CORD-19-Sentences  

CORD-19:4aa092956fea94f9487d129b4a05a8704b73d0fc JSONTXT 8 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
TextSentencer_T1 0-120 Sentence denotes HLA-DMB restricts human T-cell leukemia virus type-1 (HTLV-1) protein expression via regulation of ATG7 acetylation OPEN
TextSentencer_T1 0-120 Sentence denotes HLA-DMB restricts human T-cell leukemia virus type-1 (HTLV-1) protein expression via regulation of ATG7 acetylation OPEN
TextSentencer_T2 122-130 Sentence denotes Abstract
TextSentencer_T2 122-130 Sentence denotes Abstract
TextSentencer_T3 131-189 Sentence denotes The roles of autophagy in viral infection are complicated.
TextSentencer_T3 131-189 Sentence denotes The roles of autophagy in viral infection are complicated.
TextSentencer_T4 190-404 Sentence denotes While autophagy has been shown to function in host antiviral defense by eliminating intracellular viruses and regulating adaptive immunity, several viruses have evolved molecular mechanisms to get benefits from it.
TextSentencer_T4 190-404 Sentence denotes While autophagy has been shown to function in host antiviral defense by eliminating intracellular viruses and regulating adaptive immunity, several viruses have evolved molecular mechanisms to get benefits from it.
TextSentencer_T5 405-555 Sentence denotes The deltaretrovirus human T-cell leukemia virus type-1 (HTLV-1) has been reported to profit its replication from enhancing autophagosome accumulation.
TextSentencer_T5 405-555 Sentence denotes The deltaretrovirus human T-cell leukemia virus type-1 (HTLV-1) has been reported to profit its replication from enhancing autophagosome accumulation.
TextSentencer_T6 556-851 Sentence denotes Here, we reported that HLA-DMB (generally referred to here as DMB), the beta chain of the non-classical MHC-II protein HLA-DM, had strong expression in HTLV-1transformed T-cell lines and could be induced in Hela, PMA-differentiated THP1 (PMA-THP1) or primary human monocytes by HTLV-1 infection.
TextSentencer_T6 556-851 Sentence denotes Here, we reported that HLA-DMB (generally referred to here as DMB), the beta chain of the non-classical MHC-II protein HLA-DM, had strong expression in HTLV-1transformed T-cell lines and could be induced in Hela, PMA-differentiated THP1 (PMA-THP1) or primary human monocytes by HTLV-1 infection.
TextSentencer_T7 852-1027 Sentence denotes Immunoblot and real-time PCR assays demonstrated that overexpression of DMB decreased HTLV-1 protein expression while the knockdown of DMB increased HTLV-1 protein expression.
TextSentencer_T7 852-1027 Sentence denotes Immunoblot and real-time PCR assays demonstrated that overexpression of DMB decreased HTLV-1 protein expression while the knockdown of DMB increased HTLV-1 protein expression.
TextSentencer_T8 1028-1215 Sentence denotes Immunoblot and confocal microscopy assays indicated that overexpression of DMB decreased HTLV-1 induced autophagosome accumulation while the knockdown of DMB yielded the opposite effects.
TextSentencer_T8 1028-1215 Sentence denotes Immunoblot and confocal microscopy assays indicated that overexpression of DMB decreased HTLV-1 induced autophagosome accumulation while the knockdown of DMB yielded the opposite effects.
TextSentencer_T9 1216-1373 Sentence denotes Coimmunoprecipitation and immunoprecipitation experiments suggested DMB interacted with autophagy-related gene (ATG) 7 and increased the acetylation of ATG7.
TextSentencer_T9 1216-1373 Sentence denotes Coimmunoprecipitation and immunoprecipitation experiments suggested DMB interacted with autophagy-related gene (ATG) 7 and increased the acetylation of ATG7.
TextSentencer_T10 1374-1604 Sentence denotes Taken together, these results suggested DMB modulated HTLV-1 protein expression through regulation of autophagosome accumulation and our findings suggested a new mechanism by which the host cells defended against HTLV-1 infection.
TextSentencer_T10 1374-1604 Sentence denotes Taken together, these results suggested DMB modulated HTLV-1 protein expression through regulation of autophagosome accumulation and our findings suggested a new mechanism by which the host cells defended against HTLV-1 infection.
TextSentencer_T11 1605-1777 Sentence denotes Human T-cell leukemia virus type-1 (HTLV-1), the first retrovirus discovered to be linked with human diseases 1,2 , infects approximately 10~20 million people worldwide 3 .
TextSentencer_T11 1605-1777 Sentence denotes Human T-cell leukemia virus type-1 (HTLV-1), the first retrovirus discovered to be linked with human diseases 1,2 , infects approximately 10~20 million people worldwide 3 .
TextSentencer_T12 1778-2061 Sentence denotes While most infected individuals are asymptomatic carriers (ACs) of the virus, 3~5% of infected individuals develop a malignancy of CD4+ T cells known as Adult T cell leukemia (ATL) several decades after infection and less than 50% of the ATL patients survive more than one year 4,5 .
TextSentencer_T12 1778-2061 Sentence denotes While most infected individuals are asymptomatic carriers (ACs) of the virus, 3~5% of infected individuals develop a malignancy of CD4+ T cells known as Adult T cell leukemia (ATL) several decades after infection and less than 50% of the ATL patients survive more than one year 4,5 .
TextSentencer_T13 2062-2249 Sentence denotes HTLV-1 also causes a severe neurological disorder designated HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and other inflammatory diseases such as HTLV-1 uveitis 6 .
TextSentencer_T13 2062-2249 Sentence denotes HTLV-1 also causes a severe neurological disorder designated HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and other inflammatory diseases such as HTLV-1 uveitis 6 .
TextSentencer_T14 2250-2482 Sentence denotes Autophagy, characterized by the formation of double-membrane vesicles called autophagosomes and subsequent lysosome-based degradation of damaged or excess cellular components, plays an important role in maintaining homeostasis 7,8 .
TextSentencer_T14 2250-2482 Sentence denotes Autophagy, characterized by the formation of double-membrane vesicles called autophagosomes and subsequent lysosome-based degradation of damaged or excess cellular components, plays an important role in maintaining homeostasis 7,8 .
TextSentencer_T15 2483-2683 Sentence denotes Autophagy is initiated at the isolation membrane, usually from endoplasmic reticulum (ER) membranes, and autophagosome formation is dependent on the so-called autophagy-related gene (ATG) products 9 .
TextSentencer_T15 2483-2683 Sentence denotes Autophagy is initiated at the isolation membrane, usually from endoplasmic reticulum (ER) membranes, and autophagosome formation is dependent on the so-called autophagy-related gene (ATG) products 9 .
TextSentencer_T16 2684-2798 Sentence denotes Till now, 40 ATG proteins have been identified in yeast and many mammalian homologs for these have been found 10 .
TextSentencer_T16 2684-2798 Sentence denotes Till now, 40 ATG proteins have been identified in yeast and many mammalian homologs for these have been found 10 .
TextSentencer_T17 2799-2893 Sentence denotes However, only half of these are essential for formation of canonical autophagosomes, including
TextSentencer_T17 2799-2893 Sentence denotes However, only half of these are essential for formation of canonical autophagosomes, including
TextSentencer_T18 2895-3065 Sentence denotes antigenic-peptide complexes 29 , which are expressed constitutively in B cells and could be induced by some stimuli in other cell types such as monocytes and T cells 30 .
TextSentencer_T18 2895-3065 Sentence denotes antigenic-peptide complexes 29 , which are expressed constitutively in B cells and could be induced by some stimuli in other cell types such as monocytes and T cells 30 .
TextSentencer_T19 3066-3123 Sentence denotes All the above cell types could be infected by HTLV-1 31 .
TextSentencer_T19 3066-3123 Sentence denotes All the above cell types could be infected by HTLV-1 31 .
TextSentencer_T20 3124-3219 Sentence denotes Thus, it seemed reasonable for us to explore the relationship between DMΒ and HTLV-1 infection.
TextSentencer_T20 3124-3219 Sentence denotes Thus, it seemed reasonable for us to explore the relationship between DMΒ and HTLV-1 infection.
TextSentencer_T21 3220-3278 Sentence denotes We first examined DMΒ expression in HTLV-1 infected cells.
TextSentencer_T21 3220-3278 Sentence denotes We first examined DMΒ expression in HTLV-1 infected cells.
TextSentencer_T22 3279-3410 Sentence denotes We compared the expression of DMΒ in non-infected Jurkat T-cell line as well as in HTLV-1-transformed T-cell lines (C8166 and MT2).
TextSentencer_T22 3279-3410 Sentence denotes We compared the expression of DMΒ in non-infected Jurkat T-cell line as well as in HTLV-1-transformed T-cell lines (C8166 and MT2).
TextSentencer_T23 3411-3596 Sentence denotes Immunoblot assays indicated that the HTLV-1-positive MT2 and C8166 cells showed strong expression of endogenous DMΒ protein, whereas the HTLV-1-negative Jurkat cells did not (Fig. 1A) .
TextSentencer_T23 3411-3596 Sentence denotes Immunoblot assays indicated that the HTLV-1-positive MT2 and C8166 cells showed strong expression of endogenous DMΒ protein, whereas the HTLV-1-negative Jurkat cells did not (Fig. 1A) .
TextSentencer_T24 3597-3733 Sentence denotes We next examined DMΒ expression in HTLV-1 infected Hela and PMA-differentiated THP1 (a human macrophage-like cell line, PMA-THP1) cells.
TextSentencer_T24 3597-3733 Sentence denotes We next examined DMΒ expression in HTLV-1 infected Hela and PMA-differentiated THP1 (a human macrophage-like cell line, PMA-THP1) cells.
TextSentencer_T25 3734-3893 Sentence denotes Hela and PMA-THP1 cells were co-cultured with MT2 cells and immunoblot assays demonstrated that DMΒ expression was induced in MT2-co-cultured cells (Fig. 1B) .
TextSentencer_T25 3734-3893 Sentence denotes Hela and PMA-THP1 cells were co-cultured with MT2 cells and immunoblot assays demonstrated that DMΒ expression was induced in MT2-co-cultured cells (Fig. 1B) .
TextSentencer_T26 3894-4004 Sentence denotes We tried to investigate the molecular mechanisms by which DMB expression was induced in HTLV-1 infected cells.
TextSentencer_T26 3894-4004 Sentence denotes We tried to investigate the molecular mechanisms by which DMB expression was induced in HTLV-1 infected cells.
TextSentencer_T27 4005-4185 Sentence denotes Because the reverse transcription intermediates (RTIs) of retroviruses could be recognized by DNA sensors, we speculated that DMB might be induced by cytosolic DNA sensor pathways.
TextSentencer_T27 4005-4185 Sentence denotes Because the reverse transcription intermediates (RTIs) of retroviruses could be recognized by DNA sensors, we speculated that DMB might be induced by cytosolic DNA sensor pathways.
TextSentencer_T28 4186-4343 Sentence denotes It has been clarified that HTLV-1 RTIs interact with STING and HTLV-1 infection triggers a robust anti-viral innate immune response in primary monocytes 32 .
TextSentencer_T28 4186-4343 Sentence denotes It has been clarified that HTLV-1 RTIs interact with STING and HTLV-1 infection triggers a robust anti-viral innate immune response in primary monocytes 32 .
TextSentencer_T29 4344-4576 Sentence denotes Although the exact roles of cGAS and IFI16 in HTLV-1 infection were unclear, it is known that IFI16 and cGAS could interact with RTIs generated by some other retroviruses and recruit STING for downstream signal transduction 33, 34 .
TextSentencer_T29 4344-4576 Sentence denotes Although the exact roles of cGAS and IFI16 in HTLV-1 infection were unclear, it is known that IFI16 and cGAS could interact with RTIs generated by some other retroviruses and recruit STING for downstream signal transduction 33, 34 .
TextSentencer_T30 4577-4679 Sentence denotes So, we first investigated the roles of cGAS, IFI16 and STING in DMB induction during HTLV-1 infection.
TextSentencer_T30 4577-4679 Sentence denotes So, we first investigated the roles of cGAS, IFI16 and STING in DMB induction during HTLV-1 infection.
TextSentencer_T31 4680-4914 Sentence denotes Interestingly, after cGAS, IFI16 or STING knockdown, the DMB expression was decreased markedly in Hela cells after HTLV-1 co-culture (Fig. 1C) , suggesting that the DMB induction by HTLV-1 infection dependent on cytosolic DNA sensors.
TextSentencer_T31 4680-4914 Sentence denotes Interestingly, after cGAS, IFI16 or STING knockdown, the DMB expression was decreased markedly in Hela cells after HTLV-1 co-culture (Fig. 1C) , suggesting that the DMB induction by HTLV-1 infection dependent on cytosolic DNA sensors.
TextSentencer_T32 4915-5002 Sentence denotes Then we tried to figure out the downstream signaling pathways involved in this process.
TextSentencer_T32 4915-5002 Sentence denotes Then we tried to figure out the downstream signaling pathways involved in this process.
TextSentencer_T33 5003-5302 Sentence denotes We treated Hela cells with Fludarabine (for STAT1 inhibition), Nifuroxazide (for STAT1/3/5 inhibition), BAY11-7082 (for NF-κB inhibition), SB203580 (for p38 MAPK inhibition), SP600125 (for JNK1/2/3 inhibition) or U0126 (for MEK1/2 inhibition) and the DMB expression was examined after MT2 infection.
TextSentencer_T33 5003-5302 Sentence denotes We treated Hela cells with Fludarabine (for STAT1 inhibition), Nifuroxazide (for STAT1/3/5 inhibition), BAY11-7082 (for NF-κB inhibition), SB203580 (for p38 MAPK inhibition), SP600125 (for JNK1/2/3 inhibition) or U0126 (for MEK1/2 inhibition) and the DMB expression was examined after MT2 infection.
TextSentencer_T34 5303-5392 Sentence denotes The results suggested NF-κB was involved in DMB induction by HTLV-1 infection (Fig. 1D) .
TextSentencer_T34 5303-5392 Sentence denotes The results suggested NF-κB was involved in DMB induction by HTLV-1 infection (Fig. 1D) .
TextSentencer_T35 5393-5550 Sentence denotes Taken together, our data suggested that the expression of DMΒ could be induced by HTLV-1 infection and NF-κB was critical to HTLV-1 triggered DMB production.
TextSentencer_T35 5393-5550 Sentence denotes Taken together, our data suggested that the expression of DMΒ could be induced by HTLV-1 infection and NF-κB was critical to HTLV-1 triggered DMB production.
TextSentencer_T36 5551-5602 Sentence denotes DMB expression decreases HTLV-1 protein expression.
TextSentencer_T36 5551-5602 Sentence denotes DMB expression decreases HTLV-1 protein expression.
TextSentencer_T37 5603-5675 Sentence denotes Then we tried to determine the functions of DMΒ during HTLV-1 infection.
TextSentencer_T37 5603-5675 Sentence denotes Then we tried to determine the functions of DMΒ during HTLV-1 infection.
TextSentencer_T38 5676-5801 Sentence denotes Hela cells overexpressing DMB were co-cultured with MT2 cells and the expression levels of HTLV-1 proteins were investigated.
TextSentencer_T38 5676-5801 Sentence denotes Hela cells overexpressing DMB were co-cultured with MT2 cells and the expression levels of HTLV-1 proteins were investigated.
TextSentencer_T39 5802-5954 Sentence denotes Immunoblot assays demonstrated that the exogenous expression of DMB was associated with lower protein levels of HTLV-1 proteins Tax and p19 ( Fig. 2A) .
TextSentencer_T39 5802-5954 Sentence denotes Immunoblot assays demonstrated that the exogenous expression of DMB was associated with lower protein levels of HTLV-1 proteins Tax and p19 ( Fig. 2A) .
TextSentencer_T40 5955-6133 Sentence denotes Consistently, real-time PCR results indicated that the expression levels of HTLV-1 proviral transcripts for Tax, p19, Env and px were decreased in the presence of DMΒ (Fig. 2B) .
TextSentencer_T40 5955-6133 Sentence denotes Consistently, real-time PCR results indicated that the expression levels of HTLV-1 proviral transcripts for Tax, p19, Env and px were decreased in the presence of DMΒ (Fig. 2B) .
TextSentencer_T41 6134-6242 Sentence denotes Taken together, these data suggest that the exogenous expression of DMΒ decreases HTLV-1 protein expression.
TextSentencer_T41 6134-6242 Sentence denotes Taken together, these data suggest that the exogenous expression of DMΒ decreases HTLV-1 protein expression.
TextSentencer_T42 6243-6296 Sentence denotes Knockdown of DMB increases HTLV-1 protein expression.
TextSentencer_T42 6243-6296 Sentence denotes Knockdown of DMB increases HTLV-1 protein expression.
TextSentencer_T43 6297-6398 Sentence denotes Next, we examined whether endogenous DMΒ was involved in the regulation of HTLV-1 protein expression.
TextSentencer_T43 6297-6398 Sentence denotes Next, we examined whether endogenous DMΒ was involved in the regulation of HTLV-1 protein expression.
TextSentencer_T44 6399-6459 Sentence denotes We silenced endogenous DMB expression in MT2 cells by siRNA.
TextSentencer_T44 6399-6459 Sentence denotes We silenced endogenous DMB expression in MT2 cells by siRNA.
TextSentencer_T45 6460-6543 Sentence denotes We purchased three siRNA constructs and determined their effects on DMB expression.
TextSentencer_T45 6460-6543 Sentence denotes We purchased three siRNA constructs and determined their effects on DMB expression.
TextSentencer_T46 6544-6749 Sentence denotes As shown in Fig. 3A , the #3 DMΒ-siRNA construct (H3) could markedly inhibit the expression of transfected pcDNA3.1-DMΒ in HEK293T cells and endogenous DMΒ in MT2 cells as suggested by immunoblot analysis.
TextSentencer_T46 6544-6749 Sentence denotes As shown in Fig. 3A , the #3 DMΒ-siRNA construct (H3) could markedly inhibit the expression of transfected pcDNA3.1-DMΒ in HEK293T cells and endogenous DMΒ in MT2 cells as suggested by immunoblot analysis.
TextSentencer_T47 6750-6891 Sentence denotes Then the H3 was used to silence the DMB expression and the effect of endogenous DMB expression on HTLV-1 protein expression was investigated.
TextSentencer_T47 6750-6891 Sentence denotes Then the H3 was used to silence the DMB expression and the effect of endogenous DMB expression on HTLV-1 protein expression was investigated.
TextSentencer_T48 6892-7036 Sentence denotes As shown in Fig. 3B , immunoblot assays demonstrated that the expressions of Tax and p19 were increased after the knockdown of DMB in MT2 cells.
TextSentencer_T48 6892-7036 Sentence denotes As shown in Fig. 3B , immunoblot assays demonstrated that the expressions of Tax and p19 were increased after the knockdown of DMB in MT2 cells.
TextSentencer_T49 7037-7311 Sentence denotes Consistently, after DMΒ was silenced in the MT2 cells, proviral transcription was monitored by real-time PCR assays and the results indicated that the expression levels of HTLV-1 proviral transcripts for Tax, p19, Env and px were higher in DMB-silenced MT2 cells (Fig. 3C) .
TextSentencer_T49 7037-7311 Sentence denotes Consistently, after DMΒ was silenced in the MT2 cells, proviral transcription was monitored by real-time PCR assays and the results indicated that the expression levels of HTLV-1 proviral transcripts for Tax, p19, Env and px were higher in DMB-silenced MT2 cells (Fig. 3C) .
TextSentencer_T50 7312-7406 Sentence denotes Similar results were observed in Jurkat and primary CD4+ T cells (see Supplementary Fig. S1 ).
TextSentencer_T50 7312-7406 Sentence denotes Similar results were observed in Jurkat and primary CD4+ T cells (see Supplementary Fig. S1 ).
TextSentencer_T51 7407-7483 Sentence denotes Next, we examined the role of DMΒ in HTLV-1 infected Hela or PMA-THP1 cells.
TextSentencer_T51 7407-7483 Sentence denotes Next, we examined the role of DMΒ in HTLV-1 infected Hela or PMA-THP1 cells.
TextSentencer_T52 7484-7614 Sentence denotes After the knockdown of DMΒ, Hela or PMA-THP1 cells were co-cultured with MT2 cells and HTLV-1 protein expression was investigated.
TextSentencer_T52 7484-7614 Sentence denotes After the knockdown of DMΒ, Hela or PMA-THP1 cells were co-cultured with MT2 cells and HTLV-1 protein expression was investigated.
TextSentencer_T53 7615-7914 Sentence denotes As shown in Fig. 3D and E, compared to cells transfected with control siRNA, real-time PCR assays indicated that the expression amounts of HTLV-1 proviral transcripts for Tax, p19 and px were increased after the knockdown of DMΒ in both HTLV-1 infected Hela (Fig. 3D ) and PMA-THP1 (Fig. 3E ) cells.
TextSentencer_T53 7615-7914 Sentence denotes As shown in Fig. 3D and E, compared to cells transfected with control siRNA, real-time PCR assays indicated that the expression amounts of HTLV-1 proviral transcripts for Tax, p19 and px were increased after the knockdown of DMΒ in both HTLV-1 infected Hela (Fig. 3D ) and PMA-THP1 (Fig. 3E ) cells.
TextSentencer_T54 7915-8054 Sentence denotes Taken together, these results suggest that the knockdown of DMΒ increases HTLV-1 viral protein expression in all cell lines we have tested.
TextSentencer_T54 7915-8054 Sentence denotes Taken together, these results suggest that the knockdown of DMΒ increases HTLV-1 viral protein expression in all cell lines we have tested.
TextSentencer_T55 8055-8221 Sentence denotes Given that type I IFNs play an important role in antiviral responses, we wondered whether DMB inhibited viral protein expression by regulating type I IFNs production.
TextSentencer_T55 8055-8221 Sentence denotes Given that type I IFNs play an important role in antiviral responses, we wondered whether DMB inhibited viral protein expression by regulating type I IFNs production.
TextSentencer_T56 8222-8300 Sentence denotes Hela cells were transfected with SC or H3 and then co-cultured with MT2 cells.
TextSentencer_T56 8222-8300 Sentence denotes Hela cells were transfected with SC or H3 and then co-cultured with MT2 cells.
TextSentencer_T57 8301-8424 Sentence denotes At 24 h after co-culturation, the expression levels of IFNβ and IFN-responsive genes were examined by real-time PCR assays.
TextSentencer_T57 8301-8424 Sentence denotes At 24 h after co-culturation, the expression levels of IFNβ and IFN-responsive genes were examined by real-time PCR assays.
TextSentencer_T58 8425-8601 Sentence denotes The results suggested that the knockdown of DMB had no significant effects on HTLV-1 infection induced production of IFNβ and IFN-responsive genes (see Supplementary Fig. S2 ).
TextSentencer_T58 8425-8601 Sentence denotes The results suggested that the knockdown of DMB had no significant effects on HTLV-1 infection induced production of IFNβ and IFN-responsive genes (see Supplementary Fig. S2 ).
TextSentencer_T59 8602-8749 Sentence denotes It has been reported that HTLV-1 infection increases the accumulation of autophagosomes and that this accumulation increases HTLV-1 production 28 .
TextSentencer_T59 8602-8749 Sentence denotes It has been reported that HTLV-1 infection increases the accumulation of autophagosomes and that this accumulation increases HTLV-1 production 28 .
TextSentencer_T60 8750-8831 Sentence denotes Then we examined the effects of DMB on HTLV-1 induced autophagosome accumulation.
TextSentencer_T60 8750-8831 Sentence denotes Then we examined the effects of DMB on HTLV-1 induced autophagosome accumulation.
TextSentencer_T61 8832-8899 Sentence denotes DMB was silenced in MT2 cells and immunoblot assays were performed.
TextSentencer_T61 8832-8899 Sentence denotes DMB was silenced in MT2 cells and immunoblot assays were performed.
TextSentencer_T62 8900-8992 Sentence denotes We found that the knockdown of DMB increased the amount of LC3-II protein levels (Fig. 4A) .
TextSentencer_T62 8900-8992 Sentence denotes We found that the knockdown of DMB increased the amount of LC3-II protein levels (Fig. 4A) .
TextSentencer_T63 8993-9087 Sentence denotes Similar results were observed in Jurkat and primary CD4+ T cells (see Supplementary Fig. S1 ).
TextSentencer_T63 8993-9087 Sentence denotes Similar results were observed in Jurkat and primary CD4+ T cells (see Supplementary Fig. S1 ).
TextSentencer_T64 9088-9167 Sentence denotes Then we repeated the above analysis in MT2-co-cultured Hela and PMA-THP1 cells.
TextSentencer_T64 9088-9167 Sentence denotes Then we repeated the above analysis in MT2-co-cultured Hela and PMA-THP1 cells.
TextSentencer_T65 9168-9383 Sentence denotes After co-culture with MT2 cells, Hela (Fig. 4B ) or PMA-THP1 (Fig. 4C ) cells transfected with H3 displayed enhanced LC3-II expression and reduced p62 expression compared to the cells transfected with control siRNA.
TextSentencer_T65 9168-9383 Sentence denotes After co-culture with MT2 cells, Hela (Fig. 4B ) or PMA-THP1 (Fig. 4C ) cells transfected with H3 displayed enhanced LC3-II expression and reduced p62 expression compared to the cells transfected with control siRNA.
TextSentencer_T66 9384-9575 Sentence denotes Consistently, the accumulation of LC3-II was increased in DMB-knockdown Hela cells compared to control cells after co-culture with MT2 cells as determined by GFP-LC3 assays ( Fig. 4D and E) .
TextSentencer_T66 9384-9575 Sentence denotes Consistently, the accumulation of LC3-II was increased in DMB-knockdown Hela cells compared to control cells after co-culture with MT2 cells as determined by GFP-LC3 assays ( Fig. 4D and E) .
TextSentencer_T67 9576-9743 Sentence denotes Finally, we determined the role of DMB in MT2-co-cultured cells in the presence of 3-Methyladenine (3-MA), which is believed to block the early stage of autophagy 15 .
TextSentencer_T67 9576-9743 Sentence denotes Finally, we determined the role of DMB in MT2-co-cultured cells in the presence of 3-Methyladenine (3-MA), which is believed to block the early stage of autophagy 15 .
TextSentencer_T68 9744-9835 Sentence denotes We found that DMB knockdown could not affect 3-MA inhibited LC3-II accumulation (Fig. 4F) .
TextSentencer_T68 9744-9835 Sentence denotes We found that DMB knockdown could not affect 3-MA inhibited LC3-II accumulation (Fig. 4F) .
TextSentencer_T69 9836-10039 Sentence denotes Meanwhile, in 3-MA treated Hela cells, DMB knockdown could not increase HTLV-1 protein expression (Fig. 4F) , suggesting that the effect of DMB on HTLV-1 protein expression was associated with autophagy.
TextSentencer_T69 9836-10039 Sentence denotes Meanwhile, in 3-MA treated Hela cells, DMB knockdown could not increase HTLV-1 protein expression (Fig. 4F) , suggesting that the effect of DMB on HTLV-1 protein expression was associated with autophagy.
TextSentencer_T70 10040-10214 Sentence denotes Taken together, these results suggest DMB inhibits HTLV-1 induced autophagosome accumulation and this effect is important to its role in regulating HTLV-1 protein expression.
TextSentencer_T70 10040-10214 Sentence denotes Taken together, these results suggest DMB inhibits HTLV-1 induced autophagosome accumulation and this effect is important to its role in regulating HTLV-1 protein expression.
TextSentencer_T71 10215-10374 Sentence denotes To confirm the role of DMB during HTLV-1 infection in primary cells, we examined the effects of DMB in primary human monocytes after co-culture with MT2 cells.
TextSentencer_T71 10215-10374 Sentence denotes To confirm the role of DMB during HTLV-1 infection in primary cells, we examined the effects of DMB in primary human monocytes after co-culture with MT2 cells.
TextSentencer_T72 10375-10494 Sentence denotes As shown in Fig. 5A , the expression of DMB was much higher in primary human monocytes after co-culture with MT2 cells.
TextSentencer_T72 10375-10494 Sentence denotes As shown in Fig. 5A , the expression of DMB was much higher in primary human monocytes after co-culture with MT2 cells.
TextSentencer_T73 10495-10664 Sentence denotes Then we silenced DMB expression in primary human monocytes by siRNA and investigated its role in HTLV-1 induced autophagosome accumulation and HTLV-1 protein expression.
TextSentencer_T73 10495-10664 Sentence denotes Then we silenced DMB expression in primary human monocytes by siRNA and investigated its role in HTLV-1 induced autophagosome accumulation and HTLV-1 protein expression.
TextSentencer_T74 10665-10836 Sentence denotes Western blot assays showed that DMB-silenced human monocytes had a higher expression level of p19 and an increased LC3-II level after co-culture with MT2 cells (Fig. 5B ).
TextSentencer_T74 10665-10836 Sentence denotes Western blot assays showed that DMB-silenced human monocytes had a higher expression level of p19 and an increased LC3-II level after co-culture with MT2 cells (Fig. 5B ).
TextSentencer_T75 10837-11040 Sentence denotes Consistently, real-time PCR assays indicated that the expression of HTLV-1 proviral transcripts for Tax, p19 and HBZ was enhanced after the knockdown of DMB in MT2-co-cultured human monocytes (Fig. 5C ).
TextSentencer_T75 10837-11040 Sentence denotes Consistently, real-time PCR assays indicated that the expression of HTLV-1 proviral transcripts for Tax, p19 and HBZ was enhanced after the knockdown of DMB in MT2-co-cultured human monocytes (Fig. 5C ).
TextSentencer_T76 11041-11209 Sentence denotes However, no significant difference was observed in the expression levels of IFN-β in DMB-silenced or control human monocytes after co-culture with MT2 cells (Fig. 5C ).
TextSentencer_T76 11041-11209 Sentence denotes However, no significant difference was observed in the expression levels of IFN-β in DMB-silenced or control human monocytes after co-culture with MT2 cells (Fig. 5C ).
TextSentencer_T77 11210-11356 Sentence denotes Taken together, these data suggest DMB affects HTLV-1 induced autophagosome accumulation and HTLV-1 protein expression in primary human monocytes.
TextSentencer_T77 11210-11356 Sentence denotes Taken together, these data suggest DMB affects HTLV-1 induced autophagosome accumulation and HTLV-1 protein expression in primary human monocytes.
TextSentencer_T78 11357-11381 Sentence denotes DMB interacts with ATG7.
TextSentencer_T78 11357-11381 Sentence denotes DMB interacts with ATG7.
TextSentencer_T79 11382-11710 Sentence denotes To characterize the mechanism by which DMB regulated HTLV-1 induced autophagosome accumulation, we tested whether DMB was able to interact with the important ATG proteins involved in canonical autophagy. pcDNA3.1-DMΒ was transfected in HEK293T cells together with HA-tagged ATG proteins (including Beclin1, ATG3, ATG4 and ATG7).
TextSentencer_T79 11382-11710 Sentence denotes To characterize the mechanism by which DMB regulated HTLV-1 induced autophagosome accumulation, we tested whether DMB was able to interact with the important ATG proteins involved in canonical autophagy. pcDNA3.1-DMΒ was transfected in HEK293T cells together with HA-tagged ATG proteins (including Beclin1, ATG3, ATG4 and ATG7).
TextSentencer_T80 11711-11835 Sentence denotes Subsequent coimmunoprecipitation experiments were performed and the data suggested only ATG7 bound to DMB ( Fig. 6A and B) .
TextSentencer_T80 11711-11835 Sentence denotes Subsequent coimmunoprecipitation experiments were performed and the data suggested only ATG7 bound to DMB ( Fig. 6A and B) .
TextSentencer_T81 11836-11968 Sentence denotes To confirm the endogenous interaction between ATG7 and DMB, MT2 cells were lysed and then subjected to immunoprecipitation analysis.
TextSentencer_T81 11836-11968 Sentence denotes To confirm the endogenous interaction between ATG7 and DMB, MT2 cells were lysed and then subjected to immunoprecipitation analysis.
TextSentencer_T82 11969-12043 Sentence denotes The results suggested that endogenous DMB interacted with ATG7 (Fig. 6C ).
TextSentencer_T82 11969-12043 Sentence denotes The results suggested that endogenous DMB interacted with ATG7 (Fig. 6C ).
TextSentencer_T83 12044-12119 Sentence denotes Similar results were observed in MT2-co-cultured PMA-THP1 cells (Fig. 6D) .
TextSentencer_T83 12044-12119 Sentence denotes Similar results were observed in MT2-co-cultured PMA-THP1 cells (Fig. 6D) .
TextSentencer_T84 12120-12242 Sentence denotes Consistently, confocal microscopy assays indicated that GFP-DMB was colocalized with Cherry-ATG7 in Hela cells (Fig. 6E ).
TextSentencer_T84 12120-12242 Sentence denotes Consistently, confocal microscopy assays indicated that GFP-DMB was colocalized with Cherry-ATG7 in Hela cells (Fig. 6E ).
TextSentencer_T85 12243-12305 Sentence denotes Taken together, these results suggest DMB interacts with ATG7.
TextSentencer_T85 12243-12305 Sentence denotes Taken together, these results suggest DMB interacts with ATG7.
TextSentencer_T86 12306-12430 Sentence denotes Considered that DMB usually forms a heterodimeric protein with DMA, we also examined the effects of DMA on HTLV-1 infection.
TextSentencer_T86 12306-12430 Sentence denotes Considered that DMB usually forms a heterodimeric protein with DMA, we also examined the effects of DMA on HTLV-1 infection.
TextSentencer_T87 12431-12552 Sentence denotes Hela cells overexpressing DMA were co-cultured with MT2 cells and the expression levels of Tax and p19 were investigated.
TextSentencer_T87 12431-12552 Sentence denotes Hela cells overexpressing DMA were co-cultured with MT2 cells and the expression levels of Tax and p19 were investigated.
TextSentencer_T88 12553-12716 Sentence denotes Both immunoblot and real-time PCR results suggested that DMA had no significant effect on the expression levels of Tax and p19 (see Supplementary Fig. S3A and B) .
TextSentencer_T88 12553-12716 Sentence denotes Both immunoblot and real-time PCR results suggested that DMA had no significant effect on the expression levels of Tax and p19 (see Supplementary Fig. S3A and B) .
TextSentencer_T89 12717-12882 Sentence denotes Moreover, coimmunoprecipitation data suggested only DMB bound to ATG7 and no significant interaction was detected between ATG7 and DMA (see Supplementary Fig. S3C ).
TextSentencer_T89 12717-12882 Sentence denotes Moreover, coimmunoprecipitation data suggested only DMB bound to ATG7 and no significant interaction was detected between ATG7 and DMA (see Supplementary Fig. S3C ).
TextSentencer_T90 12883-12994 Sentence denotes These results suggested that DMA might not be involved in DMB mediated regulation of HTLV-1 protein expression.
TextSentencer_T90 12883-12994 Sentence denotes These results suggested that DMA might not be involved in DMB mediated regulation of HTLV-1 protein expression.
TextSentencer_T91 12995-13040 Sentence denotes We also examined the location of DMA and DMB.
TextSentencer_T91 12995-13040 Sentence denotes We also examined the location of DMA and DMB.
TextSentencer_T92 13041-13317 Sentence denotes As shown in Supplementary Fig. S3D , DMB co-localized with DMA in lysosomes (suggested by the lysosome Then the cells were washed with PBS three times to remove MT2 cells and lysed for the real-time PCR analyses. β-actin was used as a loading control in the immunoblot assays.
TextSentencer_T92 13041-13317 Sentence denotes As shown in Supplementary Fig. S3D , DMB co-localized with DMA in lysosomes (suggested by the lysosome Then the cells were washed with PBS three times to remove MT2 cells and lysed for the real-time PCR analyses. β-actin was used as a loading control in the immunoblot assays.
TextSentencer_T93 13318-13459 Sentence denotes The data were representative of three independent experiments and were presented as means ± SD (n = 3). *p < 0.05, **p < 0.01. marker Lamp1).
TextSentencer_T93 13318-13459 Sentence denotes The data were representative of three independent experiments and were presented as means ± SD (n = 3). *p < 0.05, **p < 0.01. marker Lamp1).
TextSentencer_T94 13460-13653 Sentence denotes Interestingly, after ssDNA90 stimulation, part of the DMB protein translocated from lysosomes to the cytoplasmic and this part of DMB did not co-localize with DMA (see Supplementary Fig. S3D ).
TextSentencer_T94 13460-13653 Sentence denotes Interestingly, after ssDNA90 stimulation, part of the DMB protein translocated from lysosomes to the cytoplasmic and this part of DMB did not co-localize with DMA (see Supplementary Fig. S3D ).
TextSentencer_T95 13654-13846 Sentence denotes Taken together, these data suggested that in addition to the role in the classical antigen-presenting process in the dimer with DMA, DMB might play a role in autophagy without the help of DMA.
TextSentencer_T95 13654-13846 Sentence denotes Taken together, these data suggested that in addition to the role in the classical antigen-presenting process in the dimer with DMA, DMB might play a role in autophagy without the help of DMA.
TextSentencer_T96 13847-13941 Sentence denotes The association with ATG7 is important for the regulatory role of DMB during HTLV-1 infection.
TextSentencer_T96 13847-13941 Sentence denotes The association with ATG7 is important for the regulatory role of DMB during HTLV-1 infection.
TextSentencer_T97 13942-14305 Sentence denotes To determine which part of DMB was essential for its interaction with ATG7, a series of GFP-tagged DMB deletion mutants, as described in Fig. 7A , were transfected into HEK293T cells with HA-tagged ATG7, The cells were washed with PBS three times to remove MT2 cells and lysed for immunoblot assays. β-actin was used as a loading control in the immunoblot assays.
TextSentencer_T97 13942-14305 Sentence denotes To determine which part of DMB was essential for its interaction with ATG7, a series of GFP-tagged DMB deletion mutants, as described in Fig. 7A , were transfected into HEK293T cells with HA-tagged ATG7, The cells were washed with PBS three times to remove MT2 cells and lysed for immunoblot assays. β-actin was used as a loading control in the immunoblot assays.
TextSentencer_T98 14306-14422 Sentence denotes The data were representative of three independent experiments. and coimmunoprecipitation experiments were performed.
TextSentencer_T98 14306-14422 Sentence denotes The data were representative of three independent experiments. and coimmunoprecipitation experiments were performed.
TextSentencer_T99 14423-14665 Sentence denotes As shown in Fig. 7B , the DMB truncation mutants D1 (aa1-112), D3 (aa1-247), and D4 (aa1-207) coimmunoprecipitated with ATG7, whereas D2 (aa113-263) did not, suggesting that the 1-112aa of DMB might be essential for its association with ATG7.
TextSentencer_T99 14423-14665 Sentence denotes As shown in Fig. 7B , the DMB truncation mutants D1 (aa1-112), D3 (aa1-247), and D4 (aa1-207) coimmunoprecipitated with ATG7, whereas D2 (aa113-263) did not, suggesting that the 1-112aa of DMB might be essential for its association with ATG7.
TextSentencer_T100 14666-14856 Sentence denotes Interestingly, although the truncation mutants D3 and D4 contained the 1-112aa of DMB, their ability of interacting with ATG7 was decreased compared to the D1 mutant and the full-length DMB.
TextSentencer_T100 14666-14856 Sentence denotes Interestingly, although the truncation mutants D3 and D4 contained the 1-112aa of DMB, their ability of interacting with ATG7 was decreased compared to the D1 mutant and the full-length DMB.
TextSentencer_T101 14857-15106 Sentence denotes There was a possibility that the 112-207aa of DMB might block the binding site to some extent and the YXXZ motif (mediating the targeting to the lysosomal compartments) might enhance the interaction by affecting the location and 3D structure of DMB.
TextSentencer_T101 14857-15106 Sentence denotes There was a possibility that the 112-207aa of DMB might block the binding site to some extent and the YXXZ motif (mediating the targeting to the lysosomal compartments) might enhance the interaction by affecting the location and 3D structure of DMB.
TextSentencer_T102 15107-15245 Sentence denotes Then, we determined whether the interaction between DMB and ATG7 was important for the regulatory function of DMB during HTLV-1 infection.
TextSentencer_T102 15107-15245 Sentence denotes Then, we determined whether the interaction between DMB and ATG7 was important for the regulatory function of DMB during HTLV-1 infection.
TextSentencer_T103 15246-15353 Sentence denotes Hela cells were transfected with full-length (FL) DMB or its D2 mutant and then co-cultured with MT2 cells.
TextSentencer_T103 15246-15353 Sentence denotes Hela cells were transfected with full-length (FL) DMB or its D2 mutant and then co-cultured with MT2 cells.
TextSentencer_T104 15354-15493 Sentence denotes Immunoblot assays demonstrated that the D2 mutant had only a slight effect on LC3-II accumulation and HTLV-1 protein expression (Fig. 7C) .
TextSentencer_T104 15354-15493 Sentence denotes Immunoblot assays demonstrated that the D2 mutant had only a slight effect on LC3-II accumulation and HTLV-1 protein expression (Fig. 7C) .
TextSentencer_T105 15494-15691 Sentence denotes Taken together, these results suggest that the 1-112aa of DMB is important for its interaction with ATG7 and this interaction is required for the regulatory function of DMB during HTLV-1 infection.
TextSentencer_T105 15494-15691 Sentence denotes Taken together, these results suggest that the 1-112aa of DMB is important for its interaction with ATG7 and this interaction is required for the regulatory function of DMB during HTLV-1 infection.
TextSentencer_T106 15692-15988 Sentence denotes Given the fact that the p300 promoted acetylation of ATG7 inhibits autophagy 35 , we tried to explore whether DMB could modulate the acetylation of ATG7. pcD-NA3.1-DMΒ was cotransfected with HA-tagged ATG7, and the acetylation of ATG7 was examined in Hela cells co-cultured with MT2 cells or not.
TextSentencer_T106 15692-15988 Sentence denotes Given the fact that the p300 promoted acetylation of ATG7 inhibits autophagy 35 , we tried to explore whether DMB could modulate the acetylation of ATG7. pcD-NA3.1-DMΒ was cotransfected with HA-tagged ATG7, and the acetylation of ATG7 was examined in Hela cells co-cultured with MT2 cells or not.
TextSentencer_T107 15989-16109 Sentence denotes As shown in Fig. 8A , the exogenous expression of DMΒ promoted the (B,C) Human monocytes were transfected with SC or H3.
TextSentencer_T107 15989-16109 Sentence denotes As shown in Fig. 8A , the exogenous expression of DMΒ promoted the (B,C) Human monocytes were transfected with SC or H3.
TextSentencer_T108 16110-16197 Sentence denotes At 24 h after transfection, the cells were co-cultured with MT2 cells for another 24 h.
TextSentencer_T108 16110-16197 Sentence denotes At 24 h after transfection, the cells were co-cultured with MT2 cells for another 24 h.
TextSentencer_T109 16198-16395 Sentence denotes Then the cells were washed with PBS three times to remove MT2 cells and lysed for immunoblot analyses (B) or real-time PCR assay (C). β-actin was used as a loading control in the immunoblot assays.
TextSentencer_T109 16198-16395 Sentence denotes Then the cells were washed with PBS three times to remove MT2 cells and lysed for immunoblot analyses (B) or real-time PCR assay (C). β-actin was used as a loading control in the immunoblot assays.
TextSentencer_T110 16396-16601 Sentence denotes The data were representative of three independent experiments and were presented as means ± SD (n = 3). *p <0.05, **p <0.01. acetylation of ATG7 in both MT2-co-cultured Hela cells and untreated Hela cells.
TextSentencer_T110 16396-16601 Sentence denotes The data were representative of three independent experiments and were presented as means ± SD (n = 3). *p <0.05, **p <0.01. acetylation of ATG7 in both MT2-co-cultured Hela cells and untreated Hela cells.
TextSentencer_T111 16602-16741 Sentence denotes We confirmed this result in endogenous conditions and found the knockdown of DMB decreased the acetylation of ATG7 in MT2 cells (Fig. 8B) .
TextSentencer_T111 16602-16741 Sentence denotes We confirmed this result in endogenous conditions and found the knockdown of DMB decreased the acetylation of ATG7 in MT2 cells (Fig. 8B) .
TextSentencer_T112 16742-16902 Sentence denotes Moreover, the D2 mutant of DMB, which was unable to interact with ATG7, had a slight effect on the acetylation of ATG7 in MT2-co-cultured Hela cells (Fig. 8C) .
TextSentencer_T112 16742-16902 Sentence denotes Moreover, the D2 mutant of DMB, which was unable to interact with ATG7, had a slight effect on the acetylation of ATG7 in MT2-co-cultured Hela cells (Fig. 8C) .
TextSentencer_T113 16903-17050 Sentence denotes Because ATG7 could activate ATG12 and promote the formation of ATG12-ATG5 complex 13 , we examined whether DMB impaired the ATG12-ATG5 conjugation.
TextSentencer_T113 16903-17050 Sentence denotes Because ATG7 could activate ATG12 and promote the formation of ATG12-ATG5 complex 13 , we examined whether DMB impaired the ATG12-ATG5 conjugation.
TextSentencer_T114 17051-17242 Sentence denotes Coimmunoprecipitation experiments indicated that the knockdown of DMB enhanced the endogenous ATG12-conjugation no matter in MT2-co-cultured PMA-THP1 cells (Fig. 8D ) or MT2 cells (Fig. 8E ).
TextSentencer_T114 17051-17242 Sentence denotes Coimmunoprecipitation experiments indicated that the knockdown of DMB enhanced the endogenous ATG12-conjugation no matter in MT2-co-cultured PMA-THP1 cells (Fig. 8D ) or MT2 cells (Fig. 8E ).
TextSentencer_T115 17243-17319 Sentence denotes Then we tried to explore the mechanism by which DMB enhance the acetylation.
TextSentencer_T115 17243-17319 Sentence denotes Then we tried to explore the mechanism by which DMB enhance the acetylation.
TextSentencer_T116 17320-17421 Sentence denotes It has been reported that Sirtuin 1 (Sirt1) can interact with ATG7 and directly deacetylate ATG7 36 .
TextSentencer_T116 17320-17421 Sentence denotes It has been reported that Sirtuin 1 (Sirt1) can interact with ATG7 and directly deacetylate ATG7 36 .
TextSentencer_T117 17422-17503 Sentence denotes So we tried to determine whether DMB modulated the acetylation of ATG7 via Sirt1.
TextSentencer_T117 17422-17503 Sentence denotes So we tried to determine whether DMB modulated the acetylation of ATG7 via Sirt1.
TextSentencer_T118 17504-17770 Sentence denotes We inhibited the Sirt1 activity by EX527 in Hela cells and found that DMB had little effect on the acetylation of ATG7 in the presence of EX527 (see Supplementary Fig. S4A) , suggesting the effect of DMB on the acetylation of ATG7 may be dependent on Sirt1 activity.
TextSentencer_T118 17504-17770 Sentence denotes We inhibited the Sirt1 activity by EX527 in Hela cells and found that DMB had little effect on the acetylation of ATG7 in the presence of EX527 (see Supplementary Fig. S4A) , suggesting the effect of DMB on the acetylation of ATG7 may be dependent on Sirt1 activity.
TextSentencer_T119 17771-17893 Sentence denotes We assumed that DMB might have the potential to regulate the acetylation of ATG7 by disrupting its interaction with Sirt1.
TextSentencer_T119 17771-17893 Sentence denotes We assumed that DMB might have the potential to regulate the acetylation of ATG7 by disrupting its interaction with Sirt1.
TextSentencer_T120 17894-18046 Sentence denotes To address this issue, we examined the effect of exogenous expressed DMB on the association between ATG7 and Sirt1 by competitive coimmunoprecipitation.
TextSentencer_T120 17894-18046 Sentence denotes To address this issue, we examined the effect of exogenous expressed DMB on the association between ATG7 and Sirt1 by competitive coimmunoprecipitation.
TextSentencer_T121 18047-18164 Sentence denotes The results suggested that DMB was able to decrease the association of Sirt1 with ATG7 (see Supplementary Fig. S4B ).
TextSentencer_T121 18047-18164 Sentence denotes The results suggested that DMB was able to decrease the association of Sirt1 with ATG7 (see Supplementary Fig. S4B ).
TextSentencer_T122 18165-18253 Sentence denotes Then we explored the effect of endogenous DMB on the interaction between Sirt1 and ATG7.
TextSentencer_T122 18165-18253 Sentence denotes Then we explored the effect of endogenous DMB on the interaction between Sirt1 and ATG7.
TextSentencer_T123 18254-18526 Sentence denotes The knockdown of DMB in MT2 or MT2-co-cultuled PMA-THP1 cells increased the amount of Sirt1 that coimmunoprecipitated with ATG7 (see Supplementary Fig. S4C and D) , suggesting DMB might regulate the acetylation of ATG7 by inhibiting the interaction between Sirt1 and ATG7.
TextSentencer_T123 18254-18526 Sentence denotes The knockdown of DMB in MT2 or MT2-co-cultuled PMA-THP1 cells increased the amount of Sirt1 that coimmunoprecipitated with ATG7 (see Supplementary Fig. S4C and D) , suggesting DMB might regulate the acetylation of ATG7 by inhibiting the interaction between Sirt1 and ATG7.
TextSentencer_T124 18527-18643 Sentence denotes Taken together, these results suggest DMB inhibits autophagosome accumulation by increasing the acetylation of ATG7.
TextSentencer_T124 18527-18643 Sentence denotes Taken together, these results suggest DMB inhibits autophagosome accumulation by increasing the acetylation of ATG7.
TextSentencer_T125 18644-18855 Sentence denotes It is well known that DM is a kind of non-peptide binding MHC-class-II molecules and acts as an enzyme to catalyze peptide exchange required for efficient loading of endosomal peptides onto MHC-II molecules 37 .
TextSentencer_T125 18644-18855 Sentence denotes It is well known that DM is a kind of non-peptide binding MHC-class-II molecules and acts as an enzyme to catalyze peptide exchange required for efficient loading of endosomal peptides onto MHC-II molecules 37 .
TextSentencer_T126 18856-19065 Sentence denotes However, the role of DM in the overall immune response remains unclear, although several papers have reported DM may function in the development of several autoimmune diseases, such as type I diabetes 38, 39 .
TextSentencer_T126 18856-19065 Sentence denotes However, the role of DM in the overall immune response remains unclear, although several papers have reported DM may function in the development of several autoimmune diseases, such as type I diabetes 38, 39 .
TextSentencer_T127 19066-19205 Sentence denotes Our findings suggested that DMB inhibited HTLV-1 induced autophagosome accumulation and decreased the expression levels of HTLV-1 proteins.
TextSentencer_T127 19066-19205 Sentence denotes Our findings suggested that DMB inhibited HTLV-1 induced autophagosome accumulation and decreased the expression levels of HTLV-1 proteins.
TextSentencer_T128 19206-19379 Sentence denotes Our results showed that HTLV-1-positive T-cell lines had a strong expression of DMB and HTLV-1 infection induced DMΒ expression in Hela, PMA-THP1 or primary human monocytes.
TextSentencer_T128 19206-19379 Sentence denotes Our results showed that HTLV-1-positive T-cell lines had a strong expression of DMB and HTLV-1 infection induced DMΒ expression in Hela, PMA-THP1 or primary human monocytes.
TextSentencer_T129 19380-19554 Sentence denotes Further studies indicated that the overexpression of DMB inhibited HTLV-1 protein expression and DMB knockdown was associated with higher levels of HTLV-1 protein expression.
TextSentencer_T129 19380-19554 Sentence denotes Further studies indicated that the overexpression of DMB inhibited HTLV-1 protein expression and DMB knockdown was associated with higher levels of HTLV-1 protein expression.
TextSentencer_T130 19555-19685 Sentence denotes Because of the importance of type I IFN in the host anti-viral responses, the effect of DMB on type I IFN production was examined.
TextSentencer_T130 19555-19685 Sentence denotes Because of the importance of type I IFN in the host anti-viral responses, the effect of DMB on type I IFN production was examined.
TextSentencer_T131 19686-19766 Sentence denotes However, no significant change was observed with or without the presence of DMB.
TextSentencer_T131 19686-19766 Sentence denotes However, no significant change was observed with or without the presence of DMB.
TextSentencer_T132 19767-19870 Sentence denotes These results drove us to find other possible mechanism to explain the role of DMB in HTLV-1 infection.
TextSentencer_T132 19767-19870 Sentence denotes These results drove us to find other possible mechanism to explain the role of DMB in HTLV-1 infection.
TextSentencer_T133 19871-20065 Sentence denotes As increasing evidence has shown that autophagy plays a complex role in viral infection, it is worth noting that HTLV-1 infection accumulates autophagosomes to benefit the virus replication 28 .
TextSentencer_T133 19871-20065 Sentence denotes As increasing evidence has shown that autophagy plays a complex role in viral infection, it is worth noting that HTLV-1 infection accumulates autophagosomes to benefit the virus replication 28 .
TextSentencer_T134 20066-20204 Sentence denotes Thus, it was reasonable for us to suspect the inhibitory role of DMB on HTLV-1 protein expression might have some relation with autophagy.
TextSentencer_T134 20066-20204 Sentence denotes Thus, it was reasonable for us to suspect the inhibitory role of DMB on HTLV-1 protein expression might have some relation with autophagy.
TextSentencer_T135 20205-20306 Sentence denotes We used LC3-II as the marker of autophagy and examined the effect of DMB on HTLV-1 induced autophagy.
TextSentencer_T135 20205-20306 Sentence denotes We used LC3-II as the marker of autophagy and examined the effect of DMB on HTLV-1 induced autophagy.
TextSentencer_T136 20307-20360 Sentence denotes Our findings confirmed the hypothesis by three steps.
TextSentencer_T136 20307-20360 Sentence denotes Our findings confirmed the hypothesis by three steps.
TextSentencer_T137 20361-20428 Sentence denotes Firstly, DMB inhibited the autophagosome accumulation in MT2 cells.
TextSentencer_T137 20361-20428 Sentence denotes Firstly, DMB inhibited the autophagosome accumulation in MT2 cells.
TextSentencer_T138 20429-20557 Sentence denotes Secondly, DMB inhibited the autophagosome accumulation induced by HTLV-1 infection in Hela, PMA-THP1 or primary human monocytes.
TextSentencer_T138 20429-20557 Sentence denotes Secondly, DMB inhibited the autophagosome accumulation induced by HTLV-1 infection in Hela, PMA-THP1 or primary human monocytes.
TextSentencer_T139 20558-20888 Sentence denotes Thirdly, when we used 3-MA to block the early stage of autophagy, we found that DMB knockdown lost the abilities to promote autophagosome accumulation and to increase HTLV-1 viral protein expression, suggesting that the regulatory role of DMB in autophagosome accumulation was important to its effect on HTLV-1 protein expression.
TextSentencer_T139 20558-20888 Sentence denotes Thirdly, when we used 3-MA to block the early stage of autophagy, we found that DMB knockdown lost the abilities to promote autophagosome accumulation and to increase HTLV-1 viral protein expression, suggesting that the regulatory role of DMB in autophagosome accumulation was important to its effect on HTLV-1 protein expression.
TextSentencer_T140 20889-20966 Sentence denotes How could a non-classical MHC-II protein regulate autophagosome accumulation?
TextSentencer_T140 20889-20966 Sentence denotes How could a non-classical MHC-II protein regulate autophagosome accumulation?
TextSentencer_T141 20967-21128 Sentence denotes As an E1-like enzyme, ATG7 has been reported to be required in both ubiquitin-like LC3 and ATG12 conjugation systems and is essential to autophagosome formation.
TextSentencer_T141 20967-21128 Sentence denotes As an E1-like enzyme, ATG7 has been reported to be required in both ubiquitin-like LC3 and ATG12 conjugation systems and is essential to autophagosome formation.
TextSentencer_T142 21129-21170 Sentence denotes Thus, it is a good target for regulation.
TextSentencer_T142 21129-21170 Sentence denotes Thus, it is a good target for regulation.
TextSentencer_T143 21171-21287 Sentence denotes Our findings indicated that DMB interacted with ATG7 through co-immunoprecipitation and co-localization experiments.
TextSentencer_T143 21171-21287 Sentence denotes Our findings indicated that DMB interacted with ATG7 through co-immunoprecipitation and co-localization experiments.
TextSentencer_T144 21288-21401 Sentence denotes Using a serious of DMB deletion mutants, we found DMB aa1-112 was essential for the association of DMB with ATG7.
TextSentencer_T144 21288-21401 Sentence denotes Using a serious of DMB deletion mutants, we found DMB aa1-112 was essential for the association of DMB with ATG7.
TextSentencer_T145 21402-21676 Sentence denotes Furthermore, the DMB D2 mutant (without aa1-112) almost lost the ability to regulate autophagosome accumulation and HTLV-1 protein expression, suggesting that the interaction between DMB and ATG7 was essential to the regulatory role of DMB in autophagy and HTLV-1 infection.
TextSentencer_T145 21402-21676 Sentence denotes Furthermore, the DMB D2 mutant (without aa1-112) almost lost the ability to regulate autophagosome accumulation and HTLV-1 protein expression, suggesting that the interaction between DMB and ATG7 was essential to the regulatory role of DMB in autophagy and HTLV-1 infection.
TextSentencer_T146 21677-21833 Sentence denotes Acetylation is one of the important posttranslational modifications for the regulation of autophagy, which could affect ATG gene expression or activity 40 .
TextSentencer_T146 21677-21833 Sentence denotes Acetylation is one of the important posttranslational modifications for the regulation of autophagy, which could affect ATG gene expression or activity 40 .
TextSentencer_T147 21834-21966 Sentence denotes It has been reported that deacetylation of ATG5, ATG7 and ATG8 by the NAD-dependent deacetylase Sirt1 could stimulate autophagy 36 .
TextSentencer_T147 21834-21966 Sentence denotes It has been reported that deacetylation of ATG5, ATG7 and ATG8 by the NAD-dependent deacetylase Sirt1 could stimulate autophagy 36 .
TextSentencer_T148 21967-22091 Sentence denotes Here, we showed that DMB affected the acetylation of ATG7, thereby playing an inhibitory role in autophagosome accumulation.
TextSentencer_T148 21967-22091 Sentence denotes Here, we showed that DMB affected the acetylation of ATG7, thereby playing an inhibitory role in autophagosome accumulation.
TextSentencer_T149 22092-22288 Sentence denotes The overexpression of DMB promoted the acetylation of ATG7 in both MT2-co-cultured Hela cells and untreated Hela cells, whereas the knockdown of DMB decreased the acetylation of ATG7 in MT2 cells.
TextSentencer_T149 22092-22288 Sentence denotes The overexpression of DMB promoted the acetylation of ATG7 in both MT2-co-cultured Hela cells and untreated Hela cells, whereas the knockdown of DMB decreased the acetylation of ATG7 in MT2 cells.
TextSentencer_T150 22289-22487 Sentence denotes Although our data have suggested DMB might regulate the acetylation of ATG7 by inhibiting the interaction between Sirt1 and ATG7, further studies about the underlying molecular mechanism are needed.
TextSentencer_T150 22289-22487 Sentence denotes Although our data have suggested DMB might regulate the acetylation of ATG7 by inhibiting the interaction between Sirt1 and ATG7, further studies about the underlying molecular mechanism are needed.
TextSentencer_T151 22488-22641 Sentence denotes It is worth noting that the detailed mechanisms about how autophagosome accumulation can increase the abundance of HTLV-1 protein remain to be clarified.
TextSentencer_T151 22488-22641 Sentence denotes It is worth noting that the detailed mechanisms about how autophagosome accumulation can increase the abundance of HTLV-1 protein remain to be clarified.
TextSentencer_T152 22642-22887 Sentence denotes It has been revealed that HTLV-1 protein Tax, which plays an important role in regulating HTLV-1 replication, blocks the fusion of autophagosomes to lysosomes and prevented its degradation of HTLV-1 protein in the autophagy-lysosome pathway 28 .
TextSentencer_T152 22642-22887 Sentence denotes It has been revealed that HTLV-1 protein Tax, which plays an important role in regulating HTLV-1 replication, blocks the fusion of autophagosomes to lysosomes and prevented its degradation of HTLV-1 protein in the autophagy-lysosome pathway 28 .
TextSentencer_T153 22888-23102 Sentence denotes One may think that the inhibition of autophagosome-lysosome fusion by Tax results in increased autophagosome accumulation and decreased degradation of HTLV-1 protein, leading to increased HTLV-1 proteins abundance.
TextSentencer_T153 22888-23102 Sentence denotes One may think that the inhibition of autophagosome-lysosome fusion by Tax results in increased autophagosome accumulation and decreased degradation of HTLV-1 protein, leading to increased HTLV-1 proteins abundance.
TextSentencer_T154 23103-23290 Sentence denotes Interestingly, our data showed that the DMB expression inhibited autophagosome accumulation at the early phase of the autophagy pathway and resulted in impaired HTLV-1 protein expression.
TextSentencer_T154 23103-23290 Sentence denotes Interestingly, our data showed that the DMB expression inhibited autophagosome accumulation at the early phase of the autophagy pathway and resulted in impaired HTLV-1 protein expression.
TextSentencer_T155 23291-23404 Sentence denotes These results indicated that the autophagosome formation might provide convenience for HTLV-1 protein expression.
TextSentencer_T155 23291-23404 Sentence denotes These results indicated that the autophagosome formation might provide convenience for HTLV-1 protein expression.
TextSentencer_T156 23405-23506 Sentence denotes It is possible that HTLV-1 infection promotes the autophagosome formation to benefit its replication.
TextSentencer_T156 23405-23506 Sentence denotes It is possible that HTLV-1 infection promotes the autophagosome formation to benefit its replication.
TextSentencer_T157 23507-23612 Sentence denotes Meanwhile the Tax protein inhibits the degradation of autophagosome to make the best use of this benefit.
TextSentencer_T157 23507-23612 Sentence denotes Meanwhile the Tax protein inhibits the degradation of autophagosome to make the best use of this benefit.
TextSentencer_T158 23613-23675 Sentence denotes Further studies are needed to clarify the detailed mechanisms.
TextSentencer_T158 23613-23675 Sentence denotes Further studies are needed to clarify the detailed mechanisms.
TextSentencer_T159 23676-23856 Sentence denotes Together, our study demonstrated that DMB modulated autophagosome accumulation by regulating the acetylation of ATG7, thereby affecting the expression of HTLV-1 protein (Fig. 8F ).
TextSentencer_T159 23676-23856 Sentence denotes Together, our study demonstrated that DMB modulated autophagosome accumulation by regulating the acetylation of ATG7, thereby affecting the expression of HTLV-1 protein (Fig. 8F ).
TextSentencer_T160 23857-24014 Sentence denotes Our research may expand our understanding of the regulators in host anti-viral responses and suggest a new role of non-canonical MHC-II protein in autophagy.
TextSentencer_T160 23857-24014 Sentence denotes Our research may expand our understanding of the regulators in host anti-viral responses and suggest a new role of non-canonical MHC-II protein in autophagy.
TextSentencer_T161 24015-24044 Sentence denotes cDNA constructs and reagents.
TextSentencer_T161 24015-24044 Sentence denotes cDNA constructs and reagents.
TextSentencer_T162 24045-24152 Sentence denotes Human HLA-DMB was amplified by PCR using cDNA from MT2 cells, and subsequently cloned into pcDNA3.1 vector.
TextSentencer_T162 24045-24152 Sentence denotes Human HLA-DMB was amplified by PCR using cDNA from MT2 cells, and subsequently cloned into pcDNA3.1 vector.
TextSentencer_T163 24153-24235 Sentence denotes The deletion mutants of DMB were amplified by PCR and subcloned into pEGFP vector.
TextSentencer_T163 24153-24235 Sentence denotes The deletion mutants of DMB were amplified by PCR and subcloned into pEGFP vector.
TextSentencer_T164 24236-24359 Sentence denotes Human ATG3, ATG4, ATG7, and Beclin1 were amplified by PCR using cDNA from Hela cells, and cloned into a pcDNA3.1-HA vector.
TextSentencer_T164 24236-24359 Sentence denotes Human ATG3, ATG4, ATG7, and Beclin1 were amplified by PCR using cDNA from Hela cells, and cloned into a pcDNA3.1-HA vector.
TextSentencer_T165 24360-24464 Sentence denotes ATG7 was subcloned into a pmCherry vector. pENTER-Flag-DMA plasmid was obtained from Vigene Biosciences.
TextSentencer_T165 24360-24464 Sentence denotes ATG7 was subcloned into a pmCherry vector. pENTER-Flag-DMA plasmid was obtained from Vigene Biosciences.
TextSentencer_T166 24465-24562 Sentence denotes Myc-Sirt1 plasmid was a generous gift of Xiaofei Zhu (Xinxiang Medical University, Henan, China).
TextSentencer_T166 24465-24562 Sentence denotes Myc-Sirt1 plasmid was a generous gift of Xiaofei Zhu (Xinxiang Medical University, Henan, China).
TextSentencer_T167 24563-24728 Sentence denotes The 90-base-long HTLV-1 ssDNA90 is the reverse complement of the 5′UTR region (315-404) of complete HTLV-1 genome (NCBI) and was synthesized from the Sangon Biotech.
TextSentencer_T167 24563-24728 Sentence denotes The 90-base-long HTLV-1 ssDNA90 is the reverse complement of the 5′UTR region (315-404) of complete HTLV-1 genome (NCBI) and was synthesized from the Sangon Biotech.
TextSentencer_T168 24729-24760 Sentence denotes The sequence was as f ol lo ws:
TextSentencer_T168 24729-24760 Sentence denotes The sequence was as f ol lo ws:
TextSentencer_T169 24761-24855 Sentence denotes C TG TGTACTAAATTTCTCTCCTGGAGAGTGCTATAGAATGGGCTGTCGCT GGCTCCGAGCCAGCAGAGTTGCCGGTACTTGGCCGTGGGC.
TextSentencer_T169 24761-24855 Sentence denotes C TG TGTACTAAATTTCTCTCCTGGAGAGTGCTATAGAATGGGCTGTCGCT GGCTCCGAGCCAGCAGAGTTGCCGGTACTTGGCCGTGGGC.
TextSentencer_T170 24856-24909 Sentence denotes The The 3-MA (M9281) was obtained from Sigma-Aldrich.
TextSentencer_T170 24856-24909 Sentence denotes The The 3-MA (M9281) was obtained from Sigma-Aldrich.
TextSentencer_T171 24910-24965 Sentence denotes All the chemical inhibitors were obtained from Selleck.
TextSentencer_T171 24910-24965 Sentence denotes All the chemical inhibitors were obtained from Selleck.
TextSentencer_T172 24966-25024 Sentence denotes The PMA (S1819) was purchased from Beyotime Biotechnology.
TextSentencer_T172 24966-25024 Sentence denotes The PMA (S1819) was purchased from Beyotime Biotechnology.
TextSentencer_T173 25025-25055 Sentence denotes Cell culture and transfection.
TextSentencer_T173 25025-25055 Sentence denotes Cell culture and transfection.
TextSentencer_T174 25056-25101 Sentence denotes HEK293T and Hela cells were cultured in DMEM.
TextSentencer_T174 25056-25101 Sentence denotes HEK293T and Hela cells were cultured in DMEM.
TextSentencer_T175 25102-25160 Sentence denotes MT2, C8166, Jurkat and THP1 cells were grown in RPMI 1640.
TextSentencer_T175 25102-25160 Sentence denotes MT2, C8166, Jurkat and THP1 cells were grown in RPMI 1640.
TextSentencer_T176 25161-25327 Sentence denotes PBMCs were enriched from donor blood using Ficoll density gradient separation and human monocytes were separated by their adherence to the culture plate in RPMI 1640.
TextSentencer_T176 25161-25327 Sentence denotes PBMCs were enriched from donor blood using Ficoll density gradient separation and human monocytes were separated by their adherence to the culture plate in RPMI 1640.
TextSentencer_T177 25328-25444 Sentence denotes Primary CD4 + T cells were isolated from PBMCs by FACS screening, and cultured in RPMI 1640 in the presence of IL-2.
TextSentencer_T177 25328-25444 Sentence denotes Primary CD4 + T cells were isolated from PBMCs by FACS screening, and cultured in RPMI 1640 in the presence of IL-2.
TextSentencer_T178 25445-25607 Sentence denotes All cells were supplemented with 10% FBS (Gibco), 4mM L-glutamine, 100U/ml penicillin, and 100U/ml streptomycin under humidified conditions with 5% CO 2 at 37 °C.
TextSentencer_T178 25445-25607 Sentence denotes All cells were supplemented with 10% FBS (Gibco), 4mM L-glutamine, 100U/ml penicillin, and 100U/ml streptomycin under humidified conditions with 5% CO 2 at 37 °C.
TextSentencer_T179 25608-25743 Sentence denotes Transfection of HEK293T and Hela cells was performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
TextSentencer_T179 25608-25743 Sentence denotes Transfection of HEK293T and Hela cells was performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
TextSentencer_T180 25744-25788 Sentence denotes Immunoprecipitation and immunoblot analysis.
TextSentencer_T180 25744-25788 Sentence denotes Immunoprecipitation and immunoblot analysis.
TextSentencer_T181 25789-25876 Sentence denotes Immunoprecipitation and immunoblot analysis were performed as described previously 41 .
TextSentencer_T181 25789-25876 Sentence denotes Immunoprecipitation and immunoblot analysis were performed as described previously 41 .
TextSentencer_T182 25877-25984 Sentence denotes In short, HEK293T, Hela, THP1 or MT2 cells were transfected with various combinations of plasmids or siRNA.
TextSentencer_T182 25877-25984 Sentence denotes In short, HEK293T, Hela, THP1 or MT2 cells were transfected with various combinations of plasmids or siRNA.
TextSentencer_T183 25985-26260 Sentence denotes At 24 h after the transfection, the cell lysates were prepared in lysis buffer containing 1.0% (vol/vol) Nonidet P40, 20 mM Tris-HCl, pH 8.0, 10%(vol/vol) glycerol, 150 mM NaCl, 0.2 mM Na3VO4, 1 mM NaF, 0.1 mM sodium pyrophosphate and a protease inhibitor 'cocktail' (Roche).
TextSentencer_T183 25985-26260 Sentence denotes At 24 h after the transfection, the cell lysates were prepared in lysis buffer containing 1.0% (vol/vol) Nonidet P40, 20 mM Tris-HCl, pH 8.0, 10%(vol/vol) glycerol, 150 mM NaCl, 0.2 mM Na3VO4, 1 mM NaF, 0.1 mM sodium pyrophosphate and a protease inhibitor 'cocktail' (Roche).
TextSentencer_T184 26261-26508 Sentence denotes After centrifugation for 20 min at 14,000 g, supernatants were collected and incubated with the indicated antibody together with protein A/G Plus-agarose immunoprecipitation reagent (sc-2003, Santa Cruz Biotechnology) at 4 °C for 3 h or overnight.
TextSentencer_T184 26261-26508 Sentence denotes After centrifugation for 20 min at 14,000 g, supernatants were collected and incubated with the indicated antibody together with protein A/G Plus-agarose immunoprecipitation reagent (sc-2003, Santa Cruz Biotechnology) at 4 °C for 3 h or overnight.
TextSentencer_T185 26509-26623 Sentence denotes After three washes, the immunoprecipitants were boiled in SDS sample buffer for 10 min and analyzed by immunoblot.
TextSentencer_T185 26509-26623 Sentence denotes After three washes, the immunoprecipitants were boiled in SDS sample buffer for 10 min and analyzed by immunoblot.
TextSentencer_T186 26624-26786 Sentence denotes For endogenous coimmunoprecipitation experiments, the cell lysates of MT2 cells or THP1 cells were incubated with indicated antibodies and analyzed by immunoblot.
TextSentencer_T186 26624-26786 Sentence denotes For endogenous coimmunoprecipitation experiments, the cell lysates of MT2 cells or THP1 cells were incubated with indicated antibodies and analyzed by immunoblot.