Labelling of cDNA
Double stranded, fluorescently labelled (FAM, JOE, or NED) oligonucleotides (5' labelled oligonucleotide: CAGGAGATGCTGTTCGTAGG, unlabelled oligonucleotide: ACGAACAGCATCTCCT, supplier: Applied Biosystems) were annealed in 10 mM Tris pH 8.0, 10 mM NaCl, and 1 mM EDTA (3 min. at 94°C, cooling to 20°C within 15 minutes). Two times three labelling reactions were prepared in 6 different 96-microtiterplates (2×FAM, 2×JOE, and 2×NED, respectively). 500 ng (FAM labelling) or 1 μg (JOE and NED labelling) of the cDNA plasmid preparation was mixed with 0.5 pmol labelled oligonucleotides, 0.25 (FAM) or 0.5 (JOE and NED) Units Bgl I, and 10 (FAM) or 20 (JOE and NED) Units T4-DNA-ligase (New England Biolabs), respectively, in 20 mM Tris-acetate (pH 7.9), 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT, 100 μg/ml BSA, 1 mM ATP. The reactions were incubated over night at 37°C and stopped by heating to 65°C for 10 minutes. The restriction enzymes for the second digest (0.5 U Bfa I, 1.0 U Dde I, 1.5 U Dpn I, 2.0 U Alu I, 1.0 U Rsa I, or 2.0 U Hinf I) were diluted in 10 μl buffer (20 mM Tris-acetate (pH 7.9), 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT, 100 μg/ml BSA) and added separately to the six rections (FAM: Bfa I and Dde I, JOE: Dpn I and Alu I, NED: Rsa I and Hinf I). After 2 hours at 37°C, the reactions were stopped by heating to 80°C for 20 minutes and the reactions Bfa I, Dpn I and Rsa I as well as Dde I, Alu I and Hinf I were pooled, respectively. The reaction products were purified by means of three repeated gel chromatographies using water saturated Sephadex G-50 in Millipore Multiscreen® filtration plates according to the instructions provided by the supplier and dried under vacuum.