |
T14912 |
prep |
from,indistinguishable |
R4091 |
T14914 |
T14915 |
amod |
wild,type |
R4092 |
T14976 |
T14977 |
det |
the,protein |
R4093 |
T14915 |
T14913 |
pobj |
type,from |
R4094 |
T14916 |
T14911 |
prep |
on,are |
R4095 |
T14917 |
T14916 |
pobj |
immunostaining,on |
R4096 |
T14977 |
T14975 |
nsubjpass |
protein,rescued |
R4097 |
T14918 |
T14917 |
prep |
of,immunostaining |
R4098 |
T14919 |
T14918 |
pobj |
kidneys,of |
R4099 |
T14920 |
T14921 |
punct |
(,Figure |
R410 |
T2629 |
T2628 |
prep |
into,insertion |
R4100 |
T14978 |
T14977 |
compound |
mutant,protein |
R4101 |
T14921 |
T14911 |
parataxis |
Figure,are |
R4102 |
T14922 |
T14921 |
nummod |
5A,Figure |
R4103 |
T14923 |
T14921 |
punct |
),Figure |
R4104 |
T14924 |
T14911 |
punct |
.,are |
R4105 |
T14979 |
T14975 |
aux |
is,rescued |
R4106 |
T14926 |
T14927 |
det |
The,presence |
R4107 |
T14927 |
T14928 |
nsubj |
presence,explain |
R4108 |
T14980 |
T14975 |
auxpass |
being,rescued |
R4109 |
T14929 |
T14927 |
prep |
of,presence |
R411 |
T2630 |
T2631 |
det |
the,membrane |
R4110 |
T14930 |
T14931 |
nummod |
50,% |
R4111 |
T14931 |
T14929 |
pobj |
%,of |
R4112 |
T14981 |
T14975 |
agent |
by,rescued |
R4113 |
T14932 |
T14931 |
prep |
of,% |
R4114 |
T14933 |
T14934 |
det |
the,amount |
R4115 |
T14934 |
T14932 |
pobj |
amount,of |
R4116 |
T14982 |
T14983 |
det |
the,protein |
R4117 |
T14935 |
T14934 |
amod |
normal,amount |
R4118 |
T14936 |
T14934 |
prep |
of,amount |
R4119 |
T14937 |
T14938 |
amod |
wild,type |
R412 |
T2631 |
T2629 |
pobj |
membrane,into |
R4120 |
T14938 |
T14940 |
compound |
type,protein |
R4121 |
T14983 |
T14981 |
pobj |
protein,by |
R4122 |
T14939 |
T14938 |
punct |
-,type |
R4123 |
T14940 |
T14936 |
pobj |
protein,of |
R4124 |
T14984 |
T14985 |
amod |
wild,type |
R4125 |
T14941 |
T14928 |
aux |
may,explain |
R4126 |
T14942 |
T14943 |
det |
the,lack |
R4127 |
T14943 |
T14928 |
dobj |
lack,explain |
R4128 |
T14944 |
T14943 |
prep |
of,lack |
R4129 |
T14985 |
T14983 |
compound |
type,protein |
R413 |
T2632 |
T2631 |
compound |
plasma,membrane |
R4130 |
T14945 |
T14944 |
pobj |
symptoms,of |
R4131 |
T14946 |
T14928 |
punct |
", ",explain |
R4132 |
T14947 |
T14928 |
cc |
but,explain |
R4133 |
T14986 |
T14985 |
punct |
-,type |
R4134 |
T14948 |
T14949 |
nsubj |
it,explain |
R4135 |
T14987 |
T14964 |
punct |
.,suggests |
R4136 |
T14949 |
T14928 |
conj |
explain,explain |
R4137 |
T14989 |
T14990 |
advmod |
Indeed,demonstrated |
R4138 |
T14991 |
T14990 |
punct |
", ",demonstrated |
R4139 |
T14992 |
T14993 |
compound |
de,Mattia |
R414 |
T2633 |
T2634 |
punct |
[,6 |
R4140 |
T14993 |
T14990 |
nsubj |
Mattia,demonstrated |
R4141 |
T14994 |
T14995 |
advmod |
et,al. |
R4142 |
T15056 |
T15055 |
pobj |
this,of |
R4143 |
T15057 |
T15053 |
punct |
", ",interact |
R4144 |
T14995 |
T14993 |
advmod |
al.,Mattia |
R4145 |
T15058 |
T15059 |
compound |
AQP2,F204V |
R4146 |
T15059 |
T15053 |
nsubj |
F204V,interact |
R4147 |
T15060 |
T15059 |
punct |
-,F204V |
R4148 |
T14996 |
T14997 |
punct |
(,26 |
R4149 |
T15061 |
T15053 |
aux |
can,interact |
R415 |
T2634 |
T2613 |
parataxis |
6,established |
R4150 |
T15062 |
T15053 |
prep |
with,interact |
R4151 |
T14997 |
T14993 |
parataxis |
26,Mattia |
R4152 |
T15063 |
T15064 |
amod |
wild,type |
R4153 |
T15064 |
T15066 |
compound |
type,AQP2 |
R4154 |
T15065 |
T15064 |
punct |
-,type |
R4155 |
T15066 |
T15062 |
pobj |
AQP2,with |
R4156 |
T15067 |
T15068 |
punct |
(,Figure |
R4157 |
T15068 |
T15053 |
parataxis |
Figure,interact |
R4158 |
T14998 |
T14997 |
punct |
),26 |
R4159 |
T15069 |
T15068 |
nummod |
5B,Figure |
R416 |
T2635 |
T2634 |
nummod |
4,6 |
R4160 |
T15070 |
T15068 |
punct |
),Figure |
R4161 |
T15071 |
T15053 |
punct |
", ",interact |
R4162 |
T15072 |
T15053 |
cc |
and,interact |
R4163 |
T14999 |
T14990 |
aux |
have,demonstrated |
R4164 |
T15073 |
T15074 |
advmod |
when,coexpressed |
R4165 |
T15074 |
T15075 |
advcl |
coexpressed,reach |
R4166 |
T15000 |
T15001 |
mark |
that,translocate |
R4167 |
T15075 |
T15053 |
conj |
reach,interact |
R4168 |
T15076 |
T15074 |
prep |
with,coexpressed |
R4169 |
T15077 |
T15078 |
amod |
wild,type |
R417 |
T2636 |
T2634 |
punct |
",",6 |
R4170 |
T15001 |
T14990 |
advcl |
translocate,demonstrated |
R4171 |
T15078 |
T15080 |
compound |
type,protein |
R4172 |
T15079 |
T15078 |
punct |
-,type |
R4173 |
T15080 |
T15076 |
pobj |
protein,with |
R4174 |
T15002 |
T15003 |
nummod |
one,allele |
R4175 |
T15081 |
T15075 |
punct |
", ",reach |
R4176 |
T15082 |
T15083 |
compound |
AQP2,F204V |
R4177 |
T15083 |
T15075 |
nsubj |
F204V,reach |
R4178 |
T15003 |
T15001 |
nsubj |
allele,translocate |
R4179 |
T15084 |
T15083 |
punct |
-,F204V |
R418 |
T2637 |
T2634 |
punct |
],6 |
R4180 |
T15085 |
T15075 |
aux |
can,reach |
R4181 |
T15086 |
T15087 |
det |
the,surface |
R4182 |
T15004 |
T15003 |
amod |
recessive,allele |
R4183 |
T15087 |
T15075 |
dobj |
surface,reach |
R4184 |
T15088 |
T15087 |
compound |
cell,surface |
R4185 |
T15089 |
T15090 |
punct |
(,panel |
R4186 |
T15005 |
T15003 |
prep |
of,allele |
R4187 |
T15090 |
T15075 |
parataxis |
panel,reach |
R4188 |
T15091 |
T15090 |
nmod |
Figure,panel |
R4189 |
T15092 |
T15091 |
nummod |
5C,Figure |
R419 |
T2638 |
T2613 |
punct |
.,established |
R4190 |
T15093 |
T15094 |
npadvmod |
bottom,right |
R4191 |
T15006 |
T15005 |
pobj |
Aqp2,of |
R4192 |
T15094 |
T15090 |
amod |
right,panel |
R4193 |
T15095 |
T15090 |
cc |
and,panel |
R4194 |
T15096 |
T15090 |
conj |
5D,panel |
R4195 |
T15007 |
T15003 |
punct |
", ",allele |
R4196 |
T15097 |
T15090 |
punct |
),panel |
R4197 |
T15098 |
T15053 |
punct |
.,interact |
R4198 |
T15008 |
T15003 |
appos |
P262L,allele |
R4199 |
T15100 |
T15101 |
mark |
Although,demonstrated |
R420 |
T2640 |
T2641 |
advmod |
Furthermore,targeted |
R4200 |
T15101 |
T15105 |
advcl |
demonstrated,show |
R4201 |
T15009 |
T15001 |
punct |
", ",translocate |
R4202 |
T15102 |
T15101 |
nsubjpass |
it,demonstrated |
R4203 |
T15103 |
T15101 |
aux |
has,demonstrated |
R4204 |
T15104 |
T15101 |
auxpass |
been,demonstrated |
R4205 |
T15010 |
T15001 |
aux |
does,translocate |
R4206 |
T15106 |
T15107 |
mark |
that,fails |
R4207 |
T15107 |
T15101 |
ccomp |
fails,demonstrated |
R4208 |
T15108 |
T15109 |
det |
a,allele |
R4209 |
T15109 |
T15107 |
nsubj |
allele,fails |
R421 |
T2641 |
T2648 |
ccomp |
targeted,routed |
R4210 |
T15110 |
T15109 |
amod |
recessive,allele |
R4211 |
T15011 |
T15001 |
neg |
not,translocate |
R4212 |
T15111 |
T15109 |
punct |
(,allele |
R4213 |
T15112 |
T15109 |
acl |
encoding,allele |
R4214 |
T15113 |
T15114 |
compound |
AQP2,R187C |
R4215 |
T15012 |
T15001 |
advmod |
properly,translocate |
R4216 |
T15114 |
T15112 |
dobj |
R187C,encoding |
R4217 |
T15115 |
T15114 |
punct |
-,R187C |
R4218 |
T15116 |
T15109 |
punct |
),allele |
R4219 |
T15013 |
T15014 |
advmod |
when,expressed |
R422 |
T2642 |
T2643 |
det |
these,proteins |
R4220 |
T15117 |
T15109 |
prep |
of,allele |
R4221 |
T15118 |
T15117 |
pobj |
NDI,of |
R4222 |
T15014 |
T15001 |
advcl |
expressed,translocate |
R4223 |
T15119 |
T15120 |
aux |
to,interact |
R4224 |
T15015 |
T15014 |
prep |
by,expressed |
R4225 |
T15120 |
T15107 |
xcomp |
interact,fails |
R4226 |
T15121 |
T15120 |
prep |
with,interact |
R4227 |
T15122 |
T15123 |
amod |
wild,type |
R4228 |
T15016 |
T15015 |
pobj |
itself,by |
R4229 |
T15123 |
T15125 |
compound |
type,AQP2 |
R423 |
T2643 |
T2641 |
nsubjpass |
proteins,targeted |
R4230 |
T15124 |
T15123 |
punct |
-,type |
R4231 |
T15125 |
T15121 |
pobj |
AQP2,with |
R4232 |
T15017 |
T15014 |
prep |
in,expressed |
R4233 |
T15126 |
T15127 |
punct |
[,6 |
R4234 |
T15127 |
T15101 |
parataxis |
6,demonstrated |
R4235 |
T15018 |
T15019 |
compound |
MDCK,cells |
R4236 |
T15128 |
T15127 |
punct |
],6 |
R4237 |
T15129 |
T15105 |
punct |
", ",show |
R4238 |
T15019 |
T15017 |
pobj |
cells,in |
R4239 |
T15130 |
T15105 |
advmod |
here,show |
R424 |
T2644 |
T2641 |
aux |
can,targeted |
R4240 |
T15131 |
T15105 |
nsubj |
we,show |
R4241 |
T15132 |
T15133 |
mark |
that,interact |
R4242 |
T15133 |
T15105 |
ccomp |
interact,show |
R4243 |
T15020 |
T15001 |
punct |
", ",translocate |
R4244 |
T15134 |
T15135 |
compound |
AQP2,F204V |
R4245 |
T15135 |
T15133 |
nsubj |
F204V,interact |
R4246 |
T15021 |
T15001 |
cc |
but,translocate |
R4247 |
T15136 |
T15135 |
punct |
-,F204V |
R4248 |
T15137 |
T15133 |
aux |
does,interact |
R4249 |
T15138 |
T15133 |
prep |
with,interact |
R425 |
T2645 |
T2641 |
advmod |
also,targeted |
R4250 |
T15022 |
T15023 |
mark |
that,localizes |
R4251 |
T15139 |
T15140 |
det |
the,protein |
R4252 |
T15140 |
T15138 |
pobj |
protein,with |
R4253 |
T15141 |
T15142 |
amod |
wild,type |
R4254 |
T15023 |
T15001 |
conj |
localizes,translocate |
R4255 |
T15142 |
T15140 |
compound |
type,protein |
R4256 |
T15143 |
T15142 |
punct |
-,type |
R4257 |
T15144 |
T15133 |
punct |
", ",interact |
R4258 |
T15145 |
T15146 |
advmod |
presumably,as |
R4259 |
T15146 |
T15133 |
prep |
as,interact |
R426 |
T2646 |
T2641 |
auxpass |
be,targeted |
R4260 |
T15147 |
T15146 |
pobj |
part,as |
R4261 |
T15024 |
T15023 |
prep |
in,localizes |
R4262 |
T15148 |
T15147 |
prep |
of,part |
R4263 |
T15149 |
T15148 |
pobj |
heterotetramers,of |
R4264 |
T15025 |
T15026 |
det |
the,presence |
R4265 |
T15150 |
T15133 |
punct |
", ",interact |
R4266 |
T15151 |
T15133 |
cc |
and,interact |
R4267 |
T15152 |
T15133 |
conj |
represents,interact |
R4268 |
T15153 |
T15154 |
det |
a,allele |
R4269 |
T15026 |
T15024 |
pobj |
presence,in |
R427 |
T2647 |
T2641 |
advmod |
differentially,targeted |
R4270 |
T15154 |
T15152 |
dobj |
allele,represents |
R4271 |
T15155 |
T15154 |
amod |
rescuable,allele |
R4272 |
T15156 |
T15152 |
punct |
", ",represents |
R4273 |
T15027 |
T15026 |
prep |
of,presence |
R4274 |
T15157 |
T15158 |
preconj |
both,vitro |
R4275 |
T15158 |
T15152 |
advmod |
vitro,represents |
R4276 |
T15028 |
T15029 |
amod |
wild,type |
R4277 |
T15159 |
T15158 |
advmod |
in,vitro |
R4278 |
T15160 |
T15158 |
cc |
and,vitro |
R4279 |
T15029 |
T15031 |
compound |
type,protein |
R428 |
T2649 |
T2641 |
prep |
to,targeted |
R4280 |
T15030 |
T15029 |
punct |
-,type |
R4281 |
T15031 |
T15027 |
pobj |
protein,of |
R4282 |
T15161 |
T15162 |
advmod |
in,vivo |
R4283 |
T15162 |
T15158 |
conj |
vivo,vitro |
R4284 |
T15032 |
T15023 |
punct |
", ",localizes |
R4285 |
T15163 |
T15105 |
punct |
.,show |
R4286 |
T15165 |
T15166 |
csubj |
Immunostaining,shows |
R4287 |
T15033 |
T15023 |
nsubj |
it,localizes |
R4288 |
T15034 |
T15023 |
advmod |
normally,localizes |
R4289 |
T15167 |
T15168 |
det |
the,kidneys |
R429 |
T2650 |
T2651 |
amod |
distinct,regions |
R4290 |
T15168 |
T15165 |
dobj |
kidneys,Immunostaining |
R4291 |
T15169 |
T15168 |
prep |
of,kidneys |
R4292 |
T15170 |
T15171 |
amod |
homozygous,mice |
R4293 |
T15035 |
T14990 |
punct |
.,demonstrated |
R4294 |
T15171 |
T15169 |
pobj |
mice,of |
R4295 |
T15172 |
T15173 |
compound |
Aqp2F204V,F204V |
R4296 |
T15173 |
T15171 |
compound |
F204V,mice |
R4297 |
T15037 |
T15038 |
det |
The,mechanism |
R4298 |
T15174 |
T15173 |
punct |
/,F204V |
R4299 |
T15175 |
T15176 |
mark |
that,mediate |
R430 |
T2651 |
T2649 |
pobj |
regions,to |
R4300 |
T15176 |
T15166 |
ccomp |
mediate,shows |
R4301 |
T15177 |
T15178 |
det |
the,cells |
R4302 |
T15038 |
T15040 |
nsubj |
mechanism,seems |
R4303 |
T15178 |
T15176 |
nsubj |
cells,mediate |
R4304 |
T15179 |
T15180 |
npadvmod |
mutant,expressing |
R4305 |
T15039 |
T15038 |
amod |
same,mechanism |
R4306 |
T15180 |
T15178 |
amod |
expressing,cells |
R4307 |
T15181 |
T15180 |
punct |
-,expressing |
R4308 |
T15182 |
T15183 |
amod |
collecting,duct |
R4309 |
T15183 |
T15178 |
compound |
duct,cells |
R431 |
T2652 |
T2651 |
prep |
of,regions |
R4310 |
T15184 |
T15176 |
aux |
can,mediate |
R4311 |
T15185 |
T15176 |
neg |
not,mediate |
R4312 |
T15186 |
T15187 |
compound |
water,reabsorption |
R4313 |
T15041 |
T15042 |
aux |
to,apply |
R4314 |
T15187 |
T15176 |
dobj |
reabsorption,mediate |
R4315 |
T15188 |
T15176 |
punct |
", ",mediate |
R4316 |
T15189 |
T15190 |
mark |
because,fails |
R4317 |
T15190 |
T15176 |
advcl |
fails,mediate |
R4318 |
T15191 |
T15190 |
nsubj |
it,fails |
R4319 |
T15042 |
T15040 |
xcomp |
apply,seems |
R432 |
T2653 |
T2654 |
det |
the,PM |
R4320 |
T15192 |
T15193 |
aux |
to,insert |
R4321 |
T15193 |
T15190 |
xcomp |
insert,fails |
R4322 |
T15043 |
T15044 |
advmod |
in,vivo |
R4323 |
T15194 |
T15193 |
prep |
into,insert |
R4324 |
T15195 |
T15196 |
det |
the,membrane |
R4325 |
T15196 |
T15194 |
pobj |
membrane,into |
R4326 |
T15044 |
T15042 |
advmod |
vivo,apply |
R4327 |
T15197 |
T15196 |
amod |
apical,membrane |
R4328 |
T15198 |
T15196 |
compound |
plasma,membrane |
R4329 |
T15199 |
T15193 |
prep |
in,insert |
R433 |
T2654 |
T2652 |
pobj |
PM,of |
R4330 |
T15045 |
T15042 |
prep |
with,apply |
R4331 |
T15200 |
T15199 |
pobj |
response,in |
R4332 |
T15046 |
T15047 |
nmod |
Aqp2F204V,mice |
R4333 |
T15047 |
T15045 |
pobj |
mice,with |
R4334 |
T15048 |
T15046 |
punct |
/,Aqp2F204V |
R4335 |
T15201 |
T15200 |
prep |
to,response |
R4336 |
T15049 |
T15046 |
punct |
+,Aqp2F204V |
R4337 |
T15050 |
T15040 |
punct |
.,seems |
R4338 |
T15202 |
T15201 |
pobj |
dDAVP,to |
R4339 |
T15203 |
T15166 |
punct |
.,shows |
R434 |
T2655 |
T2648 |
punct |
;,routed |
R4340 |
T15052 |
T15053 |
prep |
In,interact |
R4341 |
T15205 |
T15206 |
nsubj |
This,is |
R4342 |
T15054 |
T15052 |
pobj |
support,In |
R4343 |
T15207 |
T15208 |
det |
this,proof |
R4344 |
T15208 |
T15206 |
attr |
proof,is |
R4345 |
T15209 |
T15208 |
amod |
first,proof |
R4346 |
T15055 |
T15054 |
prep |
of,support |
R4347 |
T15210 |
T15211 |
advmod |
in,vivo |
R4348 |
T15211 |
T15208 |
amod |
vivo,proof |
R4349 |
T15212 |
T15208 |
prep |
of,proof |
R435 |
T2656 |
T2648 |
prep |
for,routed |
R4350 |
T15267 |
T15268 |
advmod |
Thus,proposed |
R4351 |
T15213 |
T15214 |
det |
a,hypothesis |
R4352 |
T15214 |
T15212 |
pobj |
hypothesis,of |
R4353 |
T15215 |
T15216 |
amod |
long,standing |
R4354 |
T15216 |
T15214 |
amod |
standing,hypothesis |
R4355 |
T15217 |
T15216 |
punct |
-,standing |
R4356 |
T15269 |
T15268 |
punct |
", ",proposed |
R4357 |
T15218 |
T15219 |
dep |
that,comes |
R4358 |
T15219 |
T15214 |
relcl |
comes,hypothesis |
R4359 |
T15220 |
T15219 |
prep |
from,comes |
R436 |
T2657 |
T2656 |
pobj |
example,for |
R4360 |
T15221 |
T15222 |
advmod |
in,vitro |
R4361 |
T15222 |
T15223 |
amod |
vitro,studies |
R4362 |
T15223 |
T15220 |
pobj |
studies,from |
R4363 |
T15224 |
T15223 |
prep |
with,studies |
R4364 |
T15270 |
T15268 |
nsubjpass |
misfolding,proposed |
R4365 |
T15225 |
T15226 |
amod |
recessive,mutations |
R4366 |
T15226 |
T15224 |
pobj |
mutations,with |
R4367 |
T15227 |
T15226 |
compound |
Aqp2,mutations |
R4368 |
T15228 |
T15206 |
punct |
.,is |
R4369 |
T15271 |
T15270 |
punct |
", ",misfolding |
R437 |
T2658 |
T2648 |
punct |
", ",routed |
R4370 |
T15230 |
T15231 |
nsubj |
Transfection,shows |
R4371 |
T15272 |
T15270 |
conj |
retention,misfolding |
R4372 |
T15232 |
T15230 |
prep |
into,Transfection |
R4373 |
T15233 |
T15234 |
compound |
MDCK,cells |
R4374 |
T15273 |
T15272 |
prep |
in,retention |
R4375 |
T15234 |
T15232 |
pobj |
cells,into |
R4376 |
T15235 |
T15230 |
prep |
of,Transfection |
R4377 |
T15236 |
T15235 |
pobj |
any,of |
R4378 |
T15274 |
T15275 |
det |
the,ER |
R4379 |
T15237 |
T15236 |
prep |
of,any |
R438 |
T2659 |
T2648 |
nsubjpass |
AQP2,routed |
R4380 |
T15238 |
T15239 |
amod |
several,mutations |
R4381 |
T15239 |
T15237 |
pobj |
mutations,of |
R4382 |
T15275 |
T15273 |
pobj |
ER,in |
R4383 |
T15240 |
T15239 |
compound |
Aqp2,mutations |
R4384 |
T15241 |
T15239 |
acl |
corresponding,mutations |
R4385 |
T15276 |
T15272 |
punct |
", ",retention |
R4386 |
T15242 |
T15241 |
prep |
to,corresponding |
R4387 |
T15243 |
T15244 |
amod |
recessive,alleles |
R4388 |
T15244 |
T15242 |
pobj |
alleles,to |
R4389 |
T15245 |
T15244 |
amod |
human,alleles |
R439 |
T2660 |
T2648 |
auxpass |
is,routed |
R4390 |
T15277 |
T15272 |
cc |
and,retention |
R4391 |
T15246 |
T15247 |
amod |
abnormal,localization |
R4392 |
T15247 |
T15231 |
dobj |
localization,shows |
R4393 |
T15278 |
T15272 |
conj |
failure,retention |
R4394 |
T15248 |
T15247 |
amod |
subcellular,localization |
R4395 |
T15249 |
T15250 |
punct |
[,25 |
R4396 |
T15279 |
T15280 |
aux |
to,translocate |
R4397 |
T15250 |
T15247 |
parataxis |
25,localization |
R4398 |
T15251 |
T15250 |
punct |
],25 |
R4399 |
T15252 |
T15247 |
punct |
", ",localization |
R440 |
T2661 |
T2648 |
prep |
to,routed |
R4400 |
T15280 |
T15278 |
acl |
translocate,failure |
R4401 |
T15253 |
T15254 |
punct |
[,27 |
R4402 |
T15254 |
T15247 |
parataxis |
27,localization |
R4403 |
T15255 |
T15254 |
punct |
],27 |
R4404 |
T15281 |
T15280 |
prep |
in,translocate |
R4405 |
T15256 |
T15247 |
cc |
and,localization |
R4406 |
T15257 |
T15247 |
conj |
failure,localization |
R4407 |
T15258 |
T15259 |
aux |
to,translocate |
R4408 |
T15282 |
T15281 |
pobj |
response,in |
R4409 |
T15259 |
T15257 |
acl |
translocate,failure |
R441 |
T2662 |
T2663 |
det |
the,membrane |
R4410 |
T15260 |
T15259 |
advmod |
appropriately,translocate |
R4411 |
T15261 |
T15259 |
prep |
to,translocate |
R4412 |
T15283 |
T15282 |
prep |
to,response |
R4413 |
T15262 |
T15263 |
det |
the,membrane |
R4414 |
T15263 |
T15261 |
pobj |
membrane,to |
R4415 |
T15264 |
T15263 |
compound |
plasma,membrane |
R4416 |
T15265 |
T15231 |
punct |
.,shows |
R4417 |
T15284 |
T15283 |
pobj |
dDAVP,to |
R4418 |
T15285 |
T15268 |
auxpass |
were,proposed |
R4419 |
T15286 |
T15268 |
prep |
as,proposed |
R442 |
T2663 |
T2661 |
pobj |
membrane,to |
R4420 |
T15287 |
T15288 |
det |
the,mechanism |
R4421 |
T15288 |
T15286 |
pobj |
mechanism,as |
R4422 |
T15289 |
T15288 |
prep |
for,mechanism |
R4423 |
T15290 |
T15291 |
amod |
autosomal,NDI |
R4424 |
T15291 |
T15289 |
pobj |
NDI,for |
R4425 |
T15292 |
T15291 |
amod |
recessive,NDI |
R4426 |
T15293 |
T15268 |
punct |
.,proposed |
R4427 |
T15295 |
T15296 |
advmod |
Here,prove |
R4428 |
T15297 |
T15296 |
nsubj |
we,prove |
R4429 |
T15298 |
T15296 |
preconj |
not,prove |
R443 |
T2664 |
T2663 |
amod |
apical,membrane |
R4430 |
T15299 |
T15298 |
advmod |
only,not |
R4431 |
T15300 |
T15301 |
det |
this,hypothesis |
R4432 |
T15301 |
T15296 |
dobj |
hypothesis,prove |
R4433 |
T15302 |
T15296 |
cc |
but,prove |
R4434 |
T15303 |
T15302 |
advmod |
also,but |
R4435 |
T15304 |
T15296 |
conj |
establish,prove |
R4436 |
T15305 |
T15306 |
det |
a,model |
R4437 |
T15306 |
T15304 |
dobj |
model,establish |
R4438 |
T15307 |
T15306 |
amod |
useful,model |
R4439 |
T15308 |
T15306 |
prep |
for,model |
R444 |
T2665 |
T2663 |
prep |
of,membrane |
R4440 |
T15309 |
T15310 |
amod |
human,NDI |
R4441 |
T15310 |
T15308 |
pobj |
NDI,for |
R4442 |
T15311 |
T15296 |
punct |
.,prove |
R4443 |
T15313 |
T15314 |
det |
This,model |
R4444 |
T15314 |
T15316 |
nsubj |
model,provides |
R4445 |
T15315 |
T15314 |
compound |
mouse,model |
R4446 |
T15317 |
T15314 |
prep |
of,model |
R4447 |
T15318 |
T15317 |
pobj |
NDI,of |
R4448 |
T15319 |
T15314 |
prep |
based,model |
R4449 |
T15320 |
T15319 |
prep |
on,based |
R445 |
T2666 |
T2665 |
pobj |
cells,of |
R4450 |
T15321 |
T15322 |
det |
an,allele |
R4451 |
T15322 |
T15320 |
pobj |
allele,on |
R4452 |
T15323 |
T15322 |
compound |
Aqp2,allele |
R4453 |
T15324 |
T15325 |
dep |
that,rescued |
R4454 |
T15325 |
T15322 |
relcl |
rescued,allele |
R4455 |
T15326 |
T15325 |
aux |
can,rescued |
R4456 |
T15327 |
T15325 |
auxpass |
be,rescued |
R4457 |
T15328 |
T15329 |
det |
the,opportunity |
R4458 |
T15329 |
T15316 |
dobj |
opportunity,provides |
R4459 |
T15330 |
T15331 |
aux |
to,test |
R446 |
T2667 |
T2666 |
acl |
surrounding,cells |
R4460 |
T15331 |
T15329 |
acl |
test,opportunity |
R4461 |
T15332 |
T15331 |
dobj |
therapies,test |
R4462 |
T15333 |
T15332 |
punct |
", ",therapies |
R4463 |
T15334 |
T15332 |
prep |
including,therapies |
R4464 |
T15335 |
T15336 |
compound |
gene,therapy |
R4465 |
T15336 |
T15334 |
pobj |
therapy,including |
R4466 |
T15337 |
T15332 |
punct |
", ",therapies |
R4467 |
T15338 |
T15339 |
dep |
that,promote |
R4468 |
T15339 |
T15332 |
relcl |
promote,therapies |
R4469 |
T15340 |
T15339 |
aux |
may,promote |
R447 |
T2668 |
T2669 |
det |
the,duct |
R4470 |
T15341 |
T15342 |
amod |
proper,localization |
R4471 |
T15342 |
T15339 |
dobj |
localization,promote |
R4472 |
T15343 |
T15342 |
amod |
subcellular,localization |
R4473 |
T15344 |
T15316 |
punct |
.,provides |
R4474 |
T15508 |
T15507 |
prep |
of,Generation |
R4475 |
T15509 |
T15510 |
compound |
ENU,mice |
R4476 |
T15510 |
T15508 |
pobj |
mice,of |
R4477 |
T15511 |
T15507 |
cc |
and,Generation |
R4478 |
T15512 |
T15507 |
conj |
housing,Generation |
R4479 |
T15513 |
T15512 |
punct |
.,housing |
R448 |
T2669 |
T2667 |
dobj |
duct,surrounding |
R4480 |
T15515 |
T15516 |
nmod |
ENU,mice |
R4481 |
T15516 |
T15521 |
nsubjpass |
mice,generated |
R4482 |
T15517 |
T15516 |
amod |
mutagenized,mice |
R4483 |
T15518 |
T15516 |
nmod |
C57BL,mice |
R4484 |
T15519 |
T15518 |
punct |
/,C57BL |
R4485 |
T15520 |
T15518 |
nummod |
6,C57BL |
R4486 |
T15522 |
T15521 |
auxpass |
were,generated |
R4487 |
T15523 |
T15524 |
mark |
as,described |
R4488 |
T15524 |
T15521 |
advcl |
described,generated |
R4489 |
T15525 |
T15526 |
punct |
[,19 |
R449 |
T2670 |
T2669 |
amod |
collecting,duct |
R4490 |
T15526 |
T15521 |
parataxis |
19,generated |
R4491 |
T15527 |
T15526 |
punct |
],19 |
R4492 |
T15528 |
T15521 |
punct |
.,generated |
R4493 |
T15530 |
T15531 |
nsubjpass |
Mice,maintained |
R4494 |
T15532 |
T15531 |
auxpass |
were,maintained |
R4495 |
T15533 |
T15531 |
prep |
by,maintained |
R4496 |
T15534 |
T15533 |
pcomp |
backcrossing,by |
R4497 |
T15535 |
T15536 |
amod |
affected,animals |
R4498 |
T15536 |
T15534 |
dobj |
animals,backcrossing |
R4499 |
T15537 |
T15534 |
prep |
to,backcrossing |
R450 |
T2671 |
T2648 |
punct |
", ",routed |
R4500 |
T15538 |
T15537 |
pobj |
C57BL,to |
R4501 |
T15539 |
T15538 |
punct |
/,C57BL |
R4502 |
T15540 |
T15538 |
nummod |
6,C57BL |
R4503 |
T15541 |
T15531 |
cc |
and,maintained |
R4504 |
T15542 |
T15531 |
conj |
housed,maintained |
R4505 |
T15543 |
T15542 |
prep |
in,housed |
R4506 |
T15544 |
T15545 |
det |
the,Institute |
R4507 |
T15545 |
T15543 |
pobj |
Institute,in |
R4508 |
T15546 |
T15545 |
compound |
Genomics,Institute |
R4509 |
T15547 |
T15545 |
prep |
of,Institute |
R451 |
T2672 |
T2673 |
mark |
whereas,inserted |
R4510 |
T15548 |
T15549 |
det |
the,facility |
R4511 |
T15549 |
T15547 |
pobj |
facility,of |
R4512 |
T15550 |
T15551 |
compound |
Novartis,Foundation |
R4513 |
T15551 |
T15549 |
compound |
Foundation,facility |
R4514 |
T15552 |
T15551 |
compound |
Research,Foundation |
R4515 |
T15553 |
T15554 |
compound |
Specific,Pathogen |
R4516 |
T15554 |
T15555 |
compound |
Pathogen,Free |
R4517 |
T15555 |
T15549 |
compound |
Free,facility |
R4518 |
T15556 |
T15549 |
compound |
animal,facility |
R4519 |
T15557 |
T15558 |
punct |
(,Jolla |
R452 |
T2673 |
T2648 |
advcl |
inserted,routed |
R4520 |
T15558 |
T15549 |
parataxis |
Jolla,facility |
R4521 |
T15559 |
T15558 |
compound |
La,Jolla |
R4522 |
T15560 |
T15558 |
punct |
", ",Jolla |
R4523 |
T15561 |
T15558 |
npadvmod |
California,Jolla |
R4524 |
T15562 |
T15558 |
punct |
", ",Jolla |
R4525 |
T15563 |
T15564 |
compound |
United,States |
R4526 |
T15564 |
T15558 |
npadvmod |
States,Jolla |
R4527 |
T15565 |
T15558 |
punct |
),Jolla |
R4528 |
T15566 |
T15531 |
punct |
.,maintained |
R4529 |
T15568 |
T15569 |
det |
All,procedures |
R453 |
T2674 |
T2675 |
amod |
other,aquaporins |
R4530 |
T15569 |
T15570 |
nsubjpass |
procedures,approved |
R4531 |
T15571 |
T15570 |
auxpass |
were,approved |
R4532 |
T15572 |
T15570 |
agent |
by,approved |
R4533 |
T15573 |
T15574 |
det |
the,Institute |
R4534 |
T15574 |
T15572 |
pobj |
Institute,by |
R4535 |
T15575 |
T15574 |
compound |
Genomics,Institute |
R4536 |
T15576 |
T15574 |
prep |
of,Institute |
R4537 |
T15577 |
T15578 |
det |
the,Committee |
R4538 |
T15578 |
T15576 |
pobj |
Committee,of |
R4539 |
T15579 |
T15580 |
nmod |
Novartis,Foundation |
R454 |
T2675 |
T2673 |
nsubjpass |
aquaporins,inserted |
R4540 |
T15580 |
T15578 |
nmod |
Foundation,Committee |
R4541 |
T15581 |
T15580 |
nmod |
Research,Foundation |
R4542 |
T15582 |
T15583 |
nmod |
Institutional,Animal |
R4543 |
T15583 |
T15578 |
nmod |
Animal,Committee |
R4544 |
T15584 |
T15583 |
appos |
Care,Animal |
R4545 |
T15585 |
T15584 |
cc |
and,Care |
R4546 |
T15586 |
T15584 |
conj |
Use,Care |
R4547 |
T15587 |
T15570 |
punct |
.,approved |
R4548 |
T15901 |
T15900 |
punct |
.,Constructs |
R4549 |
T15903 |
T15904 |
det |
The,sequence |
R455 |
T2676 |
T2675 |
punct |
(,aquaporins |
R4550 |
T15904 |
T15907 |
nsubjpass |
sequence,digested |
R4551 |
T15905 |
T15904 |
amod |
complete,sequence |
R4552 |
T15906 |
T15904 |
compound |
coding,sequence |
R4553 |
T15908 |
T15904 |
prep |
of,sequence |
R4554 |
T15909 |
T15910 |
compound |
mouse,AQP2 |
R4555 |
T15910 |
T15908 |
pobj |
AQP2,of |
R4556 |
T15911 |
T15904 |
prep |
from,sequence |
R4557 |
T15912 |
T15913 |
det |
an,clone |
R4558 |
T15913 |
T15911 |
pobj |
clone,from |
R4559 |
T15914 |
T15913 |
compound |
IMAGE,clone |
R456 |
T2677 |
T2675 |
appos |
AQP3,aquaporins |
R4560 |
T15915 |
T15907 |
auxpass |
was,digested |
R4561 |
T15916 |
T15907 |
prep |
from,digested |
R4562 |
T15917 |
T15918 |
det |
the,plasmid |
R4563 |
T15918 |
T15916 |
pobj |
plasmid,from |
R4564 |
T15919 |
T15918 |
compound |
pCMV⋅SPORT6,plasmid |
R4565 |
T15920 |
T15907 |
prep |
with,digested |
R4566 |
T15921 |
T15920 |
pobj |
EcoRI,with |
R4567 |
T15922 |
T15921 |
cc |
and,EcoRI |
R4568 |
T15923 |
T15921 |
conj |
NotI,EcoRI |
R4569 |
T15924 |
T15907 |
cc |
and,digested |
R457 |
T2678 |
T2677 |
cc |
or,AQP3 |
R4570 |
T15925 |
T15907 |
conj |
ligated,digested |
R4571 |
T15926 |
T15925 |
prep |
into,ligated |
R4572 |
T15927 |
T15926 |
pobj |
pcDNA3.1,into |
R4573 |
T15928 |
T15929 |
punct |
(,Invitrogen |
R4574 |
T15929 |
T15927 |
parataxis |
Invitrogen,pcDNA3.1 |
R4575 |
T15930 |
T15929 |
punct |
", ",Invitrogen |
R4576 |
T15931 |
T15929 |
npadvmod |
Carlsbad,Invitrogen |
R4577 |
T15932 |
T15929 |
punct |
", ",Invitrogen |
R4578 |
T15933 |
T15929 |
npadvmod |
California,Invitrogen |
R4579 |
T15934 |
T15929 |
punct |
", ",Invitrogen |
R458 |
T2679 |
T2677 |
conj |
4,AQP3 |
R4580 |
T15935 |
T15936 |
compound |
United,States |
R4581 |
T15936 |
T15929 |
npadvmod |
States,Invitrogen |
R4582 |
T15937 |
T15929 |
punct |
),Invitrogen |
R4583 |
T15938 |
T15907 |
punct |
.,digested |
R4584 |
T15940 |
T15941 |
det |
The,mutation |
R4585 |
T15941 |
T15943 |
nsubjpass |
mutation,introduced |
R4586 |
T15942 |
T15941 |
compound |
F204V,mutation |
R4587 |
T15944 |
T15943 |
auxpass |
was,introduced |
R4588 |
T15945 |
T15943 |
prep |
by,introduced |
R4589 |
T15946 |
T15947 |
npadvmod |
site,directed |
R459 |
T2680 |
T2673 |
punct |
),inserted |
R4590 |
T15947 |
T15949 |
amod |
directed,mutagenesis |
R4591 |
T15948 |
T15947 |
punct |
-,directed |
R4592 |
T15949 |
T15945 |
pobj |
mutagenesis,by |
R4593 |
T15950 |
T15951 |
punct |
(,Stratagene |
R4594 |
T15951 |
T15949 |
parataxis |
Stratagene,mutagenesis |
R4595 |
T15952 |
T15951 |
punct |
", ",Stratagene |
R4596 |
T15953 |
T15954 |
compound |
La,Jolla |
R4597 |
T15954 |
T15951 |
npadvmod |
Jolla,Stratagene |
R4598 |
T15955 |
T15951 |
punct |
", ",Stratagene |
R4599 |
T15956 |
T15951 |
npadvmod |
California,Stratagene |
R460 |
T2681 |
T2673 |
auxpass |
are,inserted |
R4600 |
T15957 |
T15951 |
punct |
", ",Stratagene |
R4601 |
T15958 |
T15959 |
compound |
United,States |
R4602 |
T15959 |
T15951 |
npadvmod |
States,Stratagene |
R4603 |
T15960 |
T15951 |
punct |
),Stratagene |
R4604 |
T15961 |
T15943 |
punct |
", ",introduced |
R4605 |
T15962 |
T15943 |
advcl |
using,introduced |
R4606 |
T15963 |
T15964 |
det |
the,oligonucleotide |
R4607 |
T15964 |
T15962 |
dobj |
oligonucleotide,using |
R4608 |
T15965 |
T15964 |
compound |
sense,oligonucleotide |
R4609 |
T15966 |
T15967 |
nummod |
5,GATGATCACTGGGTCGTCTGGATCGGACCCC |
R461 |
T2682 |
T2673 |
prep |
into,inserted |
R4610 |
T15967 |
T15964 |
appos |
GATGATCACTGGGTCGTCTGGATCGGACCCC,oligonucleotide |
R4611 |
T15968 |
T15966 |
punct |
′,5 |
R4612 |
T15969 |
T15967 |
punct |
-,GATGATCACTGGGTCGTCTGGATCGGACCCC |
R4613 |
T15970 |
T15967 |
punct |
-,GATGATCACTGGGTCGTCTGGATCGGACCCC |
R4614 |
T15971 |
T15967 |
nummod |
3,GATGATCACTGGGTCGTCTGGATCGGACCCC |
R4615 |
T15972 |
T15967 |
punct |
′,GATGATCACTGGGTCGTCTGGATCGGACCCC |
R4616 |
T15973 |
T15964 |
punct |
", ",oligonucleotide |
R4617 |
T15974 |
T15964 |
cc |
and,oligonucleotide |
R4618 |
T15975 |
T15976 |
amod |
antisense,oligonucleotide |
R4619 |
T15976 |
T15964 |
conj |
oligonucleotide,oligonucleotide |
R462 |
T2683 |
T2684 |
det |
the,face |
R4620 |
T15977 |
T15978 |
nummod |
5,GGGGTCCGATCCAGACGACCCAGTGATCATC |
R4621 |
T15978 |
T15976 |
appos |
GGGGTCCGATCCAGACGACCCAGTGATCATC,oligonucleotide |
R4622 |
T15979 |
T15977 |
punct |
′,5 |
R4623 |
T15980 |
T15978 |
punct |
-,GGGGTCCGATCCAGACGACCCAGTGATCATC |
R4624 |
T15981 |
T15978 |
punct |
-,GGGGTCCGATCCAGACGACCCAGTGATCATC |
R4625 |
T15982 |
T15978 |
nummod |
3,GGGGTCCGATCCAGACGACCCAGTGATCATC |
R4626 |
T15983 |
T15978 |
punct |
′,GGGGTCCGATCCAGACGACCCAGTGATCATC |
R4627 |
T15984 |
T15943 |
punct |
.,introduced |
R4628 |
T15986 |
T15987 |
aux |
To,generate |
R4629 |
T15987 |
T15988 |
advcl |
generate,used |
R463 |
T2684 |
T2682 |
pobj |
face,into |
R4630 |
T15989 |
T15990 |
compound |
GFP,fusions |
R4631 |
T15990 |
T15987 |
dobj |
fusions,generate |
R4632 |
T15991 |
T15990 |
prep |
of,fusions |
R4633 |
T15992 |
T15991 |
pobj |
AQP2,of |
R4634 |
T15993 |
T15988 |
punct |
", ",used |
R4635 |
T15994 |
T15995 |
det |
the,construct |
R4636 |
T15995 |
T15988 |
nsubjpass |
construct,used |
R4637 |
T15996 |
T15995 |
compound |
pCMV⋅SPORT6,construct |
R4638 |
T15997 |
T15995 |
compound |
AQP2,construct |
R4639 |
T15998 |
T15988 |
auxpass |
was,used |
R464 |
T2685 |
T2684 |
amod |
basolateral,face |
R4640 |
T15999 |
T15988 |
prep |
in,used |
R4641 |
T16000 |
T16001 |
det |
a,reaction |
R4642 |
T16001 |
T15999 |
pobj |
reaction,in |
R4643 |
T16002 |
T16001 |
compound |
PCR,reaction |
R4644 |
T16003 |
T16001 |
prep |
with,reaction |
R4645 |
T16004 |
T16005 |
det |
the,Sp6 |
R4646 |
T16005 |
T16003 |
pobj |
Sp6,with |
R4647 |
T16006 |
T16005 |
compound |
primers,Sp6 |
R4648 |
T16007 |
T16005 |
cc |
and,Sp6 |
R4649 |
T16008 |
T16009 |
nummod |
5,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R465 |
T2686 |
T2648 |
punct |
.,routed |
R4650 |
T16009 |
T16005 |
conj |
GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG,Sp6 |
R4651 |
T16010 |
T16008 |
punct |
′,5 |
R4652 |
T16011 |
T16009 |
punct |
-,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4653 |
T16012 |
T16009 |
punct |
-,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4654 |
T16013 |
T16009 |
nummod |
3,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4655 |
T16014 |
T16009 |
punct |
′,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4656 |
T16015 |
T16016 |
aux |
to,remove |
R4657 |
T16016 |
T15988 |
advcl |
remove,used |
R4658 |
T16017 |
T16018 |
det |
the,codon |
R4659 |
T16018 |
T16016 |
dobj |
codon,remove |
R466 |
T2688 |
T2689 |
prep |
Unlike,inserted |
R4660 |
T16019 |
T16018 |
compound |
stop,codon |
R4661 |
T16020 |
T16018 |
prep |
of,codon |
R4662 |
T16021 |
T16020 |
pobj |
AQP2,of |
R4663 |
T16022 |
T15988 |
punct |
.,used |
R4664 |
T16024 |
T16025 |
det |
The,product |
R4665 |
T16025 |
T16026 |
nsubjpass |
product,digested |
R4666 |
T16027 |
T16026 |
auxpass |
was,digested |
R4667 |
T16028 |
T16026 |
prep |
with,digested |
R4668 |
T16029 |
T16028 |
pobj |
KpnI,with |
R4669 |
T16030 |
T16029 |
cc |
and,KpnI |
R467 |
T2690 |
T2691 |
det |
all,members |
R4670 |
T16031 |
T16029 |
conj |
BamHI,KpnI |
R4671 |
T16032 |
T16026 |
cc |
and,digested |
R4672 |
T16033 |
T16026 |
conj |
ligated,digested |
R4673 |
T16034 |
T16033 |
prep |
into,ligated |
R4674 |
T16035 |
T16036 |
compound |
pEGFP,N2 |
R4675 |
T16036 |
T16034 |
pobj |
N2,into |
R4676 |
T16037 |
T16036 |
punct |
-,N2 |
R4677 |
T16038 |
T16039 |
punct |
(,Biosciences |
R4678 |
T16039 |
T16036 |
parataxis |
Biosciences,N2 |
R4679 |
T16040 |
T16039 |
compound |
BD,Biosciences |
R468 |
T2691 |
T2688 |
pobj |
members,Unlike |
R4680 |
T16041 |
T16039 |
punct |
", ",Biosciences |
R4681 |
T16042 |
T16043 |
compound |
San,Diego |
R4682 |
T16043 |
T16039 |
npadvmod |
Diego,Biosciences |
R4683 |
T16044 |
T16039 |
punct |
", ",Biosciences |
R4684 |
T16045 |
T16039 |
npadvmod |
California,Biosciences |
R4685 |
T16046 |
T16039 |
punct |
", ",Biosciences |
R4686 |
T16047 |
T16048 |
compound |
United,States |
R4687 |
T16048 |
T16039 |
npadvmod |
States,Biosciences |
R4688 |
T16049 |
T16039 |
punct |
),Biosciences |
R4689 |
T16050 |
T16026 |
punct |
.,digested |
R469 |
T2692 |
T2691 |
amod |
other,members |
R4690 |
T16052 |
T16053 |
det |
The,mutation |
R4691 |
T16053 |
T16055 |
nsubjpass |
mutation,introduced |
R4692 |
T16054 |
T16053 |
compound |
F204V,mutation |
R4693 |
T16056 |
T16055 |
auxpass |
was,introduced |
R4694 |
T16057 |
T16055 |
advcl |
using,introduced |
R4695 |
T16058 |
T16059 |
det |
the,oligonucleotides |
R4696 |
T16059 |
T16057 |
dobj |
oligonucleotides,using |
R4697 |
T16060 |
T16059 |
amod |
same,oligonucleotides |
R4698 |
T16061 |
T16059 |
amod |
mutagenic,oligonucleotides |
R4699 |
T16062 |
T16055 |
punct |
.,introduced |
R470 |
T2693 |
T2691 |
compound |
family,members |
R4700 |
T16399 |
T16400 |
compound |
Cell,culture |
R4701 |
T16401 |
T16400 |
cc |
and,culture |
R4702 |
T16402 |
T16400 |
conj |
generation,culture |
R4703 |
T16403 |
T16400 |
prep |
of,culture |
R4704 |
T16404 |
T16405 |
amod |
stable,lines |
R4705 |
T16405 |
T16403 |
pobj |
lines,of |
R4706 |
T16406 |
T16405 |
compound |
cell,lines |
R4707 |
T16407 |
T16400 |
punct |
.,culture |
R4708 |
T16409 |
T16410 |
compound |
MDCK,cells |
R4709 |
T16410 |
T16411 |
nsubjpass |
cells,cultured |
R471 |
T2694 |
T2689 |
punct |
", ",inserted |
R4710 |
T16412 |
T16413 |
punct |
(,ATCC |
R4711 |
T16413 |
T16410 |
parataxis |
ATCC,cells |
R4712 |
T16414 |
T16413 |
dep |
CCL,ATCC |
R4713 |
T16415 |
T16414 |
punct |
-,CCL |
R4714 |
T16416 |
T16414 |
nummod |
34,CCL |
R4715 |
T16417 |
T16413 |
punct |
;,ATCC |
R4716 |
T16418 |
T16413 |
punct |
", ",ATCC |
R4717 |
T16419 |
T16413 |
npadvmod |
Manassas,ATCC |
R4718 |
T16420 |
T16413 |
punct |
", ",ATCC |
R4719 |
T16421 |
T16413 |
npadvmod |
Virginia,ATCC |
R472 |
T2695 |
T2689 |
nsubjpass |
AQP2,inserted |
R4720 |
T16422 |
T16413 |
punct |
", ",ATCC |
R4721 |
T16423 |
T16424 |
compound |
United,States |
R4722 |
T16424 |
T16413 |
npadvmod |
States,ATCC |
R4723 |
T16425 |
T16413 |
punct |
),ATCC |
R4724 |
T16426 |
T16411 |
auxpass |
were,cultured |
R4725 |
T16427 |
T16411 |
prep |
in,cultured |
R4726 |
T16428 |
T16427 |
pobj |
DMEM,in |
R4727 |
T16429 |
T16430 |
punct |
(,Aldrich |
R4728 |
T16430 |
T16428 |
parataxis |
Aldrich,DMEM |
R4729 |
T16431 |
T16430 |
compound |
Sigma,Aldrich |
R473 |
T2696 |
T2689 |
auxpass |
is,inserted |
R4730 |
T16432 |
T16430 |
punct |
-,Aldrich |
R4731 |
T16433 |
T16430 |
punct |
", ",Aldrich |
R4732 |
T16434 |
T16435 |
compound |
St.,Louis |
R4733 |
T16435 |
T16430 |
npadvmod |
Louis,Aldrich |
R4734 |
T16436 |
T16430 |
punct |
", ",Aldrich |
R4735 |
T16437 |
T16430 |
npadvmod |
Missouri,Aldrich |
R4736 |
T16438 |
T16430 |
punct |
", ",Aldrich |
R4737 |
T16439 |
T16440 |
compound |
United,States |
R4738 |
T16440 |
T16430 |
npadvmod |
States,Aldrich |
R4739 |
T16441 |
T16430 |
punct |
),Aldrich |
R474 |
T2697 |
T2689 |
neg |
not,inserted |
R4740 |
T16442 |
T16411 |
dep |
supplemented,cultured |
R4741 |
T16443 |
T16442 |
prep |
with,supplemented |
R4742 |
T16444 |
T16445 |
nummod |
10,% |
R4743 |
T16445 |
T16446 |
compound |
%,FBS |
R4744 |
T16446 |
T16443 |
pobj |
FBS,with |
R4745 |
T16447 |
T16448 |
punct |
(,Aldrich |
R4746 |
T16448 |
T16446 |
parataxis |
Aldrich,FBS |
R4747 |
T16449 |
T16448 |
compound |
Sigma,Aldrich |
R4748 |
T16450 |
T16448 |
punct |
-,Aldrich |
R4749 |
T16451 |
T16448 |
punct |
),Aldrich |
R475 |
T2698 |
T2689 |
advmod |
constitutively,inserted |
R4750 |
T16452 |
T16446 |
punct |
", ",FBS |
R4751 |
T16453 |
T16454 |
nummod |
100,U |
R4752 |
T16454 |
T16446 |
conj |
U,FBS |
R4753 |
T16455 |
T16456 |
punct |
/,ml |
R4754 |
T16456 |
T16454 |
prep |
ml,U |
R4755 |
T16457 |
T16454 |
prep |
of,U |
R4756 |
T16458 |
T16457 |
pobj |
penicillin,of |
R4757 |
T16459 |
T16454 |
punct |
", ",U |
R4758 |
T16460 |
T16454 |
cc |
and,U |
R4759 |
T16461 |
T16462 |
nummod |
100,μg |
R476 |
T2699 |
T2689 |
prep |
into,inserted |
R4760 |
T16462 |
T16454 |
conj |
μg,U |
R4761 |
T16463 |
T16464 |
punct |
/,ml |
R4762 |
T16464 |
T16462 |
prep |
ml,μg |
R4763 |
T16465 |
T16462 |
prep |
of,μg |
R4764 |
T16466 |
T16465 |
pobj |
streptomycin,of |
R4765 |
T16467 |
T16446 |
prep |
at,FBS |
R4766 |
T16468 |
T16469 |
nummod |
37,°C |
R4767 |
T16469 |
T16467 |
pobj |
°C,at |
R4768 |
T16470 |
T16446 |
prep |
in,FBS |
R4769 |
T16471 |
T16472 |
nummod |
5,% |
R477 |
T2700 |
T2701 |
det |
the,membrane |
R4770 |
T16472 |
T16473 |
compound |
%,CO2 |
R4771 |
T16473 |
T16470 |
pobj |
CO2,in |
R4772 |
T16474 |
T16411 |
punct |
.,cultured |
R4773 |
T16476 |
T16477 |
aux |
To,generate |
R4774 |
T16477 |
T16478 |
advcl |
generate,transfected |
R4775 |
T16479 |
T16480 |
amod |
stable,lines |
R4776 |
T16480 |
T16477 |
dobj |
lines,generate |
R4777 |
T16481 |
T16480 |
compound |
MDCK,lines |
R4778 |
T16482 |
T16480 |
compound |
cell,lines |
R4779 |
T16483 |
T16478 |
punct |
", ",transfected |
R478 |
T2701 |
T2699 |
pobj |
membrane,into |
R4780 |
T16484 |
T16478 |
nsubjpass |
cells,transfected |
R4781 |
T16485 |
T16478 |
auxpass |
were,transfected |
R4782 |
T16486 |
T16478 |
advcl |
using,transfected |
R4783 |
T16487 |
T16486 |
dobj |
Lipofectamine,using |
R4784 |
T16488 |
T16487 |
nummod |
2000,Lipofectamine |
R4785 |
T16489 |
T16490 |
punct |
(,Invitrogen |
R4786 |
T16490 |
T16487 |
parataxis |
Invitrogen,Lipofectamine |
R4787 |
T16491 |
T16490 |
punct |
),Invitrogen |
R4788 |
T16492 |
T16487 |
cc |
and,Lipofectamine |
R4789 |
T16493 |
T16494 |
det |
the,constructs |
R479 |
T2702 |
T2701 |
compound |
plasma,membrane |
R4790 |
T16494 |
T16487 |
conj |
constructs,Lipofectamine |
R4791 |
T16495 |
T16494 |
compound |
pcDNA3.1,constructs |
R4792 |
T16496 |
T16494 |
compound |
expression,constructs |
R4793 |
T16497 |
T16494 |
punct |
(,constructs |
R4794 |
T16498 |
T16494 |
acl |
containing,constructs |
R4795 |
T16499 |
T16500 |
amod |
wild,type |
R4796 |
T16500 |
T16502 |
compound |
type,AQP2 |
R4797 |
T16501 |
T16500 |
punct |
-,type |
R4798 |
T16502 |
T16498 |
dobj |
AQP2,containing |
R4799 |
T16503 |
T16502 |
punct |
", ",AQP2 |
R480 |
T2703 |
T2689 |
punct |
.,inserted |
R4800 |
T16504 |
T16505 |
compound |
AQP2,F204V |
R4801 |
T16505 |
T16502 |
conj |
F204V,AQP2 |
R4802 |
T16506 |
T16505 |
punct |
-,F204V |
R4803 |
T16507 |
T16505 |
punct |
", ",F204V |
R4804 |
T16508 |
T16505 |
cc |
or,F204V |
R4805 |
T16509 |
T16510 |
det |
no,insert |
R4806 |
T16510 |
T16505 |
conj |
insert,F204V |
R4807 |
T16511 |
T16494 |
punct |
),constructs |
R4808 |
T16512 |
T16478 |
cc |
and,transfected |
R4809 |
T16513 |
T16478 |
conj |
selected,transfected |
R481 |
T2705 |
T2706 |
prep |
Under,resides |
R4810 |
T16514 |
T16513 |
prep |
with,selected |
R4811 |
T16515 |
T16516 |
nummod |
900,μg |
R4812 |
T16516 |
T16517 |
nmod |
μg,G418 |
R4813 |
T16517 |
T16514 |
pobj |
G418,with |
R4814 |
T16518 |
T16519 |
punct |
/,ml |
R4815 |
T16519 |
T16516 |
prep |
ml,μg |
R4816 |
T16520 |
T16521 |
punct |
(,Aldrich |
R4817 |
T16521 |
T16517 |
parataxis |
Aldrich,G418 |
R4818 |
T16522 |
T16521 |
compound |
Sigma,Aldrich |
R4819 |
T16523 |
T16521 |
punct |
-,Aldrich |
R482 |
T2706 |
T2712 |
ccomp |
resides,translocates |
R4820 |
T16524 |
T16521 |
punct |
),Aldrich |
R4821 |
T16525 |
T16478 |
punct |
.,transfected |
R4822 |
T16527 |
T16528 |
amod |
Individual,colonies |
R4823 |
T16528 |
T16529 |
nsubjpass |
colonies,expanded |
R4824 |
T16530 |
T16529 |
auxpass |
were,expanded |
R4825 |
T16531 |
T16532 |
nummod |
14,d |
R4826 |
T16532 |
T16533 |
npadvmod |
d,later |
R4827 |
T16533 |
T16529 |
advmod |
later,expanded |
R4828 |
T16534 |
T16529 |
punct |
.,expanded |
R4829 |
T16536 |
T16537 |
prep |
For,added |
R483 |
T2707 |
T2708 |
amod |
basal,conditions |
R4830 |
T16538 |
T16539 |
det |
the,duration |
R4831 |
T16539 |
T16536 |
pobj |
duration,For |
R4832 |
T16540 |
T16539 |
prep |
of,duration |
R4833 |
T16541 |
T16542 |
det |
these,experiments |
R4834 |
T16542 |
T16540 |
pobj |
experiments,of |
R4835 |
T16543 |
T16537 |
punct |
", ",added |
R4836 |
T16544 |
T16545 |
det |
the,antibiotic |
R4837 |
T16545 |
T16537 |
nsubjpass |
antibiotic,added |
R4838 |
T16546 |
T16537 |
auxpass |
was,added |
R4839 |
T16547 |
T16537 |
advmod |
continually,added |
R484 |
T2708 |
T2705 |
pobj |
conditions,Under |
R4840 |
T16548 |
T16537 |
prep |
to,added |
R4841 |
T16549 |
T16550 |
det |
the,media |
R4842 |
T16550 |
T16548 |
pobj |
media,to |
R4843 |
T16551 |
T16537 |
punct |
.,added |
R4844 |
T16553 |
T16554 |
amod |
Transient,transfections |
R4845 |
T16554 |
T16556 |
nsubjpass |
transfections,carried |
R4846 |
T16555 |
T16554 |
compound |
GFP,transfections |
R4847 |
T16557 |
T16556 |
auxpass |
were,carried |
R4848 |
T16558 |
T16556 |
prt |
out,carried |
R4849 |
T16559 |
T16556 |
prep |
in,carried |
R485 |
T2709 |
T2706 |
punct |
", ",resides |
R4850 |
T16560 |
T16561 |
amod |
subconfluent,lines |
R4851 |
T16561 |
T16559 |
pobj |
lines,in |
R4852 |
T16562 |
T16561 |
amod |
stable,lines |
R4853 |
T16563 |
T16561 |
compound |
cells,lines |
R4854 |
T16564 |
T16556 |
advmod |
also,carried |
R4855 |
T16565 |
T16556 |
advcl |
using,carried |
R4856 |
T16566 |
T16565 |
dobj |
Lipofectamine,using |
R4857 |
T16567 |
T16566 |
nummod |
2000,Lipofectamine |
R4858 |
T16568 |
T16556 |
punct |
.,carried |
R4859 |
T16677 |
T16676 |
prep |
of,Sequencing |
R486 |
T2710 |
T2711 |
det |
the,protein |
R4860 |
T16678 |
T16677 |
pobj |
Aqp2,of |
R4861 |
T16679 |
T16676 |
cc |
and,Sequencing |
R4862 |
T16680 |
T16676 |
conj |
genotyping,Sequencing |
R4863 |
T16681 |
T16680 |
prep |
of,genotyping |
R4864 |
T16682 |
T16681 |
pobj |
mice,of |
R4865 |
T16683 |
T16680 |
punct |
.,genotyping |
R4866 |
T16685 |
T16686 |
det |
All,exons |
R4867 |
T16686 |
T16687 |
nsubjpass |
exons,amplified |
R4868 |
T16688 |
T16686 |
prep |
of,exons |
R4869 |
T16689 |
T16688 |
pobj |
Aqp2,of |
R487 |
T2711 |
T2706 |
nsubj |
protein,resides |
R4870 |
T16690 |
T16687 |
auxpass |
were,amplified |
R4871 |
T16691 |
T16687 |
prep |
from,amplified |
R4872 |
T16692 |
T16693 |
nmod |
mouse,DNA |
R4873 |
T16693 |
T16691 |
pobj |
DNA,from |
R4874 |
T16694 |
T16693 |
amod |
genomic,DNA |
R4875 |
T16695 |
T16687 |
cc |
and,amplified |
R4876 |
T16696 |
T16687 |
conj |
sequenced,amplified |
R4877 |
T16697 |
T16687 |
punct |
.,amplified |
R4878 |
T16699 |
T16700 |
prep |
For,amplified |
R4879 |
T16701 |
T16699 |
pobj |
genotyping,For |
R488 |
T2713 |
T2706 |
prep |
in,resides |
R4880 |
T16702 |
T16700 |
punct |
", ",amplified |
R4881 |
T16703 |
T16700 |
nsubjpass |
exon,amplified |
R4882 |
T16704 |
T16703 |
nummod |
4,exon |
R4883 |
T16705 |
T16700 |
auxpass |
was,amplified |
R4884 |
T16706 |
T16700 |
advcl |
using,amplified |
R4885 |
T16707 |
T16708 |
det |
the,primers |
R4886 |
T16708 |
T16706 |
dobj |
primers,using |
R4887 |
T16709 |
T16710 |
nummod |
5,TCAGAACTTGCCCACTAGCC |
R4888 |
T16710 |
T16708 |
appos |
TCAGAACTTGCCCACTAGCC,primers |
R4889 |
T16711 |
T16709 |
punct |
′,5 |
R489 |
T2714 |
T2715 |
amod |
subapical,vesicles |
R4890 |
T16712 |
T16710 |
punct |
-,TCAGAACTTGCCCACTAGCC |
R4891 |
T16713 |
T16710 |
punct |
-,TCAGAACTTGCCCACTAGCC |
R4892 |
T16714 |
T16710 |
nummod |
3,TCAGAACTTGCCCACTAGCC |
R4893 |
T16715 |
T16710 |
punct |
′,TCAGAACTTGCCCACTAGCC |
R4894 |
T16716 |
T16710 |
cc |
and,TCAGAACTTGCCCACTAGCC |
R4895 |
T16717 |
T16718 |
nummod |
5,TGTAGAGGAGGGAACCGATG |
R4896 |
T16718 |
T16710 |
conj |
TGTAGAGGAGGGAACCGATG,TCAGAACTTGCCCACTAGCC |
R4897 |
T16719 |
T16717 |
punct |
′,5 |
R4898 |
T16720 |
T16718 |
punct |
-,TGTAGAGGAGGGAACCGATG |
R4899 |
T16721 |
T16718 |
punct |
-,TGTAGAGGAGGGAACCGATG |
R490 |
T2715 |
T2713 |
pobj |
vesicles,in |
R4900 |
T16722 |
T16718 |
nummod |
3,TGTAGAGGAGGGAACCGATG |
R4901 |
T16723 |
T16718 |
punct |
′,TGTAGAGGAGGGAACCGATG |
R4902 |
T16724 |
T16700 |
punct |
.,amplified |
R4903 |
T16959 |
T16960 |
compound |
Urine,measurements |
R4904 |
T16961 |
T16960 |
punct |
.,measurements |
R4905 |
T16963 |
T16964 |
amod |
Total,output |
R4906 |
T16964 |
T16966 |
nsubjpass |
output,measured |
R4907 |
T16965 |
T16964 |
compound |
urine,output |
R4908 |
T16967 |
T16966 |
auxpass |
was,measured |
R4909 |
T16968 |
T16966 |
prep |
by,measured |
R491 |
T2716 |
T2715 |
amod |
intracellular,vesicles |
R4910 |
T16969 |
T16970 |
advmod |
separately,housing |
R4911 |
T16970 |
T16968 |
pcomp |
housing,by |
R4912 |
T16971 |
T16972 |
amod |
adult,mice |
R4913 |
T16972 |
T16970 |
dobj |
mice,housing |
R4914 |
T16973 |
T16970 |
prep |
in,housing |
R4915 |
T16974 |
T16975 |
nmod |
Nalgene,Cages |
R4916 |
T16975 |
T16973 |
pobj |
Cages,in |
R4917 |
T16976 |
T16975 |
amod |
Metabolic,Cages |
R4918 |
T16977 |
T16978 |
punct |
(,Minimitter |
R4919 |
T16978 |
T16975 |
parataxis |
Minimitter,Cages |
R492 |
T2717 |
T2712 |
punct |
;,translocates |
R4920 |
T16979 |
T16978 |
punct |
", ",Minimitter |
R4921 |
T16980 |
T16978 |
npadvmod |
Bend,Minimitter |
R4922 |
T16981 |
T16978 |
punct |
", ",Minimitter |
R4923 |
T16982 |
T16978 |
npadvmod |
Oregon,Minimitter |
R4924 |
T16983 |
T16978 |
punct |
", ",Minimitter |
R4925 |
T16984 |
T16985 |
compound |
United,States |
R4926 |
T16985 |
T16978 |
npadvmod |
States,Minimitter |
R4927 |
T16986 |
T16978 |
punct |
),Minimitter |
R4928 |
T16987 |
T16970 |
prep |
for,housing |
R4929 |
T16988 |
T16989 |
quantmod |
2,3 |
R493 |
T2718 |
T2712 |
advmod |
however,translocates |
R4930 |
T16989 |
T16991 |
nummod |
3,d |
R4931 |
T16990 |
T16989 |
punct |
–,3 |
R4932 |
T16991 |
T16987 |
pobj |
d,for |
R4933 |
T16992 |
T16970 |
cc |
and,housing |
R4934 |
T16993 |
T16970 |
conj |
collecting,housing |
R4935 |
T16994 |
T16993 |
dobj |
urine,collecting |
R4936 |
T16995 |
T16996 |
det |
every,period |
R4937 |
T16996 |
T16993 |
npadvmod |
period,collecting |
R4938 |
T16997 |
T16998 |
nummod |
24,h |
R4939 |
T16998 |
T16996 |
compound |
h,period |
R494 |
T2719 |
T2712 |
punct |
", ",translocates |
R4940 |
T16999 |
T16966 |
punct |
.,measured |
R4941 |
T17001 |
T17002 |
compound |
Urine,osmolalities |
R4942 |
T17002 |
T17003 |
nsubjpass |
osmolalities,determined |
R4943 |
T17004 |
T17003 |
auxpass |
were,determined |
R4944 |
T17005 |
T17003 |
advcl |
using,determined |
R4945 |
T17006 |
T17007 |
det |
an,Osmometer |
R4946 |
T17007 |
T17005 |
dobj |
Osmometer,using |
R4947 |
T17008 |
T17009 |
punct |
(,Systems |
R4948 |
T17009 |
T17007 |
parataxis |
Systems,Osmometer |
R4949 |
T17010 |
T17009 |
dep |
Osmette,Systems |
R495 |
T2720 |
T2712 |
prep |
under,translocates |
R4950 |
T17011 |
T17010 |
nummod |
5004,Osmette |
R4951 |
T17012 |
T17009 |
punct |
;,Systems |
R4952 |
T17013 |
T17009 |
compound |
Precision,Systems |
R4953 |
T17014 |
T17009 |
punct |
", ",Systems |
R4954 |
T17015 |
T17009 |
npadvmod |
Natick,Systems |
R4955 |
T17016 |
T17009 |
punct |
", ",Systems |
R4956 |
T17017 |
T17009 |
npadvmod |
Massachusetts,Systems |
R4957 |
T17018 |
T17009 |
punct |
", ",Systems |
R4958 |
T17019 |
T17020 |
compound |
United,States |
R4959 |
T17020 |
T17009 |
npadvmod |
States,Systems |
R496 |
T2721 |
T2720 |
pobj |
conditions,under |
R4960 |
T17021 |
T17009 |
punct |
),Systems |
R4961 |
T17022 |
T17003 |
punct |
.,determined |
R4962 |
T17024 |
T17025 |
npadvmod |
Urine,concentrating |
R4963 |
T17025 |
T17026 |
amod |
concentrating,experiments |
R4964 |
T17026 |
T17027 |
nsubjpass |
experiments,carried |
R4965 |
T17028 |
T17027 |
auxpass |
were,carried |
R4966 |
T17029 |
T17027 |
prt |
out,carried |
R4967 |
T17030 |
T17027 |
prep |
by,carried |
R4968 |
T17031 |
T17032 |
amod |
intraperitoneal,injection |
R4969 |
T17032 |
T17030 |
pobj |
injection,by |
R497 |
T2722 |
T2721 |
acl |
requiring,conditions |
R4970 |
T17033 |
T17032 |
prep |
of,injection |
R4971 |
T17034 |
T17033 |
pobj |
dDAVP,of |
R4972 |
T17035 |
T17036 |
punct |
(,μg |
R4973 |
T17036 |
T17034 |
parataxis |
μg,dDAVP |
R4974 |
T17037 |
T17036 |
nummod |
0.4,μg |
R4975 |
T17038 |
T17039 |
punct |
/,kg |
R4976 |
T17039 |
T17036 |
prep |
kg,μg |
R4977 |
T17040 |
T17036 |
punct |
),μg |
R4978 |
T17041 |
T17027 |
punct |
.,carried |
R4979 |
T17043 |
T17044 |
nsubjpass |
Mice,injected |
R498 |
T2723 |
T2724 |
compound |
water,retention |
R4980 |
T17045 |
T17044 |
auxpass |
were,injected |
R4981 |
T17046 |
T17044 |
advmod |
twice,injected |
R4982 |
T17047 |
T17044 |
prep |
with,injected |
R4983 |
T17048 |
T17047 |
pobj |
dDAVP,with |
R4984 |
T17049 |
T17044 |
punct |
", ",injected |
R4985 |
T17050 |
T17051 |
advmod |
once,at |
R4986 |
T17051 |
T17044 |
prep |
at,injected |
R4987 |
T17052 |
T17051 |
pobj |
time,at |
R4988 |
T17053 |
T17052 |
nummod |
0,time |
R4989 |
T17054 |
T17051 |
cc |
and,at |
R499 |
T2724 |
T2722 |
dobj |
retention,requiring |
R4990 |
T17055 |
T17056 |
advmod |
again,at |
R4991 |
T17056 |
T17051 |
conj |
at,at |
R4992 |
T17057 |
T17058 |
nummod |
30,min |
R4993 |
T17058 |
T17056 |
pobj |
min,at |
R4994 |
T17059 |
T17044 |
punct |
.,injected |
R4995 |
T17061 |
T17062 |
nsubjpass |
Urine,collected |
R4996 |
T17063 |
T17062 |
auxpass |
was,collected |
R4997 |
T17064 |
T17062 |
prep |
at,collected |
R4998 |
T17065 |
T17066 |
det |
the,start |
R4999 |
T17066 |
T17064 |
pobj |
start,at |
R500 |
T2725 |
T2712 |
nsubj |
AQP2,translocates |
R5000 |
T17067 |
T17066 |
prep |
of,start |
R5001 |
T17068 |
T17069 |
det |
the,experiment |
R5002 |
T17069 |
T17067 |
pobj |
experiment,of |
R5003 |
T17070 |
T17064 |
cc |
and,at |
R5004 |
T17071 |
T17072 |
nummod |
30,min |
R5005 |
T17072 |
T17073 |
npadvmod |
min,after |
R5006 |
T17073 |
T17064 |
conj |
after,at |
R5007 |
T17074 |
T17075 |
det |
the,injection |
R5008 |
T17075 |
T17073 |
pobj |
injection,after |
R5009 |
T17076 |
T17075 |
amod |
second,injection |
R501 |
T2726 |
T2712 |
prep |
to,translocates |
R5010 |
T17077 |
T17062 |
punct |
.,collected |
R5011 |
T17265 |
T17266 |
compound |
Kidney,membrane |
R5012 |
T17266 |
T17267 |
compound |
membrane,preparation |
R5013 |
T17268 |
T17267 |
punct |
.,preparation |
R5014 |
T17270 |
T17271 |
amod |
Whole,kidneys |
R5015 |
T17271 |
T17273 |
nsubjpass |
kidneys,homogenized |
R5016 |
T17272 |
T17271 |
compound |
mouse,kidneys |
R5017 |
T17274 |
T17273 |
auxpass |
were,homogenized |
R5018 |
T17275 |
T17273 |
prep |
in,homogenized |
R5019 |
T17276 |
T17277 |
nummod |
10,mM |
R502 |
T2727 |
T2728 |
det |
the,membrane |
R5020 |
T17277 |
T17278 |
compound |
mM,Tris |
R5021 |
T17278 |
T17275 |
pobj |
Tris,in |
R5022 |
T17279 |
T17278 |
punct |
(,Tris |
R5023 |
T17280 |
T17278 |
npadvmod |
pH,Tris |
R5024 |
T17281 |
T17280 |
nummod |
7.4,pH |
R5025 |
T17282 |
T17278 |
punct |
),Tris |
R5026 |
T17283 |
T17278 |
punct |
", ",Tris |
R5027 |
T17284 |
T17285 |
nummod |
350,mM |
R5028 |
T17285 |
T17286 |
compound |
mM,sucrose |
R5029 |
T17286 |
T17278 |
conj |
sucrose,Tris |
R503 |
T2728 |
T2726 |
pobj |
membrane,to |
R5030 |
T17287 |
T17286 |
punct |
", ",sucrose |
R5031 |
T17288 |
T17286 |
cc |
and,sucrose |
R5032 |
T17289 |
T17290 |
nummod |
5,mM |
R5033 |
T17290 |
T17291 |
compound |
mM,EDTA |
R5034 |
T17291 |
T17286 |
conj |
EDTA,sucrose |
R5035 |
T17292 |
T17291 |
acl |
containing,EDTA |
R5036 |
T17293 |
T17294 |
compound |
protease,inhibitors |
R5037 |
T17294 |
T17292 |
dobj |
inhibitors,containing |
R5038 |
T17295 |
T17296 |
punct |
(,P |
R5039 |
T17296 |
T17294 |
parataxis |
P,inhibitors |
R504 |
T2729 |
T2728 |
amod |
apical,membrane |
R5040 |
T17297 |
T17298 |
compound |
Sigma,Aldrich |
R5041 |
T17298 |
T17296 |
dep |
Aldrich,P |
R5042 |
T17299 |
T17298 |
punct |
-,Aldrich |
R5043 |
T17300 |
T17296 |
punct |
", ",P |
R5044 |
T17301 |
T17296 |
punct |
#,P |
R5045 |
T17302 |
T17296 |
punct |
-,P |
R5046 |
T17303 |
T17296 |
nummod |
8340,P |
R5047 |
T17304 |
T17296 |
punct |
),P |
R5048 |
T17305 |
T17273 |
prep |
in,homogenized |
R5049 |
T17306 |
T17307 |
det |
a,homogenizer |
R505 |
T2730 |
T2712 |
punct |
", ",translocates |
R5050 |
T17307 |
T17305 |
pobj |
homogenizer,in |
R5051 |
T17308 |
T17309 |
compound |
Potter,Elvehjem |
R5052 |
T17309 |
T17307 |
compound |
Elvehjem,homogenizer |
R5053 |
T17310 |
T17309 |
punct |
-,Elvehjem |
R5054 |
T17311 |
T17273 |
punct |
.,homogenized |
R5055 |
T17313 |
T17314 |
det |
The,homogenate |
R5056 |
T17314 |
T17315 |
nsubjpass |
homogenate,centrifuged |
R5057 |
T17316 |
T17315 |
auxpass |
was,centrifuged |
R5058 |
T17317 |
T17315 |
prep |
at,centrifuged |
R5059 |
T17318 |
T17319 |
nummod |
"2,000",g |
R506 |
T2731 |
T2712 |
advcl |
permitting,translocates |
R5060 |
T17319 |
T17317 |
pobj |
g,at |
R5061 |
T17320 |
T17315 |
prep |
for,centrifuged |
R5062 |
T17321 |
T17322 |
nummod |
10,min |
R5063 |
T17322 |
T17320 |
pobj |
min,for |
R5064 |
T17323 |
T17315 |
cc |
and,centrifuged |
R5065 |
T17324 |
T17325 |
det |
the,supernatant |
R5066 |
T17325 |
T17326 |
nsubjpass |
supernatant,subjected |
R5067 |
T17326 |
T17315 |
conj |
subjected,centrifuged |
R5068 |
T17327 |
T17326 |
auxpass |
was,subjected |
R5069 |
T17328 |
T17326 |
prep |
to,subjected |
R507 |
T2732 |
T2733 |
compound |
water,reabsorption |
R5070 |
T17329 |
T17328 |
pobj |
ultracentrifugation,to |
R5071 |
T17330 |
T17329 |
prep |
at,ultracentrifugation |
R5072 |
T17331 |
T17332 |
nummod |
"100,000",g |
R5073 |
T17332 |
T17330 |
pobj |
g,at |
R5074 |
T17333 |
T17326 |
prep |
for,subjected |
R5075 |
T17334 |
T17335 |
nummod |
1,h |
R5076 |
T17335 |
T17333 |
pobj |
h,for |
R5077 |
T17336 |
T17326 |
prep |
at,subjected |
R5078 |
T17337 |
T17338 |
nummod |
4,°C |
R5079 |
T17338 |
T17336 |
pobj |
°C,at |
R508 |
T2733 |
T2731 |
dobj |
reabsorption,permitting |
R5080 |
T17339 |
T17326 |
punct |
.,subjected |
R5081 |
T17341 |
T17342 |
amod |
Pelleted,membranes |
R5082 |
T17342 |
T17343 |
nsubjpass |
membranes,resuspended |
R5083 |
T17344 |
T17343 |
auxpass |
were,resuspended |
R5084 |
T17345 |
T17343 |
prep |
in,resuspended |
R5085 |
T17346 |
T17347 |
det |
the,buffer |
R5086 |
T17347 |
T17345 |
pobj |
buffer,in |
R5087 |
T17348 |
T17347 |
amod |
same,buffer |
R5088 |
T17349 |
T17343 |
punct |
", ",resuspended |
R5089 |
T17350 |
T17343 |
cc |
and,resuspended |
R509 |
T2734 |
T2735 |
punct |
[,8 |
R5090 |
T17351 |
T17352 |
compound |
protein,concentration |
R5091 |
T17352 |
T17353 |
nsubjpass |
concentration,determined |
R5092 |
T17353 |
T17343 |
conj |
determined,resuspended |
R5093 |
T17354 |
T17353 |
auxpass |
was,determined |
R5094 |
T17355 |
T17353 |
prep |
by,determined |
R5095 |
T17356 |
T17357 |
compound |
Bradford,assay |
R5096 |
T17357 |
T17355 |
pobj |
assay,by |
R5097 |
T17358 |
T17353 |
punct |
.,determined |
R5098 |
T17615 |
T17614 |
punct |
.,Immunoblotting |
R5099 |
T17617 |
T17618 |
compound |
Kidney,membrane |
R510 |
T2735 |
T2712 |
parataxis |
8,translocates |
R5100 |
T17618 |
T17619 |
compound |
membrane,fractions |
R5101 |
T17619 |
T17620 |
nsubjpass |
fractions,resolved |
R5102 |
T17621 |
T17622 |
punct |
(,μg |
R5103 |
T17622 |
T17619 |
parataxis |
μg,fractions |
R5104 |
T17623 |
T17622 |
nummod |
60,μg |
R5105 |
T17624 |
T17622 |
punct |
),μg |
R5106 |
T17625 |
T17620 |
auxpass |
were,resolved |
R5107 |
T17626 |
T17620 |
prep |
on,resolved |
R5108 |
T17627 |
T17628 |
det |
a,gel |
R5109 |
T17628 |
T17626 |
pobj |
gel,on |
R511 |
T2736 |
T2735 |
nummod |
7,8 |
R5110 |
T17629 |
T17630 |
nummod |
12,% |
R5111 |
T17630 |
T17628 |
compound |
%,gel |
R5112 |
T17631 |
T17632 |
compound |
SDS,polyacrylamide |
R5113 |
T17632 |
T17628 |
compound |
polyacrylamide,gel |
R5114 |
T17633 |
T17632 |
punct |
-,polyacrylamide |
R5115 |
T17634 |
T17620 |
cc |
and,resolved |
R5116 |
T17635 |
T17620 |
conj |
transferred,resolved |
R5117 |
T17636 |
T17635 |
prep |
to,transferred |
R5118 |
T17637 |
T17638 |
det |
a,membrane |
R5119 |
T17638 |
T17636 |
pobj |
membrane,to |
R512 |
T2737 |
T2735 |
punct |
",",8 |
R5120 |
T17639 |
T17638 |
compound |
nitrocellulose,membrane |
R5121 |
T17640 |
T17620 |
punct |
.,resolved |
R5122 |
T17642 |
T17643 |
nsubjpass |
Membranes,blocked |
R5123 |
T17644 |
T17643 |
auxpass |
were,blocked |
R5124 |
T17645 |
T17643 |
prep |
in,blocked |
R5125 |
T17646 |
T17647 |
nummod |
5,% |
R5126 |
T17647 |
T17648 |
nmod |
%,milk |
R5127 |
T17648 |
T17645 |
pobj |
milk,in |
R5128 |
T17649 |
T17648 |
amod |
nonfat,milk |
R5129 |
T17650 |
T17648 |
prep |
in,milk |
R513 |
T2738 |
T2735 |
punct |
],8 |
R5130 |
T17651 |
T17652 |
npadvmod |
Tris,buffered |
R5131 |
T17652 |
T17654 |
amod |
buffered,saline |
R5132 |
T17653 |
T17652 |
punct |
-,buffered |
R5133 |
T17654 |
T17650 |
pobj |
saline,in |
R5134 |
T17655 |
T17654 |
prep |
with,saline |
R5135 |
T17656 |
T17657 |
nummod |
0.05,% |
R5136 |
T17657 |
T17658 |
compound |
%,Tween |
R5137 |
T17658 |
T17655 |
pobj |
Tween,with |
R5138 |
T17659 |
T17658 |
nummod |
20,Tween |
R5139 |
T17660 |
T17661 |
punct |
(,TBST |
R514 |
T2739 |
T2712 |
punct |
.,translocates |
R5140 |
T17661 |
T17658 |
parataxis |
TBST,Tween |
R5141 |
T17662 |
T17661 |
punct |
),TBST |
R5142 |
T17663 |
T17643 |
punct |
", ",blocked |
R5143 |
T17664 |
T17643 |
advcl |
followed,blocked |
R5144 |
T17665 |
T17664 |
agent |
by,followed |
R5145 |
T17666 |
T17667 |
det |
an,incubation |
R5146 |
T17667 |
T17665 |
pobj |
incubation,by |
R5147 |
T17668 |
T17667 |
amod |
overnight,incubation |
R5148 |
T17669 |
T17667 |
punct |
(,incubation |
R5149 |
T17670 |
T17667 |
prep |
at,incubation |
R515 |
T2741 |
T2742 |
mark |
For,occur |
R5150 |
T17671 |
T17672 |
nummod |
4,°C |
R5151 |
T17672 |
T17670 |
pobj |
°C,at |
R5152 |
T17673 |
T17667 |
punct |
),incubation |
R5153 |
T17674 |
T17667 |
prep |
with,incubation |
R5154 |
T17675 |
T17676 |
nmod |
AQP2,antibody |
R5155 |
T17676 |
T17674 |
pobj |
antibody,with |
R5156 |
T17677 |
T17676 |
amod |
polyclonal,antibody |
R5157 |
T17678 |
T17679 |
punct |
(,sc |
R5158 |
T17679 |
T17676 |
parataxis |
sc,antibody |
R5159 |
T17680 |
T17681 |
compound |
Santa,Cruz |
R516 |
T2742 |
T2746 |
advcl |
occur,binds |
R5160 |
T17681 |
T17682 |
compound |
Cruz,Biotechnology |
R5161 |
T17682 |
T17679 |
dep |
Biotechnology,sc |
R5162 |
T17683 |
T17682 |
punct |
", ",Biotechnology |
R5163 |
T17684 |
T17685 |
compound |
Santa,Cruz |
R5164 |
T17685 |
T17682 |
npadvmod |
Cruz,Biotechnology |
R5165 |
T17686 |
T17682 |
punct |
", ",Biotechnology |
R5166 |
T17687 |
T17682 |
npadvmod |
California,Biotechnology |
R5167 |
T17688 |
T17682 |
punct |
", ",Biotechnology |
R5168 |
T17689 |
T17690 |
compound |
United,States |
R5169 |
T17690 |
T17682 |
npadvmod |
States,Biotechnology |
R517 |
T2743 |
T2744 |
det |
this,process |
R5170 |
T17691 |
T17679 |
punct |
;,sc |
R5171 |
T17692 |
T17679 |
punct |
#,sc |
R5172 |
T17693 |
T17679 |
punct |
-,sc |
R5173 |
T17694 |
T17679 |
nummod |
9882,sc |
R5174 |
T17695 |
T17679 |
punct |
),sc |
R5175 |
T17696 |
T17643 |
punct |
.,blocked |
R5176 |
T17698 |
T17699 |
nsubjpass |
Membranes,washed |
R5177 |
T17700 |
T17699 |
auxpass |
were,washed |
R5178 |
T17701 |
T17699 |
prep |
in,washed |
R5179 |
T17702 |
T17701 |
pobj |
TBST,in |
R518 |
T2744 |
T2742 |
nsubj |
process,occur |
R5180 |
T17703 |
T17704 |
advmod |
then,incubated |
R5181 |
T17704 |
T17699 |
dep |
incubated,washed |
R5182 |
T17705 |
T17704 |
prep |
with,incubated |
R5183 |
T17706 |
T17707 |
npadvmod |
HRP,conjugated |
R5184 |
T17707 |
T17709 |
amod |
conjugated,antibody |
R5185 |
T17708 |
T17707 |
punct |
-,conjugated |
R5186 |
T17709 |
T17705 |
pobj |
antibody,with |
R5187 |
T17710 |
T17709 |
nmod |
donkey,antibody |
R5188 |
T17711 |
T17709 |
amod |
anti-goat,antibody |
R5189 |
T17712 |
T17699 |
punct |
.,washed |
R519 |
T2745 |
T2742 |
aux |
to,occur |
R5190 |
T17714 |
T17715 |
nsubjpass |
Membranes,washed |
R5191 |
T17716 |
T17715 |
auxpass |
were,washed |
R5192 |
T17717 |
T17715 |
advmod |
further,washed |
R5193 |
T17718 |
T17715 |
prep |
in,washed |
R5194 |
T17719 |
T17718 |
pobj |
TBST,in |
R5195 |
T17720 |
T17715 |
cc |
and,washed |
R5196 |
T17721 |
T17722 |
nsubjpass |
bands,visualized |
R5197 |
T17722 |
T17715 |
conj |
visualized,washed |
R5198 |
T17723 |
T17722 |
auxpass |
were,visualized |
R5199 |
T17724 |
T17722 |
advcl |
using,visualized |
R520 |
T2747 |
T2746 |
punct |
", ",binds |
R5200 |
T17725 |
T17726 |
compound |
ECL,reagent |
R5201 |
T17726 |
T17724 |
dobj |
reagent,using |
R5202 |
T17727 |
T17728 |
punct |
(,Biosciences |
R5203 |
T17728 |
T17726 |
parataxis |
Biosciences,reagent |
R5204 |
T17729 |
T17728 |
compound |
Amersham,Biosciences |
R5205 |
T17730 |
T17728 |
punct |
", ",Biosciences |
R5206 |
T17731 |
T17732 |
compound |
Little,Chalfont |
R5207 |
T17732 |
T17728 |
npadvmod |
Chalfont,Biosciences |
R5208 |
T17733 |
T17728 |
punct |
", ",Biosciences |
R5209 |
T17734 |
T17735 |
compound |
United,Kingdom |
R521 |
T2748 |
T2746 |
nsubj |
AVP,binds |
R5210 |
T17735 |
T17728 |
npadvmod |
Kingdom,Biosciences |
R5211 |
T17736 |
T17728 |
punct |
),Biosciences |
R5212 |
T17737 |
T17722 |
punct |
.,visualized |
R5213 |
T17905 |
T17906 |
compound |
Endoglycosidase,digestion |
R5214 |
T17907 |
T17906 |
punct |
.,digestion |
R5215 |
T17909 |
T17910 |
compound |
Kidney,membranes |
R5216 |
T17910 |
T17911 |
nsubjpass |
membranes,incubated |
R5217 |
T17912 |
T17913 |
punct |
(,μg |
R5218 |
T17913 |
T17910 |
parataxis |
μg,membranes |
R5219 |
T17914 |
T17913 |
nummod |
60,μg |
R522 |
T2749 |
T2750 |
poss |
its,receptor |
R5220 |
T17915 |
T17913 |
punct |
),μg |
R5221 |
T17916 |
T17911 |
auxpass |
were,incubated |
R5222 |
T17917 |
T17911 |
prep |
in,incubated |
R5223 |
T17918 |
T17919 |
nummod |
50,mM |
R5224 |
T17919 |
T17920 |
compound |
mM,phosphate |
R5225 |
T17920 |
T17917 |
pobj |
phosphate,in |
R5226 |
T17921 |
T17920 |
compound |
sodium,phosphate |
R5227 |
T17922 |
T17920 |
punct |
(,phosphate |
R5228 |
T17923 |
T17920 |
npadvmod |
pH,phosphate |
R5229 |
T17924 |
T17923 |
nummod |
5.5,pH |
R523 |
T2750 |
T2746 |
dobj |
receptor,binds |
R5230 |
T17925 |
T17920 |
punct |
),phosphate |
R5231 |
T17926 |
T17920 |
punct |
", ",phosphate |
R5232 |
T17927 |
T17928 |
nummod |
0.1,% |
R5233 |
T17928 |
T17929 |
compound |
%,SDS |
R5234 |
T17929 |
T17920 |
appos |
SDS,phosphate |
R5235 |
T17930 |
T17929 |
punct |
", ",SDS |
R5236 |
T17931 |
T17929 |
cc |
and,SDS |
R5237 |
T17932 |
T17933 |
nummod |
50,mM |
R5238 |
T17933 |
T17934 |
compound |
mM,mercaptoethanol |
R5239 |
T17934 |
T17929 |
conj |
mercaptoethanol,SDS |
R524 |
T2751 |
T2750 |
punct |
", ",receptor |
R5240 |
T17935 |
T17934 |
compound |
β,mercaptoethanol |
R5241 |
T17936 |
T17934 |
punct |
-,mercaptoethanol |
R5242 |
T17937 |
T17911 |
punct |
", ",incubated |
R5243 |
T17938 |
T17911 |
dep |
heated,incubated |
R5244 |
T17939 |
T17938 |
prep |
to,heated |
R5245 |
T17940 |
T17941 |
nummod |
100,°C |
R5246 |
T17941 |
T17939 |
pobj |
°C,to |
R5247 |
T17942 |
T17938 |
prep |
for,heated |
R5248 |
T17943 |
T17944 |
nummod |
5,min |
R5249 |
T17944 |
T17942 |
pobj |
min,for |
R525 |
T2752 |
T2750 |
appos |
AVPR2,receptor |
R5250 |
T17945 |
T17911 |
punct |
", ",incubated |
R5251 |
T17946 |
T17947 |
advmod |
then,cooled |
R5252 |
T17947 |
T17911 |
dep |
cooled,incubated |
R5253 |
T17948 |
T17911 |
punct |
.,incubated |
R5254 |
T17950 |
T17951 |
compound |
Endoglycosidase,H |
R5255 |
T17951 |
T17952 |
nsubjpass |
H,added |
R5256 |
T17953 |
T17954 |
punct |
(,Aldrich |
R5257 |
T17954 |
T17951 |
parataxis |
Aldrich,H |
R5258 |
T17955 |
T17956 |
nummod |
0.01,units |
R5259 |
T17956 |
T17954 |
dep |
units,Aldrich |
R526 |
T2753 |
T2746 |
punct |
", ",binds |
R5260 |
T17957 |
T17954 |
punct |
;,Aldrich |
R5261 |
T17958 |
T17954 |
compound |
Sigma,Aldrich |
R5262 |
T17959 |
T17954 |
punct |
-,Aldrich |
R5263 |
T17960 |
T17954 |
punct |
),Aldrich |
R5264 |
T17961 |
T17952 |
auxpass |
was,added |
R5265 |
T17962 |
T17952 |
cc |
and,added |
R5266 |
T17963 |
T17952 |
conj |
incubated,added |
R5267 |
T17964 |
T17963 |
prep |
at,incubated |
R5268 |
T17965 |
T17966 |
nummod |
37,°C |
R5269 |
T17966 |
T17964 |
pobj |
°C,at |
R527 |
T2754 |
T2746 |
prep |
on,binds |
R5270 |
T17967 |
T17963 |
prep |
for,incubated |
R5271 |
T17968 |
T17969 |
nummod |
2,h |
R5272 |
T17969 |
T17967 |
pobj |
h,for |
R5273 |
T17970 |
T17952 |
punct |
.,added |
R5274 |
T17972 |
T17973 |
det |
The,reaction |
R5275 |
T17973 |
T17974 |
nsubjpass |
reaction,stopped |
R5276 |
T17975 |
T17974 |
auxpass |
was,stopped |
R5277 |
T17976 |
T17974 |
prep |
by,stopped |
R5278 |
T17977 |
T17976 |
pcomp |
boiling,by |
R5279 |
T17978 |
T17979 |
det |
the,samples |
R528 |
T2755 |
T2756 |
det |
the,face |
R5280 |
T17979 |
T17977 |
dobj |
samples,boiling |
R5281 |
T17980 |
T17977 |
prep |
in,boiling |
R5282 |
T17981 |
T17982 |
compound |
Laemmli,buffer |
R5283 |
T17982 |
T17980 |
pobj |
buffer,in |
R5284 |
T17983 |
T17974 |
punct |
.,stopped |
R5285 |
T17985 |
T17986 |
amod |
Total,reactants |
R5286 |
T17986 |
T17987 |
nsubjpass |
reactants,immunoblotted |
R5287 |
T17988 |
T17987 |
auxpass |
were,immunoblotted |
R5288 |
T17989 |
T17990 |
mark |
as,described |
R5289 |
T17990 |
T17987 |
advcl |
described,immunoblotted |
R529 |
T2756 |
T2754 |
pobj |
face,on |
R5290 |
T17991 |
T17990 |
advmod |
above,described |
R5291 |
T17992 |
T17987 |
punct |
.,immunoblotted |
R5292 |
T18784 |
T18783 |
cc |
and,Coimmunoprecipitation |
R5293 |
T18785 |
T18783 |
conj |
biotinylation,Coimmunoprecipitation |
R5294 |
T18786 |
T18783 |
prep |
in,Coimmunoprecipitation |
R5295 |
T18787 |
T18788 |
compound |
MDCK,cells |
R5296 |
T18788 |
T18786 |
pobj |
cells,in |
R5297 |
T18789 |
T18783 |
punct |
.,Coimmunoprecipitation |
R5298 |
T18791 |
T18792 |
compound |
MDCK,cells |
R5299 |
T18792 |
T18793 |
nsubjpass |
cells,transfected |
R530 |
T2757 |
T2756 |
amod |
basolateral,face |
R5300 |
T18794 |
T18795 |
advmod |
stably,expressing |
R5301 |
T18795 |
T18792 |
acl |
expressing,cells |
R5302 |
T18796 |
T18797 |
amod |
wild,type |
R5303 |
T18797 |
T18799 |
compound |
type,AQP2 |
R5304 |
T18798 |
T18797 |
punct |
-,type |
R5305 |
T18799 |
T18795 |
dobj |
AQP2,expressing |
R5306 |
T18800 |
T18799 |
punct |
(,AQP2 |
R5307 |
T18801 |
T18799 |
acl |
grown,AQP2 |
R5308 |
T18802 |
T18801 |
prep |
on,grown |
R5309 |
T18803 |
T18804 |
nummod |
10,cm |
R531 |
T2758 |
T2756 |
prep |
of,face |
R5310 |
T18804 |
T18806 |
compound |
cm,plates |
R5311 |
T18805 |
T18804 |
punct |
-,cm |
R5312 |
T18806 |
T18802 |
pobj |
plates,on |
R5313 |
T18807 |
T18795 |
punct |
),expressing |
R5314 |
T18808 |
T18793 |
auxpass |
were,transfected |
R5315 |
T18809 |
T18793 |
prep |
with,transfected |
R5316 |
T18810 |
T18811 |
nmod |
pEGFP,type |
R5317 |
T18811 |
T18815 |
compound |
type,AQP2 |
R5318 |
T18812 |
T18811 |
punct |
-,type |
R5319 |
T18813 |
T18811 |
amod |
wild,type |
R532 |
T2759 |
T2760 |
det |
the,cells |
R5320 |
T18814 |
T18811 |
punct |
-,type |
R5321 |
T18815 |
T18809 |
pobj |
AQP2,with |
R5322 |
T18816 |
T18815 |
punct |
", ",AQP2 |
R5323 |
T18817 |
T18818 |
compound |
pEGFP,F204V |
R5324 |
T18818 |
T18815 |
conj |
F204V,AQP2 |
R5325 |
T18819 |
T18818 |
punct |
-,F204V |
R5326 |
T18820 |
T18818 |
compound |
AQP2,F204V |
R5327 |
T18821 |
T18818 |
punct |
-,F204V |
R5328 |
T18822 |
T18818 |
punct |
", ",F204V |
R5329 |
T18823 |
T18818 |
cc |
or,F204V |
R533 |
T2760 |
T2758 |
pobj |
cells,of |
R5330 |
T18824 |
T18818 |
conj |
vector,F204V |
R5331 |
T18825 |
T18824 |
advmod |
alone,vector |
R5332 |
T18826 |
T18793 |
punct |
.,transfected |
R5333 |
T18828 |
T18829 |
det |
The,cells |
R5334 |
T18829 |
T18830 |
nsubjpass |
cells,homogenized |
R5335 |
T18831 |
T18830 |
auxpass |
were,homogenized |
R5336 |
T18832 |
T18830 |
prep |
in,homogenized |
R5337 |
T18833 |
T18834 |
nummod |
10,mM |
R5338 |
T18834 |
T18835 |
compound |
mM,Tris |
R5339 |
T18835 |
T18832 |
pobj |
Tris,in |
R534 |
T2761 |
T2762 |
amod |
collecting,duct |
R5340 |
T18836 |
T18835 |
punct |
(,Tris |
R5341 |
T18837 |
T18835 |
npadvmod |
pH,Tris |
R5342 |
T18838 |
T18837 |
nummod |
7.4,pH |
R5343 |
T18839 |
T18835 |
punct |
),Tris |
R5344 |
T18840 |
T18835 |
punct |
", ",Tris |
R5345 |
T18841 |
T18842 |
nummod |
1,mM |
R5346 |
T18842 |
T18843 |
compound |
mM,EDTA |
R5347 |
T18843 |
T18835 |
conj |
EDTA,Tris |
R5348 |
T18844 |
T18843 |
punct |
", ",EDTA |
R5349 |
T18845 |
T18843 |
cc |
and,EDTA |
R535 |
T2762 |
T2760 |
compound |
duct,cells |
R5350 |
T18846 |
T18847 |
nummod |
250,mM |
R5351 |
T18847 |
T18848 |
compound |
mM,sucrose |
R5352 |
T18848 |
T18843 |
conj |
sucrose,EDTA |
R5353 |
T18849 |
T18850 |
nummod |
40,h |
R5354 |
T18850 |
T18851 |
npadvmod |
h,later |
R5355 |
T18851 |
T18830 |
advmod |
later,homogenized |
R5356 |
T18852 |
T18830 |
punct |
.,homogenized |
R5357 |
T18854 |
T18855 |
det |
The,supernatant |
R5358 |
T18855 |
T18857 |
nsubjpass |
supernatant,centrifuged |
R5359 |
T18856 |
T18855 |
amod |
clarified,supernatant |
R536 |
T2763 |
T2746 |
punct |
", ",binds |
R5360 |
T18858 |
T18857 |
auxpass |
was,centrifuged |
R5361 |
T18859 |
T18857 |
prep |
at,centrifuged |
R5362 |
T18860 |
T18861 |
nummod |
"200,000",g |
R5363 |
T18861 |
T18859 |
pobj |
g,at |
R5364 |
T18862 |
T18857 |
prep |
for,centrifuged |
R5365 |
T18863 |
T18864 |
nummod |
30,min |
R5366 |
T18864 |
T18862 |
pobj |
min,for |
R5367 |
T18865 |
T18857 |
punct |
.,centrifuged |
R5368 |
T18867 |
T18868 |
amod |
Pelleted,membranes |
R5369 |
T18868 |
T18869 |
nsubjpass |
membranes,incubated |
R537 |
T2764 |
T2746 |
advcl |
leading,binds |
R5370 |
T18870 |
T18869 |
auxpass |
were,incubated |
R5371 |
T18871 |
T18869 |
aux |
resuspended,incubated |
R5372 |
T18872 |
T18869 |
prep |
in,incubated |
R5373 |
T18873 |
T18874 |
det |
the,buffer |
R5374 |
T18874 |
T18872 |
pobj |
buffer,in |
R5375 |
T18875 |
T18874 |
amod |
same,buffer |
R5376 |
T18876 |
T18874 |
prep |
but,buffer |
R5377 |
T18877 |
T18876 |
pcomp |
containing,but |
R5378 |
T18878 |
T18879 |
nummod |
4,% |
R5379 |
T18879 |
T18880 |
compound |
%,deoxycholate |
R538 |
T2765 |
T2764 |
prep |
to,leading |
R5380 |
T18880 |
T18877 |
dobj |
deoxycholate,containing |
R5381 |
T18881 |
T18880 |
compound |
sodium,deoxycholate |
R5382 |
T18882 |
T18869 |
cc |
and,incubated |
R5383 |
T18883 |
T18869 |
prep |
at,incubated |
R5384 |
T18884 |
T18885 |
nummod |
37,°C |
R5385 |
T18885 |
T18883 |
pobj |
°C,at |
R5386 |
T18886 |
T18869 |
prep |
for,incubated |
R5387 |
T18887 |
T18888 |
nummod |
1,h |
R5388 |
T18888 |
T18886 |
pobj |
h,for |
R5389 |
T18889 |
T18869 |
punct |
.,incubated |
R539 |
T2766 |
T2767 |
det |
a,rise |
R5390 |
T18891 |
T18892 |
prep |
From,removed |
R5391 |
T18893 |
T18894 |
det |
the,membranes |
R5392 |
T18894 |
T18891 |
pobj |
membranes,From |
R5393 |
T18895 |
T18894 |
amod |
dissolved,membranes |
R5394 |
T18896 |
T18892 |
punct |
", ",removed |
R5395 |
T18897 |
T18898 |
det |
a,sample |
R5396 |
T18898 |
T18892 |
nsubjpass |
sample,removed |
R5397 |
T18899 |
T18900 |
nummod |
30,μl |
R5398 |
T18900 |
T18898 |
compound |
μl,sample |
R5399 |
T18901 |
T18892 |
auxpass |
was,removed |
R540 |
T2767 |
T2765 |
pobj |
rise,to |
R5400 |
T18902 |
T18892 |
cc |
and,removed |
R5401 |
T18903 |
T18892 |
conj |
used,removed |
R5402 |
T18904 |
T18903 |
prep |
as,used |
R5403 |
T18905 |
T18906 |
det |
the,fraction |
R5404 |
T18906 |
T18904 |
pobj |
fraction,as |
R5405 |
T18907 |
T18906 |
amod |
total,fraction |
R5406 |
T18908 |
T18906 |
compound |
membrane,fraction |
R5407 |
T18909 |
T18892 |
punct |
.,removed |
R5408 |
T18911 |
T18912 |
det |
The,membranes |
R5409 |
T18912 |
T18914 |
nsubjpass |
membranes,diluted |
R541 |
T2768 |
T2767 |
prep |
in,rise |
R5410 |
T18913 |
T18912 |
amod |
remaining,membranes |
R5411 |
T18915 |
T18914 |
auxpass |
were,diluted |
R5412 |
T18916 |
T18914 |
prep |
with,diluted |
R5413 |
T18917 |
T18918 |
nummod |
600,μl |
R5414 |
T18918 |
T18916 |
pobj |
μl,with |
R5415 |
T18919 |
T18918 |
prep |
of,μl |
R5416 |
T18920 |
T18921 |
det |
the,buffer |
R5417 |
T18921 |
T18919 |
pobj |
buffer,of |
R5418 |
T18922 |
T18921 |
compound |
homogenization,buffer |
R5419 |
T18923 |
T18914 |
punct |
", ",diluted |
R542 |
T2769 |
T2770 |
amod |
intracellular,cAMP |
R5420 |
T18924 |
T18914 |
cc |
and,diluted |
R5421 |
T18925 |
T18914 |
conj |
incubated,diluted |
R5422 |
T18926 |
T18925 |
prep |
with,incubated |
R5423 |
T18927 |
T18928 |
nummod |
1,μl |
R5424 |
T18928 |
T18926 |
pobj |
μl,with |
R5425 |
T18929 |
T18928 |
prep |
of,μl |
R5426 |
T18930 |
T18931 |
compound |
GFP,antisera |
R5427 |
T18931 |
T18929 |
pobj |
antisera,of |
R5428 |
T18932 |
T18933 |
punct |
(,0092 |
R5429 |
T18933 |
T18931 |
parataxis |
0092,antisera |
R543 |
T2770 |
T2768 |
pobj |
cAMP,in |
R5430 |
T18934 |
T18933 |
dep |
Invitrogen,0092 |
R5431 |
T18935 |
T18933 |
punct |
", ",0092 |
R5432 |
T18936 |
T18933 |
punct |
#,0092 |
R5433 |
T18937 |
T18933 |
nummod |
46,0092 |
R5434 |
T18938 |
T18933 |
punct |
–,0092 |
R5435 |
T18939 |
T18933 |
punct |
),0092 |
R5436 |
T18940 |
T18931 |
cc |
and,antisera |
R5437 |
T18941 |
T18942 |
compound |
protein,sepharose |
R5438 |
T18942 |
T18931 |
conj |
sepharose,antisera |
R5439 |
T18943 |
T18944 |
compound |
A,G |
R544 |
T2771 |
T2764 |
punct |
", ",leading |
R5440 |
T18944 |
T18942 |
compound |
G,sepharose |
R5441 |
T18945 |
T18944 |
punct |
/,G |
R5442 |
T18946 |
T18914 |
punct |
.,diluted |
R5443 |
T18948 |
T18949 |
prep |
Following,washed |
R5444 |
T18950 |
T18951 |
amod |
overnight,incubation |
R5445 |
T18951 |
T18948 |
pobj |
incubation,Following |
R5446 |
T18952 |
T18949 |
punct |
", ",washed |
R5447 |
T18953 |
T18954 |
det |
the,proteins |
R5448 |
T18954 |
T18949 |
nsubjpass |
proteins,washed |
R5449 |
T18955 |
T18954 |
amod |
precipitated,proteins |
R545 |
T2772 |
T2773 |
advmod |
ultimately,resulting |
R5450 |
T18956 |
T18949 |
auxpass |
were,washed |
R5451 |
T18957 |
T18949 |
prep |
in,washed |
R5452 |
T18958 |
T18959 |
compound |
RIPA,buffer |
R5453 |
T18959 |
T18957 |
pobj |
buffer,in |
R5454 |
T18960 |
T18949 |
cc |
and,washed |
R5455 |
T18961 |
T18962 |
advmod |
finally,boiled |
R5456 |
T18962 |
T18949 |
conj |
boiled,washed |
R5457 |
T18963 |
T18962 |
prep |
in,boiled |
R5458 |
T18964 |
T18965 |
nummod |
50,μl |
R5459 |
T18965 |
T18963 |
pobj |
μl,in |
R546 |
T2773 |
T2764 |
advcl |
resulting,leading |
R5460 |
T18966 |
T18965 |
prep |
of,μl |
R5461 |
T18967 |
T18968 |
compound |
Laemmli,buffer |
R5462 |
T18968 |
T18966 |
pobj |
buffer,of |
R5463 |
T18969 |
T18949 |
punct |
.,washed |
R5464 |
T18971 |
T18972 |
nsubjpass |
Half,processed |
R5465 |
T18973 |
T18971 |
prep |
of,Half |
R5466 |
T18974 |
T18975 |
det |
the,membrane |
R5467 |
T18975 |
T18973 |
pobj |
membrane,of |
R5468 |
T18976 |
T18975 |
amod |
total,membrane |
R5469 |
T18977 |
T18975 |
cc |
and,membrane |
R547 |
T2774 |
T2773 |
prep |
in,resulting |
R5470 |
T18978 |
T18979 |
det |
the,fractions |
R5471 |
T18979 |
T18975 |
conj |
fractions,membrane |
R5472 |
T18980 |
T18979 |
compound |
IP,fractions |
R5473 |
T18981 |
T18972 |
auxpass |
were,processed |
R5474 |
T18982 |
T18972 |
prep |
for,processed |
R5475 |
T18983 |
T18982 |
pobj |
immunoblotting,for |
R5476 |
T18984 |
T18972 |
punct |
.,processed |
R5477 |
T18986 |
T18987 |
compound |
Cell,biotinylation |
R5478 |
T18987 |
T18989 |
nsubjpass |
biotinylation,performed |
R5479 |
T18988 |
T18987 |
compound |
surface,biotinylation |
R548 |
T2775 |
T2774 |
pobj |
phosphorylation,in |
R5480 |
T18990 |
T18989 |
auxpass |
was,performed |
R5481 |
T18991 |
T18989 |
prep |
in,performed |
R5482 |
T18992 |
T18993 |
det |
a,manner |
R5483 |
T18993 |
T18991 |
pobj |
manner,in |
R5484 |
T18994 |
T18993 |
amod |
similar,manner |
R5485 |
T18995 |
T18989 |
punct |
.,performed |
R5486 |
T18997 |
T18998 |
advmod |
However,transfected |
R5487 |
T18999 |
T18998 |
punct |
", ",transfected |
R5488 |
T19000 |
T19001 |
compound |
pEGFP,F204V |
R5489 |
T19001 |
T18998 |
nsubjpass |
F204V,transfected |
R549 |
T2776 |
T2775 |
prep |
of,phosphorylation |
R5490 |
T19002 |
T19001 |
punct |
-,F204V |
R5491 |
T19003 |
T19001 |
compound |
AQP2,F204V |
R5492 |
T19004 |
T19001 |
punct |
-,F204V |
R5493 |
T19005 |
T18998 |
punct |
", ",transfected |
R5494 |
T19006 |
T18998 |
auxpass |
was,transfected |
R5495 |
T19007 |
T18998 |
prep |
into,transfected |
R5496 |
T19008 |
T19009 |
compound |
MDCK,cells |
R5497 |
T19009 |
T19007 |
pobj |
cells,into |
R5498 |
T19010 |
T19011 |
advmod |
stably,expressing |
R5499 |
T19011 |
T19009 |
acl |
expressing,cells |
R550 |
T2777 |
T2776 |
pobj |
AQP2,of |
R5500 |
T19012 |
T19013 |
amod |
wild,type |
R5501 |
T19013 |
T19015 |
compound |
type,AQP2 |
R5502 |
T19014 |
T19013 |
punct |
-,type |
R5503 |
T19015 |
T19011 |
dobj |
AQP2,expressing |
R5504 |
T19016 |
T19009 |
cc |
and,cells |
R5505 |
T19017 |
T19009 |
conj |
cells,cells |
R5506 |
T19018 |
T19017 |
acl |
made,cells |
R5507 |
T19019 |
T19018 |
oprd |
stable,made |
R5508 |
T19020 |
T19018 |
prep |
with,made |
R5509 |
T19021 |
T19020 |
pobj |
vector,with |
R551 |
T2778 |
T2775 |
prep |
at,phosphorylation |
R5510 |
T19022 |
T19021 |
advmod |
alone,vector |
R5511 |
T19023 |
T18998 |
punct |
.,transfected |
R5512 |
T19025 |
T19026 |
compound |
Twenty,four |
R5513 |
T19026 |
T19028 |
nummod |
four,hours |
R5514 |
T19027 |
T19026 |
punct |
-,four |
R5515 |
T19028 |
T19029 |
npadvmod |
hours,post-transfection |
R5516 |
T19029 |
T19030 |
advmod |
post-transfection,stimulated |
R5517 |
T19031 |
T19030 |
punct |
", ",stimulated |
R5518 |
T19032 |
T19030 |
nsubjpass |
cells,stimulated |
R5519 |
T19033 |
T19030 |
auxpass |
were,stimulated |
R552 |
T2779 |
T2778 |
pobj |
serine,at |
R5520 |
T19034 |
T19030 |
prep |
with,stimulated |
R5521 |
T19035 |
T19034 |
pobj |
forskolin,with |
R5522 |
T19036 |
T19030 |
punct |
", ",stimulated |
R5523 |
T19037 |
T19030 |
conj |
trypsinized,stimulated |
R5524 |
T19038 |
T19037 |
punct |
", ",trypsinized |
R5525 |
T19039 |
T19037 |
conj |
resuspended,trypsinized |
R5526 |
T19040 |
T19039 |
prep |
in,resuspended |
R5527 |
T19041 |
T19042 |
nummod |
1,ml |
R5528 |
T19042 |
T19040 |
pobj |
ml,in |
R5529 |
T19043 |
T19042 |
prep |
of,ml |
R553 |
T2780 |
T2779 |
nummod |
256,serine |
R5530 |
T19044 |
T19043 |
pobj |
PBS,of |
R5531 |
T19045 |
T19046 |
punct |
(,cells |
R5532 |
T19046 |
T19042 |
parataxis |
cells,ml |
R5533 |
T19047 |
T19048 |
quantmod |
2.5,106 |
R5534 |
T19048 |
T19046 |
nummod |
106,cells |
R5535 |
T19049 |
T19048 |
punct |
×,106 |
R5536 |
T19050 |
T19051 |
punct |
/,ml |
R5537 |
T19051 |
T19046 |
prep |
ml,cells |
R5538 |
T19052 |
T19046 |
punct |
),cells |
R5539 |
T19053 |
T19039 |
punct |
", ",resuspended |
R554 |
T2781 |
T2775 |
prep |
by,phosphorylation |
R5540 |
T19054 |
T19039 |
cc |
and,resuspended |
R5541 |
T19055 |
T19039 |
conj |
incubated,resuspended |
R5542 |
T19056 |
T19055 |
prep |
with,incubated |
R5543 |
T19057 |
T19058 |
nummod |
0.5,mg |
R5544 |
T19058 |
T19056 |
pobj |
mg,with |
R5545 |
T19059 |
T19058 |
prep |
of,mg |
R5546 |
T19060 |
T19061 |
compound |
NHS,biotin |
R5547 |
T19061 |
T19059 |
pobj |
biotin,of |
R5548 |
T19062 |
T19061 |
punct |
-,biotin |
R5549 |
T19063 |
T19061 |
compound |
PEO4,biotin |
R555 |
T2782 |
T2783 |
npadvmod |
cAMP,dependent |
R5550 |
T19064 |
T19061 |
punct |
-,biotin |
R5551 |
T19065 |
T19066 |
punct |
(,Biotechnology |
R5552 |
T19066 |
T19061 |
parataxis |
Biotechnology,biotin |
R5553 |
T19067 |
T19066 |
compound |
Pierce,Biotechnology |
R5554 |
T19068 |
T19066 |
punct |
),Biotechnology |
R5555 |
T19069 |
T19055 |
prep |
for,incubated |
R5556 |
T19070 |
T19071 |
nummod |
30,min |
R5557 |
T19071 |
T19069 |
pobj |
min,for |
R5558 |
T19072 |
T19055 |
prep |
at,incubated |
R5559 |
T19073 |
T19074 |
compound |
room,temperature |
R556 |
T2783 |
T2785 |
amod |
dependent,kinase |
R5560 |
T19074 |
T19072 |
pobj |
temperature,at |
R5561 |
T19075 |
T19030 |
punct |
.,stimulated |
R5562 |
T19077 |
T19078 |
nsubj |
Cells,washed |
R5563 |
T19079 |
T19078 |
aux |
were,washed |
R5564 |
T19080 |
T19078 |
advmod |
once,washed |
R5565 |
T19081 |
T19078 |
prep |
in,washed |
R5566 |
T19082 |
T19083 |
nummod |
10,mM |
R5567 |
T19083 |
T19084 |
compound |
mM,Tris |
R5568 |
T19084 |
T19081 |
pobj |
Tris,in |
R5569 |
T19085 |
T19086 |
punct |
(,pH |
R557 |
T2784 |
T2783 |
punct |
-,dependent |
R5570 |
T19086 |
T19084 |
parataxis |
pH,Tris |
R5571 |
T19087 |
T19086 |
nummod |
8,pH |
R5572 |
T19088 |
T19086 |
punct |
),pH |
R5573 |
T19089 |
T19078 |
cc |
and,washed |
R5574 |
T19090 |
T19091 |
nummod |
three,times |
R5575 |
T19091 |
T19092 |
npadvmod |
times,in |
R5576 |
T19092 |
T19078 |
conj |
in,washed |
R5577 |
T19093 |
T19092 |
pobj |
PBS,in |
R5578 |
T19094 |
T19078 |
punct |
", ",washed |
R5579 |
T19095 |
T19096 |
prep |
after,purified |
R558 |
T2785 |
T2781 |
pobj |
kinase,by |
R5580 |
T19096 |
T19078 |
advcl |
purified,washed |
R5581 |
T19097 |
T19095 |
pobj |
which,after |
R5582 |
T19098 |
T19096 |
nsubjpass |
membranes,purified |
R5583 |
T19099 |
T19096 |
auxpass |
were,purified |
R5584 |
T19100 |
T19096 |
cc |
and,purified |
R5585 |
T19101 |
T19096 |
conj |
solubilized,purified |
R5586 |
T19102 |
T19103 |
mark |
as,described |
R5587 |
T19103 |
T19101 |
advcl |
described,solubilized |
R5588 |
T19104 |
T19103 |
advmod |
above,described |
R5589 |
T19105 |
T19078 |
punct |
.,washed |
R559 |
T2786 |
T2785 |
compound |
protein,kinase |
R5590 |
T19107 |
T19108 |
amod |
Solubilized,membranes |
R5591 |
T19108 |
T19109 |
nsubjpass |
membranes,incubated |
R5592 |
T19110 |
T19109 |
auxpass |
were,incubated |
R5593 |
T19111 |
T19109 |
prep |
with,incubated |
R5594 |
T19112 |
T19113 |
nummod |
20,μl |
R5595 |
T19113 |
T19111 |
pobj |
μl,with |
R5596 |
T19114 |
T19113 |
prep |
of,μl |
R5597 |
T19115 |
T19116 |
amod |
immobilized,streptavidin |
R5598 |
T19116 |
T19114 |
pobj |
streptavidin,of |
R5599 |
T19117 |
T19118 |
punct |
(,Biotechnology |
R560 |
T2787 |
T2788 |
punct |
[,9 |
R5600 |
T19118 |
T19116 |
parataxis |
Biotechnology,streptavidin |
R5601 |
T19119 |
T19118 |
compound |
Pierce,Biotechnology |
R5602 |
T19120 |
T19118 |
punct |
),Biotechnology |
R5603 |
T19121 |
T19109 |
prep |
for,incubated |
R5604 |
T19122 |
T19123 |
nummod |
2,h |
R5605 |
T19123 |
T19121 |
pobj |
h,for |
R5606 |
T19124 |
T19109 |
prep |
at,incubated |
R5607 |
T19125 |
T19126 |
nummod |
4,°C |
R5608 |
T19126 |
T19124 |
pobj |
°C,at |
R5609 |
T19127 |
T19109 |
punct |
.,incubated |
R561 |
T2788 |
T2775 |
parataxis |
9,phosphorylation |
R5610 |
T19129 |
T19130 |
advmod |
Finally,washed |
R5611 |
T19131 |
T19132 |
det |
the,proteins |
R5612 |
T19132 |
T19130 |
nsubjpass |
proteins,washed |
R5613 |
T19133 |
T19132 |
amod |
precipitated,proteins |
R5614 |
T19134 |
T19130 |
auxpass |
were,washed |
R5615 |
T19135 |
T19130 |
prep |
in,washed |
R5616 |
T19136 |
T19137 |
compound |
RIPA,buffer |
R5617 |
T19137 |
T19135 |
pobj |
buffer,in |
R5618 |
T19138 |
T19130 |
cc |
and,washed |
R5619 |
T19139 |
T19130 |
conj |
boiled,washed |
R562 |
T2789 |
T2788 |
punct |
],9 |
R5620 |
T19140 |
T19139 |
prep |
in,boiled |
R5621 |
T19141 |
T19142 |
nummod |
50,μl |
R5622 |
T19142 |
T19140 |
pobj |
μl,in |
R5623 |
T19143 |
T19142 |
prep |
of,μl |
R5624 |
T19144 |
T19145 |
compound |
Laemmli,buffer |
R5625 |
T19145 |
T19143 |
pobj |
buffer,of |
R5626 |
T19146 |
T19130 |
punct |
.,washed |
R5627 |
T19148 |
T19149 |
amod |
Total,cells |
R5628 |
T19149 |
T19150 |
nsubj |
cells,immunoblotting |
R5629 |
T19151 |
T19149 |
cc |
and,cells |
R563 |
T2790 |
T2775 |
cc |
and,phosphorylation |
R5630 |
T19152 |
T19153 |
det |
the,precipitates |
R5631 |
T19153 |
T19149 |
conj |
precipitates,cells |
R5632 |
T19154 |
T19153 |
amod |
biotinylated,precipitates |
R5633 |
T19155 |
T19150 |
aux |
were,immunoblotting |
R5634 |
T19156 |
T19150 |
advcl |
using,immunoblotting |
R5635 |
T19157 |
T19158 |
det |
an,antibody |
R5636 |
T19158 |
T19156 |
dobj |
antibody,using |
R5637 |
T19159 |
T19158 |
prep |
to,antibody |
R5638 |
T19160 |
T19159 |
pobj |
AQP2,to |
R5639 |
T19161 |
T19150 |
punct |
.,immunoblotting |
R564 |
T2791 |
T2792 |
poss |
its,redistribution |
R5640 |
T19603 |
T19604 |
compound |
Kidney,immunohistochemistry |
R5641 |
T19605 |
T19604 |
punct |
.,immunohistochemistry |
R5642 |
T19607 |
T19608 |
amod |
Whole,kidneys |
R5643 |
T19608 |
T19610 |
nsubjpass |
kidneys,fixed |
R5644 |
T19609 |
T19608 |
compound |
mouse,kidneys |
R5645 |
T19611 |
T19610 |
auxpass |
were,fixed |
R5646 |
T19612 |
T19610 |
prep |
in,fixed |
R5647 |
T19613 |
T19614 |
nummod |
10,% |
R5648 |
T19614 |
T19615 |
nmod |
%,formalin |
R5649 |
T19615 |
T19612 |
pobj |
formalin,in |
R565 |
T2792 |
T2775 |
conj |
redistribution,phosphorylation |
R5650 |
T19616 |
T19617 |
npadvmod |
phosphate,buffered |
R5651 |
T19617 |
T19615 |
amod |
buffered,formalin |
R5652 |
T19618 |
T19617 |
punct |
-,buffered |
R5653 |
T19619 |
T19610 |
prep |
for,fixed |
R5654 |
T19620 |
T19621 |
nummod |
24,h |
R5655 |
T19621 |
T19619 |
pobj |
h,for |
R5656 |
T19622 |
T19610 |
punct |
.,fixed |
R5657 |
T19624 |
T19625 |
nsubjpass |
Kidneys,embedded |
R5658 |
T19626 |
T19625 |
auxpass |
were,embedded |
R5659 |
T19627 |
T19625 |
prep |
in,embedded |
R566 |
T2793 |
T2792 |
prep |
to,redistribution |
R5660 |
T19628 |
T19627 |
pobj |
paraffin,in |
R5661 |
T19629 |
T19625 |
punct |
", ",embedded |
R5662 |
T19630 |
T19625 |
cc |
and,embedded |
R5663 |
T19631 |
T19632 |
nummod |
5,μm |
R5664 |
T19632 |
T19634 |
compound |
μm,sections |
R5665 |
T19633 |
T19632 |
punct |
-,μm |
R5666 |
T19634 |
T19635 |
nsubjpass |
sections,prepared |
R5667 |
T19635 |
T19625 |
conj |
prepared,embedded |
R5668 |
T19636 |
T19635 |
auxpass |
were,prepared |
R5669 |
T19637 |
T19635 |
punct |
.,prepared |
R567 |
T2794 |
T2795 |
det |
the,membrane |
R5670 |
T19639 |
T19640 |
prep |
Following,probed |
R5671 |
T19641 |
T19642 |
compound |
antigen,retrieval |
R5672 |
T19642 |
T19639 |
pobj |
retrieval,Following |
R5673 |
T19643 |
T19642 |
acl |
using,retrieval |
R5674 |
T19644 |
T19645 |
nummod |
10,mM |
R5675 |
T19645 |
T19646 |
compound |
mM,citrate |
R5676 |
T19646 |
T19643 |
dobj |
citrate,using |
R5677 |
T19647 |
T19646 |
compound |
sodium,citrate |
R5678 |
T19648 |
T19646 |
punct |
(,citrate |
R5679 |
T19649 |
T19646 |
npadvmod |
pH,citrate |
R568 |
T2795 |
T2793 |
pobj |
membrane,to |
R5680 |
T19650 |
T19649 |
nummod |
8,pH |
R5681 |
T19651 |
T19646 |
punct |
),citrate |
R5682 |
T19652 |
T19643 |
prep |
for,using |
R5683 |
T19653 |
T19654 |
nummod |
10,min |
R5684 |
T19654 |
T19652 |
pobj |
min,for |
R5685 |
T19655 |
T19643 |
prep |
at,using |
R5686 |
T19656 |
T19657 |
nummod |
98,°C |
R5687 |
T19657 |
T19655 |
pobj |
°C,at |
R5688 |
T19658 |
T19640 |
punct |
", ",probed |
R5689 |
T19659 |
T19640 |
nsubjpass |
sections,probed |
R569 |
T2796 |
T2795 |
compound |
plasma,membrane |
R5690 |
T19660 |
T19640 |
auxpass |
were,probed |
R5691 |
T19661 |
T19640 |
advmod |
sequentially,probed |
R5692 |
T19662 |
T19640 |
punct |
", ",probed |
R5693 |
T19663 |
T19664 |
advmod |
first,for |
R5694 |
T19664 |
T19640 |
prep |
for,probed |
R5695 |
T19665 |
T19664 |
pobj |
AQP3,for |
R5696 |
T19666 |
T19664 |
cc |
and,for |
R5697 |
T19667 |
T19668 |
advmod |
then,for |
R5698 |
T19668 |
T19664 |
conj |
for,for |
R5699 |
T19669 |
T19668 |
pobj |
AQP2,for |
R570 |
T2797 |
T2746 |
punct |
.,binds |
R5700 |
T19670 |
T19640 |
punct |
.,probed |
R5701 |
T19672 |
T19673 |
nsubjpass |
Sections,incubated |
R5702 |
T19674 |
T19673 |
auxpass |
were,incubated |
R5703 |
T19675 |
T19673 |
prep |
in,incubated |
R5704 |
T19676 |
T19677 |
nummod |
5,% |
R5705 |
T19677 |
T19678 |
compound |
%,serum |
R5706 |
T19678 |
T19675 |
pobj |
serum,in |
R5707 |
T19679 |
T19678 |
compound |
donkey,serum |
R5708 |
T19680 |
T19673 |
cc |
and,incubated |
R5709 |
T19681 |
T19682 |
advmod |
then,in |
R571 |
T2799 |
T2800 |
det |
The,importance |
R5710 |
T19682 |
T19673 |
conj |
in,incubated |
R5711 |
T19683 |
T19684 |
nmod |
goat,antibody |
R5712 |
T19684 |
T19682 |
pobj |
antibody,in |
R5713 |
T19685 |
T19684 |
amod |
anti-AQP3,antibody |
R5714 |
T19686 |
T19687 |
punct |
(,sc |
R5715 |
T19687 |
T19684 |
parataxis |
sc,antibody |
R5716 |
T19688 |
T19687 |
dep |
1,sc |
R5717 |
T19689 |
T19690 |
punct |
:,100 |
R5718 |
T19690 |
T19688 |
prep |
100,1 |
R5719 |
T19691 |
T19687 |
punct |
;,sc |
R572 |
T2800 |
T2801 |
nsubjpass |
importance,highlighted |
R5720 |
T19692 |
T19693 |
compound |
Santa,Cruz |
R5721 |
T19693 |
T19694 |
compound |
Cruz,Biotechnology |
R5722 |
T19694 |
T19687 |
dep |
Biotechnology,sc |
R5723 |
T19695 |
T19687 |
punct |
;,sc |
R5724 |
T19696 |
T19687 |
punct |
#,sc |
R5725 |
T19697 |
T19687 |
punct |
-,sc |
R5726 |
T19698 |
T19687 |
nummod |
9885,sc |
R5727 |
T19699 |
T19687 |
punct |
),sc |
R5728 |
T19700 |
T19673 |
punct |
.,incubated |
R5729 |
T19702 |
T19703 |
nsubjpass |
Slides,washed |
R573 |
T2802 |
T2800 |
prep |
of,importance |
R5730 |
T19704 |
T19703 |
auxpass |
were,washed |
R5731 |
T19705 |
T19703 |
prep |
with,washed |
R5732 |
T19706 |
T19705 |
pobj |
PBS,with |
R5733 |
T19707 |
T19703 |
cc |
and,washed |
R5734 |
T19708 |
T19703 |
conj |
incubated,washed |
R5735 |
T19709 |
T19708 |
prep |
with,incubated |
R5736 |
T19710 |
T19711 |
npadvmod |
AlexaFluor,conjugated |
R5737 |
T19711 |
T19714 |
amod |
conjugated,antibody |
R5738 |
T19712 |
T19710 |
nummod |
488,AlexaFluor |
R5739 |
T19713 |
T19711 |
punct |
-,conjugated |
R574 |
T2803 |
T2804 |
compound |
AQP2,redistribution |
R5740 |
T19714 |
T19709 |
pobj |
antibody,with |
R5741 |
T19715 |
T19714 |
nmod |
donkey,antibody |
R5742 |
T19716 |
T19714 |
amod |
anti-goat,antibody |
R5743 |
T19717 |
T19718 |
punct |
(,Probes |
R5744 |
T19718 |
T19714 |
parataxis |
Probes,antibody |
R5745 |
T19719 |
T19718 |
compound |
Molecular,Probes |
R5746 |
T19720 |
T19718 |
punct |
", ",Probes |
R5747 |
T19721 |
T19718 |
npadvmod |
Eugene,Probes |
R5748 |
T19722 |
T19718 |
punct |
", ",Probes |
R5749 |
T19723 |
T19718 |
npadvmod |
Oregon,Probes |
R575 |
T2804 |
T2802 |
pobj |
redistribution,of |
R5750 |
T19724 |
T19718 |
punct |
", ",Probes |
R5751 |
T19725 |
T19726 |
compound |
United,States |
R5752 |
T19726 |
T19718 |
npadvmod |
States,Probes |
R5753 |
T19727 |
T19718 |
punct |
),Probes |
R5754 |
T19728 |
T19703 |
punct |
.,washed |
R5755 |
T19730 |
T19731 |
det |
The,slides |
R5756 |
T19731 |
T19732 |
nsubjpass |
slides,incubated |
R5757 |
T19733 |
T19732 |
auxpass |
were,incubated |
R5758 |
T19734 |
T19732 |
advmod |
subsequently,incubated |
R5759 |
T19735 |
T19732 |
aux |
blocked,incubated |
R576 |
T2805 |
T2801 |
aux |
has,highlighted |
R5760 |
T19736 |
T19732 |
prep |
in,incubated |
R5761 |
T19737 |
T19738 |
nummod |
5,% |
R5762 |
T19738 |
T19739 |
compound |
%,serum |
R5763 |
T19739 |
T19736 |
pobj |
serum,in |
R5764 |
T19740 |
T19739 |
compound |
chicken,serum |
R5765 |
T19741 |
T19732 |
punct |
", ",incubated |
R5766 |
T19742 |
T19732 |
prep |
with,incubated |
R5767 |
T19743 |
T19744 |
det |
a,antibody |
R5768 |
T19744 |
T19742 |
pobj |
antibody,with |
R5769 |
T19745 |
T19744 |
nmod |
rabbit,antibody |
R577 |
T2806 |
T2801 |
auxpass |
been,highlighted |
R5770 |
T19746 |
T19744 |
amod |
anti-AQP2,antibody |
R5771 |
T19747 |
T19748 |
punct |
(,A3000 |
R5772 |
T19748 |
T19744 |
parataxis |
A3000,antibody |
R5773 |
T19749 |
T19748 |
dep |
1,A3000 |
R5774 |
T19750 |
T19751 |
punct |
:,250 |
R5775 |
T19751 |
T19749 |
prep |
250,1 |
R5776 |
T19752 |
T19748 |
punct |
;,A3000 |
R5777 |
T19753 |
T19748 |
dep |
USB,A3000 |
R5778 |
T19754 |
T19753 |
punct |
", ",USB |
R5779 |
T19755 |
T19753 |
npadvmod |
Cleveland,USB |
R578 |
T2807 |
T2801 |
agent |
by,highlighted |
R5780 |
T19756 |
T19753 |
punct |
", ",USB |
R5781 |
T19757 |
T19753 |
npadvmod |
Ohio,USB |
R5782 |
T19758 |
T19753 |
punct |
", ",USB |
R5783 |
T19759 |
T19760 |
compound |
United,States |
R5784 |
T19760 |
T19753 |
npadvmod |
States,USB |
R5785 |
T19761 |
T19748 |
punct |
;,A3000 |
R5786 |
T19762 |
T19748 |
punct |
#,A3000 |
R5787 |
T19763 |
T19748 |
punct |
–,A3000 |
R5788 |
T19764 |
T19748 |
nummod |
06,A3000 |
R5789 |
T19765 |
T19748 |
punct |
),A3000 |
R579 |
T2808 |
T2809 |
amod |
functional,characterization |
R5790 |
T19766 |
T19744 |
punct |
", ",antibody |
R5791 |
T19767 |
T19768 |
dep |
which,detected |
R5792 |
T19768 |
T19744 |
relcl |
detected,antibody |
R5793 |
T19769 |
T19768 |
auxpass |
was,detected |
R5794 |
T19770 |
T19768 |
prep |
with,detected |
R5795 |
T19771 |
T19772 |
det |
a,antibody |
R5796 |
T19772 |
T19770 |
pobj |
antibody,with |
R5797 |
T19773 |
T19774 |
npadvmod |
AlexaFluor,conjugated |
R5798 |
T19774 |
T19772 |
amod |
conjugated,antibody |
R5799 |
T19775 |
T19773 |
nummod |
594,AlexaFluor |
R580 |
T2809 |
T2807 |
pobj |
characterization,by |
R5800 |
T19776 |
T19774 |
punct |
-,conjugated |
R5801 |
T19777 |
T19772 |
nmod |
chicken,antibody |
R5802 |
T19778 |
T19772 |
amod |
anti-rabbit,antibody |
R5803 |
T19779 |
T19780 |
punct |
(,Probes |
R5804 |
T19780 |
T19772 |
parataxis |
Probes,antibody |
R5805 |
T19781 |
T19780 |
dep |
1,Probes |
R5806 |
T19782 |
T19783 |
punct |
:,500 |
R5807 |
T19783 |
T19781 |
prep |
500,1 |
R5808 |
T19784 |
T19780 |
punct |
;,Probes |
R5809 |
T19785 |
T19780 |
compound |
Molecular,Probes |
R581 |
T2810 |
T2809 |
prep |
of,characterization |
R5810 |
T19786 |
T19780 |
punct |
),Probes |
R5811 |
T19787 |
T19732 |
punct |
.,incubated |
R5812 |
T19789 |
T19790 |
det |
The,sections |
R5813 |
T19790 |
T19791 |
nsubjpass |
sections,stained |
R5814 |
T19792 |
T19791 |
auxpass |
were,stained |
R5815 |
T19793 |
T19791 |
prep |
with,stained |
R5816 |
T19794 |
T19793 |
pobj |
DAPI,with |
R5817 |
T19795 |
T19791 |
cc |
and,stained |
R5818 |
T19796 |
T19791 |
conj |
mounted,stained |
R5819 |
T19797 |
T19796 |
prep |
in,mounted |
R582 |
T2811 |
T2812 |
compound |
Aqp2,mutations |
R5820 |
T19798 |
T19797 |
pobj |
Vectashield,in |
R5821 |
T19799 |
T19800 |
punct |
(,Labs |
R5822 |
T19800 |
T19796 |
parataxis |
Labs,mounted |
R5823 |
T19801 |
T19800 |
compound |
Vector,Labs |
R5824 |
T19802 |
T19800 |
punct |
", ",Labs |
R5825 |
T19803 |
T19800 |
npadvmod |
Burlingame,Labs |
R5826 |
T19804 |
T19800 |
punct |
", ",Labs |
R5827 |
T19805 |
T19800 |
npadvmod |
California,Labs |
R5828 |
T19806 |
T19800 |
punct |
", ",Labs |
R5829 |
T19807 |
T19808 |
compound |
United,States |
R583 |
T2812 |
T2810 |
pobj |
mutations,of |
R5830 |
T19808 |
T19800 |
npadvmod |
States,Labs |
R5831 |
T19809 |
T19800 |
punct |
),Labs |
R5832 |
T19810 |
T19791 |
punct |
.,stained |
R5833 |
T20425 |
T20424 |
prep |
on,Immunocytochemistry |
R5834 |
T20426 |
T20427 |
compound |
MDCK,cells |
R5835 |
T20427 |
T20425 |
pobj |
cells,on |
R5836 |
T20428 |
T20424 |
punct |
.,Immunocytochemistry |
R5837 |
T20430 |
T20431 |
nmod |
MDCK,lines |
R5838 |
T20431 |
T20434 |
nsubjpass |
lines,grown |
R5839 |
T20432 |
T20431 |
amod |
stable,lines |
R584 |
T2813 |
T2801 |
advcl |
resulting,highlighted |
R5840 |
T20433 |
T20431 |
compound |
cell,lines |
R5841 |
T20435 |
T20431 |
acl |
expressing,lines |
R5842 |
T20436 |
T20435 |
dobj |
vector,expressing |
R5843 |
T20437 |
T20436 |
amod |
alone,vector |
R5844 |
T20438 |
T20436 |
punct |
", ",vector |
R5845 |
T20439 |
T20440 |
amod |
wild,type |
R5846 |
T20440 |
T20442 |
compound |
type,AQP2 |
R5847 |
T20441 |
T20440 |
punct |
-,type |
R5848 |
T20442 |
T20436 |
conj |
AQP2,vector |
R5849 |
T20443 |
T20442 |
punct |
", ",AQP2 |
R585 |
T2814 |
T2813 |
prep |
in,resulting |
R5850 |
T20444 |
T20442 |
cc |
or,AQP2 |
R5851 |
T20445 |
T20446 |
compound |
AQP2,F204V |
R5852 |
T20446 |
T20442 |
conj |
F204V,AQP2 |
R5853 |
T20447 |
T20446 |
punct |
-,F204V |
R5854 |
T20448 |
T20435 |
punct |
(,expressing |
R5855 |
T20449 |
T20435 |
cc |
and,expressing |
R5856 |
T20450 |
T20451 |
prep |
in,expressing |
R5857 |
T20451 |
T20435 |
conj |
expressing,expressing |
R5858 |
T20452 |
T20453 |
det |
some,cases |
R5859 |
T20453 |
T20450 |
pobj |
cases,in |
R586 |
T2815 |
T2816 |
amod |
severe,NDI |
R5860 |
T20454 |
T20451 |
advmod |
transiently,expressing |
R5861 |
T20455 |
T20456 |
det |
a,construct |
R5862 |
T20456 |
T20451 |
dobj |
construct,expressing |
R5863 |
T20457 |
T20456 |
compound |
GFP,construct |
R5864 |
T20458 |
T20451 |
punct |
),expressing |
R5865 |
T20459 |
T20434 |
auxpass |
were,grown |
R5866 |
T20460 |
T20434 |
prep |
on,grown |
R5867 |
T20461 |
T20462 |
npadvmod |
fibronectin,coated |
R5868 |
T20462 |
T20464 |
amod |
coated,coverslips |
R5869 |
T20463 |
T20462 |
punct |
-,coated |
R587 |
T2816 |
T2814 |
pobj |
NDI,in |
R5870 |
T20464 |
T20460 |
pobj |
coverslips,on |
R5871 |
T20465 |
T20466 |
mark |
until,formed |
R5872 |
T20466 |
T20434 |
advcl |
formed,grown |
R5873 |
T20467 |
T20468 |
amod |
tight,junctions |
R5874 |
T20468 |
T20466 |
nsubj |
junctions,formed |
R5875 |
T20469 |
T20434 |
punct |
.,grown |
R5876 |
T20471 |
T20472 |
nsubjpass |
Cells,treated |
R5877 |
T20473 |
T20472 |
auxpass |
were,treated |
R5878 |
T20474 |
T20472 |
prep |
with,treated |
R5879 |
T20475 |
T20474 |
cc |
or,with |
R588 |
T2817 |
T2813 |
prep |
in,resulting |
R5880 |
T20476 |
T20474 |
conj |
without,with |
R5881 |
T20477 |
T20478 |
nummod |
150,μM |
R5882 |
T20478 |
T20479 |
compound |
μM,forskolin |
R5883 |
T20479 |
T20476 |
pobj |
forskolin,without |
R5884 |
T20480 |
T20472 |
prep |
for,treated |
R5885 |
T20481 |
T20482 |
nummod |
90,min |
R5886 |
T20482 |
T20480 |
pobj |
min,for |
R5887 |
T20483 |
T20472 |
punct |
", ",treated |
R5888 |
T20484 |
T20472 |
cc |
and,treated |
R5889 |
T20485 |
T20472 |
conj |
fixed,treated |
R589 |
T2818 |
T2817 |
pobj |
humans,in |
R5890 |
T20486 |
T20485 |
prep |
in,fixed |
R5891 |
T20487 |
T20486 |
pobj |
methanol,in |
R5892 |
T20488 |
T20485 |
prep |
at,fixed |
R5893 |
T20489 |
T20490 |
punct |
−,20 |
R5894 |
T20490 |
T20491 |
nummod |
20,°C |
R5895 |
T20491 |
T20488 |
pobj |
°C,at |
R5896 |
T20492 |
T20472 |
punct |
.,treated |
R5897 |
T20494 |
T20495 |
advmod |
Subsequently,washed |
R5898 |
T20496 |
T20495 |
punct |
", ",washed |
R5899 |
T20497 |
T20495 |
nsubj |
cells,washed |
R590 |
T2819 |
T2820 |
punct |
[,10 |
R5900 |
T20498 |
T20495 |
aux |
were,washed |
R5901 |
T20499 |
T20495 |
cc |
and,washed |
R5902 |
T20500 |
T20495 |
conj |
permeabilized,washed |
R5903 |
T20501 |
T20500 |
prep |
in,permeabilized |
R5904 |
T20502 |
T20503 |
nummod |
0.2,% |
R5905 |
T20503 |
T20504 |
compound |
%,X |
R5906 |
T20504 |
T20501 |
pobj |
X,in |
R5907 |
T20505 |
T20504 |
compound |
Triton,X |
R5908 |
T20506 |
T20504 |
punct |
-,X |
R5909 |
T20507 |
T20504 |
nummod |
100,X |
R591 |
T2820 |
T2801 |
parataxis |
10,highlighted |
R5910 |
T20508 |
T20500 |
prep |
for,permeabilized |
R5911 |
T20509 |
T20510 |
nummod |
5,min |
R5912 |
T20510 |
T20508 |
pobj |
min,for |
R5913 |
T20511 |
T20495 |
punct |
", ",washed |
R5914 |
T20512 |
T20495 |
cc |
and,washed |
R5915 |
T20513 |
T20514 |
advmod |
sequentially,probed |
R5916 |
T20514 |
T20495 |
conj |
probed,washed |
R5917 |
T20515 |
T20514 |
prep |
for,probed |
R5918 |
T20516 |
T20515 |
pobj |
AQP2,for |
R5919 |
T20517 |
T20516 |
cc |
and,AQP2 |
R592 |
T2821 |
T2820 |
nummod |
3,10 |
R5920 |
T20518 |
T20519 |
compound |
organelle,markers |
R5921 |
T20519 |
T20516 |
conj |
markers,AQP2 |
R5922 |
T20520 |
T20519 |
prep |
for,markers |
R5923 |
T20521 |
T20522 |
preconj |
either,PM |
R5924 |
T20522 |
T20520 |
pobj |
PM,for |
R5925 |
T20523 |
T20522 |
det |
the,PM |
R5926 |
T20524 |
T20522 |
cc |
or,PM |
R5927 |
T20525 |
T20526 |
det |
the,ER |
R5928 |
T20526 |
T20522 |
conj |
ER,PM |
R5929 |
T20527 |
T20495 |
punct |
.,washed |
R593 |
T2822 |
T2820 |
punct |
",",10 |
R5930 |
T20529 |
T20530 |
nsubjpass |
AQP2,detected |
R5931 |
T20531 |
T20530 |
auxpass |
was,detected |
R5932 |
T20532 |
T20530 |
advcl |
using,detected |
R5933 |
T20533 |
T20532 |
dobj |
goat,using |
R5934 |
T20534 |
T20533 |
amod |
anti-AQP2,goat |
R5935 |
T20535 |
T20536 |
punct |
(,sc |
R5936 |
T20536 |
T20533 |
parataxis |
sc,goat |
R5937 |
T20537 |
T20536 |
dep |
1,sc |
R5938 |
T20538 |
T20539 |
punct |
:,100 |
R5939 |
T20539 |
T20537 |
prep |
100,1 |
R594 |
T2823 |
T2820 |
punct |
],10 |
R5940 |
T20540 |
T20536 |
punct |
;,sc |
R5941 |
T20541 |
T20542 |
compound |
Santa,Cruz |
R5942 |
T20542 |
T20543 |
compound |
Cruz,Biotechnology |
R5943 |
T20543 |
T20536 |
dep |
Biotechnology,sc |
R5944 |
T20544 |
T20536 |
punct |
;,sc |
R5945 |
T20545 |
T20536 |
punct |
#,sc |
R5946 |
T20546 |
T20536 |
punct |
-,sc |
R5947 |
T20547 |
T20536 |
nummod |
9882,sc |
R5948 |
T20548 |
T20536 |
punct |
),sc |
R5949 |
T20549 |
T20533 |
cc |
and,goat |
R595 |
T2824 |
T2801 |
punct |
.,highlighted |
R5950 |
T20550 |
T20551 |
det |
a,dilution |
R5951 |
T20551 |
T20533 |
conj |
dilution,goat |
R5952 |
T20552 |
T20553 |
quantmod |
1,200 |
R5953 |
T20553 |
T20551 |
nummod |
200,dilution |
R5954 |
T20554 |
T20553 |
punct |
:,200 |
R5955 |
T20555 |
T20551 |
prep |
of,dilution |
R5956 |
T20556 |
T20557 |
npadvmod |
AlexaFluor,conjugated |
R5957 |
T20557 |
T20560 |
amod |
conjugated,antibody |
R5958 |
T20558 |
T20556 |
nummod |
488,AlexaFluor |
R5959 |
T20559 |
T20557 |
punct |
-,conjugated |
R596 |
T2826 |
T2827 |
amod |
Recessive,mutations |
R5960 |
T20560 |
T20555 |
pobj |
antibody,of |
R5961 |
T20561 |
T20560 |
nmod |
donkey,antibody |
R5962 |
T20562 |
T20560 |
amod |
anti-goat,antibody |
R5963 |
T20563 |
T20560 |
amod |
secondary,antibody |
R5964 |
T20564 |
T20530 |
punct |
.,detected |
R5965 |
T20566 |
T20567 |
det |
The,PM |
R5966 |
T20567 |
T20568 |
nsubjpass |
PM,probed |
R5967 |
T20569 |
T20567 |
cc |
and,PM |
R5968 |
T20570 |
T20567 |
conj |
ER,PM |
R5969 |
T20571 |
T20568 |
auxpass |
were,probed |
R597 |
T2827 |
T2829 |
nsubjpass |
mutations,thought |
R5970 |
T20572 |
T20568 |
advcl |
using,probed |
R5971 |
T20573 |
T20574 |
nmod |
mouse,ATPase |
R5972 |
T20574 |
T20579 |
nmod |
ATPase,antibodies |
R5973 |
T20575 |
T20574 |
amod |
anti-Na+,ATPase |
R5974 |
T20576 |
T20574 |
punct |
/,ATPase |
R5975 |
T20577 |
T20574 |
nmod |
K+,ATPase |
R5976 |
T20578 |
T20574 |
punct |
-,ATPase |
R5977 |
T20579 |
T20572 |
dobj |
antibodies,using |
R5978 |
T20580 |
T20581 |
punct |
(,Upstate |
R5979 |
T20581 |
T20574 |
parataxis |
Upstate,ATPase |
R598 |
T2828 |
T2827 |
compound |
Aqp2,mutations |
R5980 |
T20582 |
T20581 |
punct |
", ",Upstate |
R5981 |
T20583 |
T20581 |
npadvmod |
Waltham,Upstate |
R5982 |
T20584 |
T20581 |
punct |
", ",Upstate |
R5983 |
T20585 |
T20581 |
npadvmod |
Massachusetts,Upstate |
R5984 |
T20586 |
T20581 |
punct |
", ",Upstate |
R5985 |
T20587 |
T20588 |
compound |
United,States |
R5986 |
T20588 |
T20581 |
npadvmod |
States,Upstate |
R5987 |
T20589 |
T20581 |
punct |
),Upstate |
R5988 |
T20590 |
T20574 |
cc |
or,ATPase |
R5989 |
T20591 |
T20592 |
npadvmod |
rabbit,anti-calnexin |
R599 |
T2830 |
T2829 |
auxpass |
are,thought |
R5990 |
T20592 |
T20574 |
conj |
anti-calnexin,ATPase |
R5991 |
T20593 |
T20594 |
punct |
(,Biotechnology |
R5992 |
T20594 |
T20592 |
parataxis |
Biotechnology,anti-calnexin |
R5993 |
T20595 |
T20594 |
compound |
Stressgen,Biotechnology |
R5994 |
T20596 |
T20594 |
punct |
", ",Biotechnology |
R5995 |
T20597 |
T20594 |
npadvmod |
Victoria,Biotechnology |
R5996 |
T20598 |
T20594 |
punct |
", ",Biotechnology |
R5997 |
T20599 |
T20600 |
compound |
British,Columbia |
R5998 |
T20600 |
T20594 |
npadvmod |
Columbia,Biotechnology |
R5999 |
T20601 |
T20594 |
punct |
", ",Biotechnology |
R600 |
T2831 |
T2829 |
advmod |
generally,thought |
R6000 |
T20602 |
T20594 |
npadvmod |
Canada,Biotechnology |
R6001 |
T20603 |
T20594 |
punct |
),Biotechnology |
R6002 |
T20604 |
T20579 |
cc |
and,antibodies |
R6003 |
T20605 |
T20606 |
det |
the,antibodies |
R6004 |
T20606 |
T20579 |
conj |
antibodies,antibodies |
R6005 |
T20607 |
T20606 |
amod |
secondary,antibodies |
R6006 |
T20608 |
T20606 |
punct |
", ",antibodies |
R6007 |
T20609 |
T20610 |
npadvmod |
Cy3,conjugated |
R6008 |
T20610 |
T20612 |
amod |
conjugated,goat |
R6009 |
T20611 |
T20610 |
punct |
-,conjugated |
R601 |
T2832 |
T2833 |
aux |
to,produce |
R6010 |
T20612 |
T20606 |
appos |
goat,antibodies |
R6011 |
T20613 |
T20612 |
amod |
anti-mouse,goat |
R6012 |
T20614 |
T20615 |
punct |
(,ImmunoResearch |
R6013 |
T20615 |
T20612 |
parataxis |
ImmunoResearch,goat |
R6014 |
T20616 |
T20615 |
dep |
1,ImmunoResearch |
R6015 |
T20617 |
T20618 |
punct |
:,200 |
R6016 |
T20618 |
T20616 |
prep |
200,1 |
R6017 |
T20619 |
T20615 |
punct |
;,ImmunoResearch |
R6018 |
T20620 |
T20615 |
compound |
Jackson,ImmunoResearch |
R6019 |
T20621 |
T20615 |
punct |
", ",ImmunoResearch |
R602 |
T2833 |
T2829 |
xcomp |
produce,thought |
R6020 |
T20622 |
T20623 |
compound |
West,Grove |
R6021 |
T20623 |
T20615 |
npadvmod |
Grove,ImmunoResearch |
R6022 |
T20624 |
T20615 |
punct |
", ",ImmunoResearch |
R6023 |
T20625 |
T20615 |
npadvmod |
Pennsylvania,ImmunoResearch |
R6024 |
T20626 |
T20615 |
punct |
", ",ImmunoResearch |
R6025 |
T20627 |
T20628 |
compound |
United,States |
R6026 |
T20628 |
T20615 |
npadvmod |
States,ImmunoResearch |
R6027 |
T20629 |
T20615 |
punct |
),ImmunoResearch |
R6028 |
T20630 |
T20606 |
cc |
or,antibodies |
R6029 |
T20631 |
T20632 |
npadvmod |
AlexaFluor,conjugated |
R603 |
T2834 |
T2835 |
det |
an,pore |
R6030 |
T20632 |
T20635 |
amod |
conjugated,chicken |
R6031 |
T20633 |
T20631 |
nummod |
594,AlexaFluor |
R6032 |
T20634 |
T20632 |
punct |
-,conjugated |
R6033 |
T20635 |
T20606 |
conj |
chicken,antibodies |
R6034 |
T20636 |
T20635 |
amod |
anti-rabbit,chicken |
R6035 |
T20637 |
T20638 |
punct |
(,1 |
R6036 |
T20638 |
T20635 |
parataxis |
1,chicken |
R6037 |
T20639 |
T20640 |
punct |
:,200 |
R6038 |
T20640 |
T20638 |
prep |
200,1 |
R6039 |
T20641 |
T20638 |
punct |
),1 |
R604 |
T2835 |
T2833 |
dobj |
pore,produce |
R6040 |
T20642 |
T20572 |
advmod |
respectively,using |
R6041 |
T20643 |
T20568 |
punct |
.,probed |
R6042 |
T20645 |
T20646 |
nsubjpass |
Cells,washed |
R6043 |
T20647 |
T20646 |
auxpass |
were,washed |
R6044 |
T20648 |
T20646 |
prep |
in,washed |
R6045 |
T20649 |
T20648 |
pobj |
PBS,in |
R6046 |
T20650 |
T20646 |
punct |
", ",washed |
R6047 |
T20651 |
T20646 |
conj |
counterstained,washed |
R6048 |
T20652 |
T20651 |
prep |
with,counterstained |
R6049 |
T20653 |
T20652 |
pobj |
DAPI,with |
R605 |
T2836 |
T2837 |
advmod |
abnormally,localized |
R6050 |
T20654 |
T20651 |
punct |
", ",counterstained |
R6051 |
T20655 |
T20651 |
cc |
and,counterstained |
R6052 |
T20656 |
T20651 |
conj |
mounted,counterstained |
R6053 |
T20657 |
T20656 |
prep |
in,mounted |
R6054 |
T20658 |
T20657 |
pobj |
Vectashield,in |
R6055 |
T20659 |
T20646 |
punct |
.,washed |
R6056 |
T20661 |
T20662 |
prep |
In,probed |
R6057 |
T20663 |
T20661 |
pobj |
experiments,In |
R6058 |
T20664 |
T20665 |
prep |
in,used |
R6059 |
T20665 |
T20663 |
relcl |
used,experiments |
R606 |
T2837 |
T2835 |
amod |
localized,pore |
R6060 |
T20666 |
T20664 |
pobj |
which,in |
R6061 |
T20667 |
T20668 |
compound |
GFP,fusions |
R6062 |
T20668 |
T20665 |
nsubjpass |
fusions,used |
R6063 |
T20669 |
T20665 |
auxpass |
were,used |
R6064 |
T20670 |
T20662 |
punct |
", ",probed |
R6065 |
T20671 |
T20662 |
nsubjpass |
AQP2,probed |
R6066 |
T20672 |
T20662 |
auxpass |
was,probed |
R6067 |
T20673 |
T20662 |
advcl |
using,probed |
R6068 |
T20674 |
T20675 |
det |
the,combination |
R6069 |
T20675 |
T20673 |
dobj |
combination,using |
R607 |
T2838 |
T2837 |
cc |
and,localized |
R6070 |
T20676 |
T20675 |
compound |
antibody,combination |
R6071 |
T20677 |
T20675 |
acl |
used,combination |
R6072 |
T20678 |
T20677 |
prep |
for,used |
R6073 |
T20679 |
T20680 |
compound |
kidney,immunohistochemistry |
R6074 |
T20680 |
T20678 |
pobj |
immunohistochemistry,for |
R6075 |
T20681 |
T20662 |
prep |
in,probed |
R6076 |
T20682 |
T20681 |
pobj |
order,in |
R6077 |
T20683 |
T20684 |
aux |
to,detect |
R6078 |
T20684 |
T20682 |
acl |
detect,order |
R6079 |
T20685 |
T20686 |
det |
the,AQP2 |
R608 |
T2839 |
T2840 |
punct |
", ",misfolded |
R6080 |
T20686 |
T20684 |
dobj |
AQP2,detect |
R6081 |
T20687 |
T20684 |
prep |
at,detect |
R6082 |
T20688 |
T20689 |
nummod |
594,nm |
R6083 |
T20689 |
T20687 |
pobj |
nm,at |
R6084 |
T20690 |
T20684 |
punct |
", ",detect |
R6085 |
T20691 |
T20692 |
aux |
to,distinguish |
R6086 |
T20692 |
T20684 |
advcl |
distinguish,detect |
R6087 |
T20693 |
T20692 |
prep |
between,distinguish |
R6088 |
T20694 |
T20695 |
det |
the,proteins |
R6089 |
T20695 |
T20693 |
pobj |
proteins,between |
R609 |
T2840 |
T2837 |
conj |
misfolded,localized |
R6090 |
T20696 |
T20695 |
compound |
GFP,proteins |
R6091 |
T20697 |
T20695 |
compound |
fusion,proteins |
R6092 |
T20698 |
T20662 |
punct |
.,probed |
R6093 |
T20832 |
T20833 |
amod |
Confocal,microscopy |
R6094 |
T20834 |
T20833 |
punct |
.,microscopy |
R6095 |
T20836 |
T20837 |
amod |
Optical,images |
R6096 |
T20837 |
T20841 |
nsubjpass |
images,collected |
R6097 |
T20838 |
T20839 |
compound |
z,section |
R6098 |
T20839 |
T20837 |
compound |
section,images |
R6099 |
T20840 |
T20839 |
punct |
-,section |
R610 |
T2841 |
T2840 |
prep |
in,misfolded |
R6100 |
T20842 |
T20841 |
auxpass |
were,collected |
R6101 |
T20843 |
T20841 |
prep |
on,collected |
R6102 |
T20844 |
T20845 |
det |
a,Microscope |
R6103 |
T20845 |
T20843 |
pobj |
Microscope,on |
R6104 |
T20846 |
T20845 |
nmod |
BioRad,Microscope |
R6105 |
T20847 |
T20848 |
punct |
(,Hercules |
R6106 |
T20848 |
T20846 |
parataxis |
Hercules,BioRad |
R6107 |
T20849 |
T20848 |
punct |
", ",Hercules |
R6108 |
T20850 |
T20848 |
npadvmod |
California,Hercules |
R6109 |
T20851 |
T20848 |
punct |
", ",Hercules |
R611 |
T2842 |
T2843 |
amod |
most,instances |
R6110 |
T20852 |
T20853 |
compound |
United,States |
R6111 |
T20853 |
T20848 |
npadvmod |
States,Hercules |
R6112 |
T20854 |
T20848 |
punct |
),Hercules |
R6113 |
T20855 |
T20856 |
nmod |
Rainbow,Radiance |
R6114 |
T20856 |
T20845 |
nmod |
Radiance,Microscope |
R6115 |
T20857 |
T20856 |
nummod |
2100,Radiance |
R6116 |
T20858 |
T20859 |
compound |
Laser,Scanning |
R6117 |
T20859 |
T20845 |
compound |
Scanning,Microscope |
R6118 |
T20860 |
T20845 |
compound |
Confocal,Microscope |
R6119 |
T20861 |
T20841 |
punct |
.,collected |
R612 |
T2843 |
T2841 |
pobj |
instances,in |
R6120 |
T20863 |
T20864 |
compound |
Image,stacks |
R6121 |
T20864 |
T20865 |
nsubjpass |
stacks,flattened |
R6122 |
T20866 |
T20865 |
auxpass |
were,flattened |
R6123 |
T20867 |
T20865 |
punct |
", ",flattened |
R6124 |
T20868 |
T20865 |
cc |
or,flattened |
R6125 |
T20869 |
T20865 |
conj |
sectioned,flattened |
R6126 |
T20870 |
T20869 |
prep |
along,sectioned |
R6127 |
T20871 |
T20872 |
det |
the,axis |
R6128 |
T20872 |
T20870 |
pobj |
axis,along |
R6129 |
T20873 |
T20872 |
compound |
z,axis |
R613 |
T2844 |
T2840 |
punct |
", ",misfolded |
R6130 |
T20874 |
T20872 |
punct |
-,axis |
R6131 |
T20875 |
T20865 |
punct |
", ",flattened |
R6132 |
T20876 |
T20877 |
advmod |
then,processed |
R6133 |
T20877 |
T20865 |
dep |
processed,flattened |
R6134 |
T20878 |
T20877 |
advmod |
further,processed |
R6135 |
T20879 |
T20877 |
advcl |
using,processed |
R6136 |
T20880 |
T20881 |
nmod |
BioRad,software |
R6137 |
T20881 |
T20879 |
dobj |
software,using |
R6138 |
T20882 |
T20883 |
nmod |
Laser,Sharp |
R6139 |
T20883 |
T20881 |
nmod |
Sharp,software |
R614 |
T2845 |
T2835 |
compound |
water,pore |
R6140 |
T20884 |
T20883 |
nummod |
2000,Sharp |
R6141 |
T20885 |
T20881 |
cc |
and,software |
R6142 |
T20886 |
T20887 |
compound |
Image,J |
R6143 |
T20887 |
T20888 |
compound |
J,software |
R6144 |
T20888 |
T20881 |
conj |
software,software |
R6145 |
T20889 |
T20890 |
punct |
(,Institutes |
R6146 |
T20890 |
T20888 |
parataxis |
Institutes,software |
R6147 |
T20891 |
T20890 |
dep |
v.,Institutes |
R6148 |
T20892 |
T20891 |
nummod |
1.32,v. |
R6149 |
T20893 |
T20890 |
punct |
;,Institutes |
R615 |
T2846 |
T2847 |
dep |
that,responds |
R6150 |
T20894 |
T20890 |
compound |
National,Institutes |
R6151 |
T20895 |
T20890 |
prep |
of,Institutes |
R6152 |
T20896 |
T20895 |
pobj |
Health,of |
R6153 |
T20897 |
T20890 |
punct |
),Institutes |
R6154 |
T20898 |
T20865 |
punct |
.,flattened |
R6155 |
T20900 |
T20901 |
nsubjpass |
Colocalization,performed |
R6156 |
T20902 |
T20901 |
auxpass |
was,performed |
R6157 |
T20903 |
T20901 |
advcl |
using,performed |
R6158 |
T20904 |
T20905 |
det |
the,coefficient |
R6159 |
T20905 |
T20903 |
dobj |
coefficient,using |
R616 |
T2847 |
T2835 |
relcl |
responds,pore |
R6160 |
T20906 |
T20905 |
amod |
overlay,coefficient |
R6161 |
T20907 |
T20905 |
prep |
of,coefficient |
R6162 |
T20908 |
T20909 |
compound |
Image,J |
R6163 |
T20909 |
T20910 |
compound |
J,software |
R6164 |
T20910 |
T20907 |
pobj |
software,of |
R6165 |
T20911 |
T20901 |
punct |
.,performed |
R617 |
T2848 |
T2847 |
advmod |
abnormally,responds |
R618 |
T2849 |
T2847 |
prep |
to,responds |
R619 |
T2850 |
T2851 |
det |
an,increase |
R620 |
T2851 |
T2849 |
pobj |
increase,to |
R621 |
T2852 |
T2851 |
prep |
in,increase |
R622 |
T2853 |
T2852 |
pobj |
cAMP,in |
R623 |
T2854 |
T2855 |
punct |
[,11 |
R624 |
T2855 |
T2829 |
parataxis |
11,thought |
R625 |
T2856 |
T2855 |
nummod |
6,11 |
R626 |
T2857 |
T2855 |
punct |
",",11 |
R627 |
T2858 |
T2855 |
punct |
],11 |
R628 |
T2859 |
T2829 |
punct |
.,thought |
R629 |
T2861 |
T2862 |
advmod |
Furthermore,described |
R630 |
T2863 |
T2862 |
punct |
", ",described |
R631 |
T2864 |
T2865 |
amod |
dominant,mutations |
R632 |
T2865 |
T2862 |
nsubjpass |
mutations,described |
R633 |
T2866 |
T2862 |
aux |
have,described |
R634 |
T2867 |
T2862 |
auxpass |
been,described |
R635 |
T2868 |
T2862 |
cc |
and,described |
R636 |
T2869 |
T2862 |
conj |
found,described |
R637 |
T2870 |
T2871 |
aux |
to,misroute |
R638 |
T2871 |
T2869 |
xcomp |
misroute,found |
R639 |
T2872 |
T2873 |
preconj |
both,mutant |
R640 |
T2873 |
T2871 |
dobj |
mutant,misroute |
R641 |
T2874 |
T2873 |
det |
the,mutant |
R642 |
T2875 |
T2873 |
cc |
and,mutant |
R643 |
T2876 |
T2877 |
det |
the,type |
R644 |
T2877 |
T2880 |
compound |
type,protein |
R645 |
T2878 |
T2877 |
amod |
wild,type |
R646 |
T2879 |
T2877 |
punct |
-,type |
R647 |
T2880 |
T2873 |
conj |
protein,mutant |
R648 |
T2881 |
T2871 |
prep |
to,misroute |
R649 |
T2882 |
T2883 |
det |
the,membrane |
R650 |
T2883 |
T2881 |
pobj |
membrane,to |
R651 |
T2884 |
T2883 |
amod |
basolateral,membrane |
R652 |
T2885 |
T2886 |
punct |
[,12 |
R653 |
T2886 |
T2869 |
parataxis |
12,found |
R654 |
T2887 |
T2886 |
nummod |
6,12 |
R655 |
T2888 |
T2886 |
punct |
",",12 |
R656 |
T2889 |
T2886 |
punct |
],12 |
R657 |
T2890 |
T2862 |
punct |
.,described |
R658 |
T2892 |
T2893 |
amod |
Several,models |
R659 |
T2893 |
T2895 |
nsubjpass |
models,generated |
R660 |
T2894 |
T2893 |
compound |
mouse,models |
R661 |
T2896 |
T2893 |
prep |
of,models |
R662 |
T2897 |
T2898 |
compound |
diabetes,insipidus |
R663 |
T2898 |
T2896 |
pobj |
insipidus,of |
R664 |
T2899 |
T2895 |
aux |
have,generated |
R665 |
T2900 |
T2895 |
auxpass |
been,generated |
R666 |
T2901 |
T2902 |
punct |
[,13 |
R667 |
T2902 |
T2895 |
parataxis |
13,generated |
R668 |
T2903 |
T2904 |
punct |
–,17 |
R669 |
T2904 |
T2902 |
prep |
17,13 |
R670 |
T2905 |
T2902 |
punct |
],13 |
R671 |
T2906 |
T2895 |
punct |
.,generated |
R672 |
T2908 |
T2909 |
prep |
In,generated |
R673 |
T2910 |
T2911 |
det |
an,attempt |
R674 |
T2911 |
T2908 |
pobj |
attempt,In |
R675 |
T2912 |
T2913 |
aux |
to,recapitulate |
R676 |
T2913 |
T2911 |
acl |
recapitulate,attempt |
R677 |
T2914 |
T2915 |
amod |
human,NDI |
R678 |
T2915 |
T2913 |
dobj |
NDI,recapitulate |
R679 |
T2916 |
T2909 |
punct |
", ",generated |
R680 |
T2917 |
T2909 |
nsubjpass |
mice,generated |
R681 |
T2918 |
T2909 |
aux |
have,generated |
R682 |
T2919 |
T2909 |
auxpass |
been,generated |
R683 |
T2920 |
T2909 |
prep |
with,generated |
R684 |
T2921 |
T2920 |
pobj |
mutations,with |
R685 |
T2922 |
T2921 |
prep |
in,mutations |
R686 |
T2923 |
T2922 |
pobj |
Aqp2,in |
R687 |
T2924 |
T2923 |
cc |
and,Aqp2 |
R688 |
T2925 |
T2923 |
conj |
Avpr2,Aqp2 |
R689 |
T2926 |
T2927 |
punct |
[,18 |
R690 |
T2927 |
T2909 |
parataxis |
18,generated |
R691 |
T2928 |
T2927 |
nummod |
15,18 |
R692 |
T2929 |
T2927 |
punct |
",",18 |
R693 |
T2930 |
T2927 |
punct |
],18 |
R694 |
T2931 |
T2909 |
punct |
.,generated |
R695 |
T2933 |
T2934 |
nsubj |
Yang,created |
R696 |
T2935 |
T2933 |
cc |
and,Yang |
R697 |
T2936 |
T2933 |
conj |
colleagues,Yang |
R698 |
T2937 |
T2938 |
det |
a,mouse |
R699 |
T2938 |
T2934 |
dobj |
mouse,created |
R700 |
T2939 |
T2938 |
prep |
with,mouse |
R701 |
T2940 |
T2941 |
det |
a,mutation |
R702 |
T2941 |
T2939 |
pobj |
mutation,with |
R703 |
T2942 |
T2941 |
nmod |
T126M,mutation |
R704 |
T2943 |
T2941 |
amod |
knock,mutation |
R705 |
T2944 |
T2943 |
punct |
-,knock |
R706 |
T2945 |
T2943 |
prt |
in,knock |
R707 |
T2946 |
T2941 |
prep |
in,mutation |
R708 |
T2947 |
T2948 |
det |
the,gene |
R709 |
T2948 |
T2946 |
pobj |
gene,in |
R710 |
T2949 |
T2948 |
compound |
Aqp2,gene |
R711 |
T2950 |
T2934 |
punct |
.,created |
R712 |
T2952 |
T2953 |
advmod |
Unexpectedly,died |
R713 |
T2954 |
T2953 |
punct |
", ",died |
R714 |
T2955 |
T2956 |
amod |
homozygous,mice |
R715 |
T2956 |
T2953 |
nsubj |
mice,died |
R716 |
T2957 |
T2956 |
compound |
mutant,mice |
R717 |
T2958 |
T2953 |
prep |
within,died |
R718 |
T2959 |
T2960 |
nummod |
6,d |
R719 |
T2960 |
T2958 |
pobj |
d,within |
R720 |
T2961 |
T2960 |
prep |
after,d |
R721 |
T2962 |
T2961 |
pobj |
birth,after |
R722 |
T2963 |
T2953 |
punct |
.,died |
R723 |
T2965 |
T2966 |
advmod |
Interestingly,die |
R724 |
T2967 |
T2966 |
punct |
", ",die |
R725 |
T2968 |
T2969 |
npadvmod |
AVPR2,deficient |
R726 |
T2969 |
T2971 |
amod |
deficient,pups |
R727 |
T2970 |
T2969 |
punct |
-,deficient |
R728 |
T2971 |
T2966 |
nsubj |
pups,die |
R729 |
T2972 |
T2971 |
amod |
male,pups |
R730 |
T2973 |
T2966 |
advmod |
also,die |
R731 |
T2974 |
T2966 |
prep |
within,die |
R732 |
T2975 |
T2976 |
det |
the,week |
R733 |
T2976 |
T2974 |
pobj |
week,within |
R734 |
T2977 |
T2976 |
amod |
first,week |
R735 |
T2978 |
T2976 |
prep |
after,week |
R736 |
T2979 |
T2978 |
pobj |
birth,after |
R737 |
T2980 |
T2966 |
punct |
.,die |
R738 |
T2982 |
T2983 |
advmod |
Together,suggest |
R739 |
T2984 |
T2985 |
det |
these,models |
R740 |
T2985 |
T2983 |
nsubj |
models,suggest |
R741 |
T2986 |
T2987 |
mark |
that,be |
R742 |
T2987 |
T2983 |
ccomp |
be,suggest |
R743 |
T2988 |
T2989 |
det |
the,mouse |
R744 |
T2989 |
T2987 |
nsubj |
mouse,be |
R745 |
T3096 |
T3095 |
punct |
-,duct |
R746 |
T2990 |
T2987 |
aux |
may,be |
R747 |
T3097 |
T3084 |
punct |
", ",adopts |
R748 |
T2991 |
T2992 |
det |
a,organism |
R749 |
T2992 |
T2987 |
attr |
organism,be |
R750 |
T3098 |
T3084 |
cc |
and,adopts |
R751 |
T2993 |
T2994 |
advmod |
highly,sensitive |
R752 |
T2994 |
T2992 |
amod |
sensitive,organism |
R753 |
T3099 |
T3084 |
conj |
was,adopts |
R754 |
T2995 |
T2987 |
prep |
with,be |
R755 |
T2996 |
T2995 |
pobj |
regard,with |
R756 |
T3100 |
T3099 |
acomp |
resistant,was |
R757 |
T2997 |
T2996 |
prep |
to,regard |
R758 |
T2998 |
T2999 |
compound |
water,homeostasis |
R759 |
T2999 |
T2997 |
pobj |
homeostasis,to |
R760 |
T3000 |
T2987 |
punct |
", ",be |
R761 |
T3001 |
T2987 |
cc |
and,be |
R762 |
T3101 |
T3100 |
prep |
to,resistant |
R763 |
T3002 |
T2987 |
conj |
is,be |
R764 |
T3003 |
T3002 |
acomp |
unable,is |
R765 |
T3004 |
T3005 |
aux |
to,survive |
R766 |
T3102 |
T3101 |
pobj |
translocation,to |
R767 |
T3005 |
T3003 |
xcomp |
survive,unable |
R768 |
T3006 |
T3005 |
prep |
with,survive |
R769 |
T3007 |
T3006 |
pobj |
polyuria,with |
R770 |
T3103 |
T3102 |
acl |
induced,translocation |
R771 |
T3008 |
T2983 |
punct |
.,suggest |
R772 |
T3010 |
T3011 |
prep |
In,identified |
R773 |
T3104 |
T3103 |
agent |
by,induced |
R774 |
T3012 |
T3013 |
det |
a,screen |
R775 |
T3105 |
T3104 |
pobj |
desmopressin,by |
R776 |
T3013 |
T3010 |
pobj |
screen,In |
R777 |
T3014 |
T3015 |
advmod |
forward,genetic |
R778 |
T3015 |
T3013 |
amod |
genetic,screen |
R779 |
T3016 |
T3011 |
punct |
", ",identified |
R780 |
T3106 |
T3105 |
punct |
", ",desmopressin |
R781 |
T3017 |
T3018 |
det |
a,mouse |
R782 |
T3018 |
T3011 |
nsubjpass |
mouse,identified |
R783 |
T3107 |
T3108 |
det |
an,agonist |
R784 |
T3019 |
T3018 |
prep |
with,mouse |
R785 |
T3020 |
T3021 |
det |
an,mutation |
R786 |
T3021 |
T3019 |
pobj |
mutation,with |
R787 |
T3108 |
T3105 |
appos |
agonist,desmopressin |
R788 |
T3109 |
T3108 |
prep |
of,agonist |
R789 |
T3022 |
T3021 |
compound |
Aqp2,mutation |
R790 |
T3023 |
T3011 |
auxpass |
was,identified |
R791 |
T3024 |
T3011 |
punct |
.,identified |
R792 |
T3026 |
T3027 |
det |
The,purpose |
R793 |
T3110 |
T3109 |
pobj |
AVP,of |
R794 |
T3027 |
T3028 |
nsubj |
purpose,was |
R795 |
T3029 |
T3027 |
prep |
of,purpose |
R796 |
T3030 |
T3031 |
det |
this,study |
R797 |
T3111 |
T3082 |
punct |
.,concluded |
R798 |
T3031 |
T3029 |
pobj |
study,of |
R799 |
T3032 |
T3033 |
aux |
to,characterize |
R800 |
T3033 |
T3028 |
xcomp |
characterize,was |
R801 |
T3113 |
T3114 |
advmod |
In,vitro |
R802 |
T3034 |
T3035 |
det |
this,model |
R803 |
T3035 |
T3033 |
dobj |
model,characterize |
R804 |
T3036 |
T3035 |
amod |
murine,model |
R805 |
T3037 |
T3035 |
prep |
of,model |
R806 |
T3114 |
T3115 |
amod |
vitro,studies |
R807 |
T3038 |
T3039 |
amod |
recessive,DI |
R808 |
T3039 |
T3037 |
pobj |
DI,of |
R809 |
T3115 |
T3116 |
nsubj |
studies,demonstrated |
R810 |
T3040 |
T3039 |
amod |
nephrogenic,DI |
R811 |
T3041 |
T3028 |
punct |
.,was |
R812 |
T3043 |
T3044 |
nsubj |
We,report |
R813 |
T3045 |
T3044 |
advmod |
now,report |
R814 |
T3117 |
T3115 |
acl |
using,studies |
R815 |
T3046 |
T3047 |
det |
a,mutation |
R816 |
T3047 |
T3044 |
dobj |
mutation,report |
R817 |
T3048 |
T3047 |
amod |
novel,mutation |
R818 |
T3049 |
T3047 |
compound |
F204V,mutation |
R819 |
T3118 |
T3119 |
det |
the,line |
R820 |
T3050 |
T3047 |
prep |
in,mutation |
R821 |
T3051 |
T3052 |
det |
the,gene |
R822 |
T3052 |
T3050 |
pobj |
gene,in |
R823 |
T3119 |
T3117 |
dobj |
line,using |
R824 |
T3053 |
T3052 |
compound |
Aqp2,gene |
R825 |
T3054 |
T3044 |
punct |
.,report |
R826 |
T3120 |
T3121 |
nmod |
Madin,Darby |
R827 |
T3056 |
T3057 |
det |
This,allele |
R828 |
T3057 |
T3058 |
nsubjpass |
allele,found |
R829 |
T3121 |
T3123 |
nmod |
Darby,kidney |
R830 |
T3059 |
T3057 |
prep |
of,allele |
R831 |
T3060 |
T3059 |
pobj |
Aqp2,of |
R832 |
T3122 |
T3121 |
punct |
-,Darby |
R833 |
T3061 |
T3058 |
auxpass |
was,found |
R834 |
T3062 |
T3063 |
aux |
to,cause |
R835 |
T3063 |
T3058 |
xcomp |
cause,found |
R836 |
T3123 |
T3119 |
nmod |
kidney,line |
R837 |
T3064 |
T3065 |
det |
the,model |
R838 |
T3065 |
T3068 |
nsubj |
model,survive |
R839 |
T3124 |
T3123 |
amod |
canine,kidney |
R840 |
T3066 |
T3065 |
amod |
first,model |
R841 |
T3067 |
T3065 |
compound |
mouse,model |
R842 |
T3125 |
T3123 |
punct |
(,kidney |
R843 |
T3068 |
T3063 |
ccomp |
survive,cause |
R844 |
T3069 |
T3065 |
prep |
of,model |
R845 |
T3070 |
T3069 |
pobj |
NDI,of |
R846 |
T3126 |
T3123 |
appos |
MDCK,kidney |
R847 |
T3071 |
T3068 |
aux |
to,survive |
R848 |
T3072 |
T3068 |
prep |
past,survive |
R849 |
T3073 |
T3074 |
det |
the,week |
R850 |
T3127 |
T3119 |
punct |
),line |
R851 |
T3074 |
T3072 |
pobj |
week,past |
R852 |
T3075 |
T3074 |
amod |
first,week |
R853 |
T3076 |
T3074 |
prep |
of,week |
R854 |
T3128 |
T3119 |
compound |
cell,line |
R855 |
T3129 |
T3130 |
det |
an,pattern |
R856 |
T3130 |
T3116 |
dobj |
pattern,demonstrated |
R857 |
T3077 |
T3076 |
pobj |
life,of |
R858 |
T3078 |
T3058 |
punct |
.,found |
R859 |
T3131 |
T3130 |
amod |
endoplasmic,pattern |
R860 |
T3080 |
T3081 |
amod |
Molecular,analyses |
R861 |
T3132 |
T3130 |
compound |
reticulum,pattern |
R862 |
T3081 |
T3082 |
nsubj |
analyses,concluded |
R863 |
T3083 |
T3084 |
mark |
that,adopts |
R864 |
T3084 |
T3082 |
ccomp |
adopts,concluded |
R865 |
T3085 |
T3086 |
compound |
mutant,AQP2 |
R866 |
T3086 |
T3084 |
nsubj |
AQP2,adopts |
R867 |
T3133 |
T3130 |
prep |
for,pattern |
R868 |
T3087 |
T3088 |
det |
a,localization |
R869 |
T3088 |
T3084 |
dobj |
localization,adopts |
R870 |
T3089 |
T3088 |
amod |
different,localization |
R871 |
T3134 |
T3135 |
det |
the,protein |
R872 |
T3090 |
T3088 |
amod |
subcellular,localization |
R873 |
T3091 |
T3084 |
prep |
in,adopts |
R874 |
T3092 |
T3093 |
amod |
renal,cells |
R875 |
T3135 |
T3133 |
pobj |
protein,for |
R876 |
T3093 |
T3091 |
pobj |
cells,in |
R877 |
T3094 |
T3095 |
amod |
collecting,duct |
R878 |
T3136 |
T3135 |
compound |
mutant,protein |
R879 |
T3095 |
T3093 |
compound |
duct,cells |
R880 |
T3137 |
T3130 |
punct |
", ",pattern |
R881 |
T3138 |
T3130 |
cc |
and,pattern |
R882 |
T3139 |
T3140 |
amod |
apparent,resistance |
R883 |
T3140 |
T3130 |
conj |
resistance,pattern |
R884 |
T3141 |
T3140 |
prep |
to,resistance |
R885 |
T3142 |
T3141 |
pobj |
translocation,to |
R886 |
T3143 |
T3116 |
punct |
.,demonstrated |
R887 |
T3145 |
T3146 |
det |
These,data |
R888 |
T3146 |
T3147 |
nsubj |
data,prove |
R889 |
T3148 |
T3147 |
advmod |
conclusively,prove |
R890 |
T3149 |
T3150 |
mark |
that,is |
R891 |
T3150 |
T3147 |
ccomp |
is,prove |
R892 |
T3151 |
T3152 |
amod |
autosomal,NDI |
R893 |
T3152 |
T3150 |
nsubj |
NDI,is |
R894 |
T3153 |
T3152 |
amod |
recessive,NDI |
R895 |
T3154 |
T3155 |
det |
a,consequence |
R896 |
T3155 |
T3150 |
attr |
consequence,is |
R897 |
T3156 |
T3155 |
prep |
of,consequence |
R898 |
T3157 |
T3158 |
amod |
improper,routing |
R899 |
T3158 |
T3156 |
pobj |
routing,of |
R900 |
T3159 |
T3158 |
compound |
AQP2,routing |
R901 |
T3160 |
T3158 |
prep |
in,routing |
R902 |
T3161 |
T3162 |
det |
the,mammal |
R903 |
T3162 |
T3160 |
pobj |
mammal,in |
R904 |
T3163 |
T3162 |
amod |
intact,mammal |
R905 |
T3164 |
T3147 |
punct |
.,prove |
R916 |
T8980 |
T8981 |
punct |
[,20 |
R917 |
T8951 |
T8952 |
prep |
In,found |
R918 |
T8953 |
T8954 |
det |
a,screen |
R919 |
T8954 |
T8951 |
pobj |
screen,In |
R920 |
T8955 |
T8956 |
amod |
forward,genetic |
R921 |
T8956 |
T8954 |
amod |
genetic,screen |
R922 |
T8957 |
T8958 |
dep |
that,used |
R923 |
T8958 |
T8954 |
relcl |
used,screen |
R924 |
T8959 |
T8958 |
dobj |
ethylnitrosourea,used |
R925 |
T8960 |
T8959 |
punct |
(,ethylnitrosourea |
R926 |
T8961 |
T8959 |
appos |
ENU,ethylnitrosourea |
R927 |
T8981 |
T8958 |
parataxis |
20,used |
R928 |
T8962 |
T8958 |
punct |
),used |
R929 |
T8963 |
T8964 |
aux |
to,induce |
R930 |
T8964 |
T8958 |
advcl |
induce,used |
R931 |
T8982 |
T8981 |
nummod |
19,20 |
R932 |
T8965 |
T8964 |
dobj |
mutations,induce |
R933 |
T8966 |
T8964 |
prep |
in,induce |
R934 |
T8967 |
T8968 |
det |
a,animal |
R935 |
T8983 |
T8981 |
punct |
",",20 |
R936 |
T8968 |
T8966 |
pobj |
animal,in |
R937 |
T8969 |
T8968 |
compound |
founder,animal |
R938 |
T8970 |
T8971 |
poss |
whose,offspring |
R939 |
T8984 |
T8981 |
punct |
],20 |
R940 |
T8971 |
T8972 |
dep |
offspring,screened |
R941 |
T8972 |
T8968 |
relcl |
screened,animal |
R942 |
T8973 |
T8972 |
auxpass |
were,screened |
R943 |
T8985 |
T8952 |
punct |
", ",found |
R944 |
T8974 |
T8972 |
advmod |
then,screened |
R945 |
T8986 |
T8952 |
nsubj |
we,found |
R946 |
T8975 |
T8972 |
prep |
for,screened |
R947 |
T8976 |
T8977 |
amod |
abnormal,metabolism |
R948 |
T8987 |
T8988 |
det |
a,family |
R949 |
T8977 |
T8975 |
pobj |
metabolism,for |
R950 |
T8978 |
T8979 |
amod |
whole,body |
R951 |
T8988 |
T8952 |
dobj |
family,found |
R952 |
T8979 |
T8977 |
compound |
body,metabolism |
R953 |
T8989 |
T8988 |
prep |
of,family |
R954 |
T8990 |
T8989 |
pobj |
mice,of |
R955 |
T8991 |
T8992 |
dep |
that,urinated |
R956 |
T9086 |
T9084 |
pobj |
substitution,to |
R957 |
T9087 |
T9086 |
nmod |
valine,substitution |
R958 |
T9088 |
T9087 |
prep |
for,valine |
R959 |
T9089 |
T9088 |
pobj |
phenylalanine,for |
R960 |
T9090 |
T9086 |
prep |
at,substitution |
R961 |
T8992 |
T8988 |
relcl |
urinated,family |
R962 |
T9091 |
T9092 |
compound |
amino,acid |
R963 |
T9092 |
T9090 |
pobj |
acid,at |
R964 |
T9093 |
T9092 |
nummod |
204,acid |
R965 |
T9094 |
T9092 |
prep |
of,acid |
R966 |
T8993 |
T8992 |
cc |
and,urinated |
R967 |
T9095 |
T9096 |
det |
the,protein |
R968 |
T9096 |
T9094 |
pobj |
protein,of |
R969 |
T9097 |
T9092 |
punct |
(,acid |
R970 |
T8994 |
T8992 |
conj |
drank,urinated |
R971 |
T9098 |
T9092 |
appos |
F204V,acid |
R972 |
T9099 |
T9092 |
punct |
),acid |
R973 |
T9100 |
T9056 |
punct |
.,identified |
R974 |
T8995 |
T8994 |
advmod |
excessively,drank |
R975 |
T8996 |
T8952 |
punct |
.,found |
R976 |
T9102 |
T9103 |
nsubj |
AQP2,is |
R977 |
T9104 |
T9105 |
det |
a,channel |
R978 |
T8998 |
T8999 |
nmod |
Serum,analysis |
R979 |
T9105 |
T9103 |
attr |
channel,is |
R980 |
T9106 |
T9107 |
nummod |
six,transmembrane |
R981 |
T9107 |
T9105 |
compound |
transmembrane,channel |
R982 |
T9108 |
T9107 |
punct |
-,transmembrane |
R983 |
T8999 |
T9002 |
nsubj |
analysis,showed |
R984 |
T9109 |
T9105 |
compound |
water,channel |
R985 |
T9110 |
T9103 |
punct |
", ",is |
R986 |
T9000 |
T8998 |
cc |
and,Serum |
R987 |
T9111 |
T9103 |
cc |
and,is |
R988 |
T9112 |
T9113 |
nsubj |
F204,lies |
R989 |
T9113 |
T9103 |
conj |
lies,is |
R990 |
T9001 |
T8998 |
conj |
urine,Serum |
R991 |
T9114 |
T9113 |
prep |
near,lies |
R992 |
T9115 |
T9116 |
det |
the,face |
R993 |
T9003 |
T9004 |
mark |
that,were |
R994 |
T9116 |
T9114 |
pobj |
face,near |
R995 |
T9117 |
T9116 |
amod |
extracellular,face |
R996 |
T9118 |
T9116 |
prep |
of,face |
R997 |
T9119 |
T9120 |
det |
the,domain |
R998 |
T9120 |
T9118 |
pobj |
domain,of |
R999 |
T9004 |
T9002 |
ccomp |
were,showed |