Materials and Methods

Cell Culture, HIV-1
CD4+ T-cells were isolated from healthy human donor buffy coats by ficoll-paque density gradient followed by negative selection using a CD4+ isolation kit (Stem Cell Technologies, Vancouver Canada). Isolated CD4+ cells were cultured in RPMI medium containing 10% fetal bovine serum (FBS), and 1% penicillin-streptomycin, referred to hereafter as complete RPMI. For stimulation, complete RPMI was supplemented with phytohemagglutinin (PHA-L) and interleukin-2 (IL-2). Following 3 days of stimulation, the media was changed to complete RPMI supplemented with only IL-2 to proliferate CD4+ T-cells.
HIV-1 BaL was obtained from the NIH AIDS Research and Reference Reagent Program, National Institute of Allergy and Infectious Diseases, NIH. The HIV-1 strain BaL was used for infection of CD4+ T-cells consistent with guidelines from the NIH AIDS Reagent Program, and previous studies (33, 34).

Reagents, Treatment of Cells
For methamphetamine (Meth) treatment, cells were plated at an initial density of 2 × 106cells/mL. Meth was administered once per day at a final concentration of 100 μM, consistent with observed concentrations of Meth in samples from Meth abusers (35). For cultures with HIV-1, cells were pretreated with Meth for 24 h, followed by infection with HIV-1. Cells treated with IL-1RA were given 200 or 400 ng/mL IL-1RA as described (Shenandoah Biotechnology Inc., Warwick, PA), followed by treatment with 100 μM Meth 2 h later if applicable. Cells treated with both HIV-1 and IL-1RA were pretreated for 24 h with IL-1RA before becoming infected with HIV-1. Cells treated with IFNα2 were administered 100U/mL IFNα2 (PBL Assay Science, Piscataway, NJ) for 2 h prior to treatment with 100 μM Meth. Cells treated with both HIV-1 and IFNα2 were pretreated for 24 h with IFNα2 before becoming infected with HIV-1.

Western Blotting (WB)
Primary IRAK1 and TRAF6 antibodies were obtained from Cell Signaling Technology (Danvers, MA). GAPDH was used as a loading control (Santa Cruz Biotechnology, Dallas, TX). Western Blotting was performed as described previously (36). Briefly, cells were collected and lysed, and protein was separated using NuPAGE pre-cast gels (Life Technologies Corp., Carlsbad, CA). Gels were transferred via semi-dry electrotransfer to 0.45 μm nitrocellulose membranes (Bio-Rad Laboratories, Hercules, CA), and probed with designated primary antibodies. Blots were then probed with LI-COR IRDye secondary antibodies and imaged using LI-COR Odyssey CLX according to the manufacturer's instructions (LI-COR, Lincoln, Nebraska). Analysis and relative quantification of gel bands was carried out using ImageJ software (NIH, Bethesda, MD) (37).

Quantitative RT-PCR (Real Time-Polymerase Chain Reaction)
RNA was isolated from CD4+ T-cells using TRIzol™ reagent according to the manufacturer's instructions (Thermo Fisher Scientific, Waltham, MA). DNase treatment was performed using TURBO DNA-free kit (Ambion RNA, Carlsbad, CA). One microgram of RNA was used to prepare cDNA using iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). For miR-146a cDNA, iScript Select cDNA synthesis kit was used for specific amplification using a stem-loop primer method (Bio-Rad, Hercules, CA) (38). RT-qPCR was performed in triplicate for each sample with SYBR green based PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific, Waltham, MA) using 100 ng cDNA. All data were normalized to internal Tata-Box Binding Protein (TBP) control gene, and fold change was calculated using the 2−ΔΔCt method.
Primer Sequences:
miR-146a RT-SL (NR_029701.1): GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCCA
IL-1β F (NM_000576.2): AGCTGATGGCCCTAAACAGATG
IL-1β R (NM_000576.2): TTGTCCATGGCCACAACAAC
IRAK1 F (NM_001569.3): AGAAAAGTTGGGAGCATGGC
IRAK1 R (NM_001569.3): TTTTGGACACGCAAGAGGAC
TRAF6 F (NM_145803.2): ACGGAGCGCATAAAACAAGC
TRAF6 R (NM_145803.2): TCAGCCCAGCAATTCAGTTG.

ELISA
IL-1β ELISA assay was performed according to the manufacturer's protocol using cell culture supernatants (Chondrex, Inc., Redmond WA). Culture supernatants from cells incubated with HIV-1 alone or HIV-1 and Meth/IFNα/IL-1RA were harvested on days 0, 1, 3, and 7. P24 ELISA was performed using the Zeptometrix ELISA kit according to the manufacturer's protocol (Zeptometrix Corporation, Buffalo NY). Supernatants were stored at −80°C.

Transfection
Transfection of primary CD4+ T-cells was carried out using “Nucleofector Kit for T-cells” according to the manufacturer's protocol (Lonza Group, Basel Switzerland). miR-146a-5p mimic and mimic “Negative control #1” (Dharmacon, Lafayette CO) were used for transfection at a concentration of 20 nM. miR-146a-5p stem-loop miRNA inhibitor and stem-loop miRNA inhibitor “Negative control #1” (Dharmacon, Lafayette CO) were used for transfection at a concentration of 40 nM. Transfected cells were harvested at 48 h post transfection.

Flow Cytometry
Cells untreated or treated with Nigericin, Meth, or IFNα+Meth were subjected to the FAM-FLICA Caspase 1 Assay Kit according to the manufacturer's instructions (Immunochemistry Technologies, Bloomington, MN). Nigericin was used as a positive control at a final concentration of 10 μM (Immunochemistry Technologies, Bloomington, MN). Cells were analyzed using a CytoFlex flow cytometer (Beckman Coulter, Indianapolis, IN).

Statistics
All experiments were conducted at least in triplicate, using at least three different donors, and the results between experimental groups were analyzed by ANOVA. A p < 0.05 was considered to be minimally significant.

Study Approval
Healthy human donor buffy coats were obtained from the Blood Transfusion Service, Massachusetts General Hospital, Boston, MA, in compliance with the Beth Israel Deaconess Medical Center Committee on Clinical Investigations (CCI) protocol #2008-P-000418/5. Buffy coats were provided at this institution for research purposes without identifiers; therefore, no informed consent was needed. This study was approved by Beth Israel Deaconess Medical Center's CCI, Institutional Review Board, and Privacy Board appointed to review research involving human subjects. The experimental procedures were carried out in strict accordance with approved guidelines.