PMC:5590178 / 8391-10610 JSONTXT

{"project":"2_test","denotations":[{"id":"28882119-21602908-12765638","span":{"begin":281,"end":283},"obj":"21602908"},{"id":"28882119-16765104-12765639","span":{"begin":547,"end":549},"obj":"16765104"},{"id":"28882119-16959904-12765640","span":{"begin":628,"end":630},"obj":"16959904"}],"text":"DNA manipulation\nFor the expression study, human GFAP was PCR-amplified from GFAP cDNA (NCBI accession number BC013596, Dharmacon, Lafayette, CO) with specific primers (Table 1), and the resulting PCR product was cloned into the BamHI/EcoRV sites of the pCS4 + −3xFLAG-P2A vector [27]. p.Arg79Cys, p.Arg79His, p.Arg239Cys, p.Arg239His and p.Asp128Asn mutations were individually inserted into the WT GFAP construct by site-directed mutagenesis with specific primers (Table 1). For zebrafish study, the zebrafish gfap regulatory elements (7.4 kb) [25] were cloned into the BglII/SalI sites of a mini-Tol2 (T2AL200R150G) plasmid [28]. EGFP and human GFAP C-terminally fused to a FLAG epitope were then sequentially cloned into the resulting construct (Fig. 2b). All plasmids constructed were verified by DNA sequencing (Macrogen, Daejeon, Korea).\nTable 1 Sequences of primers (5′ → 3′) used to construct plasmids encoding various human GFAP alleles\nAllele Sequences\nWT Forward: TAGTAGGATCCATGGAGAGGAGACGCATCAC\nReverse: TAGTCGATATCATCATCACATCCTTGTGCTCCTGCTTG\np.Arg79Cys Forward: GAGATGATGGAGCTCAATGACtGCTTTGCCAGCTACATCGAG\nReverse: CTCGATGTAGCTGGCAAAGCaGTCATTGAGCTCCATCATCTC\np.Arg79His Forward: GAGATGATGGAGCTCAATGACCaCTTTGCCAGCTACATCGAG\nReverse: CTCGATGTAGCTGGCAAAGtGGTCATTGAGCTCCATCATCTC\np.Asp128Asn Forward: GAGAGCTGCGGCTGCGGCTCaATCAACTCACCGCCAACAG\nReverse: CTGTTGGCGGTGAGTTGATtGAGCCGCAGCCGCAGCTCTC\np.Asp157Asn Forward: GCAGAAGCTCCAGaATGAAACCAACCTG\nReverse: CAGGTTGGTTTCATtCTGGAGCTTCTGC\np.Arg239Cys Forward: CAGCCCTGAAAGAGATCtGCACGCAGTATGAGGCAATG\nReverse: CATTGCCTCATACTGCGTGCaGATCTCTTTCAGGGCTG\np.Arg239His Forward: CAGCCCTGAAAGAGATCCaCACGCAGTATGAGGCAATG\nReverse: CATTGCCTCATACTGCGTGtGGATCTCTTTCAGGGCTG\nLower case indicates mutated nucleotides\nFig. 2 Protein expression levels of mutant alleles were comparable to that of WT GFAP. a HEK293T cells were transfected with plasmid encoding EGFP or indicated alleles of GFAP C-terminally fused to a FLAG epitope, and processed for Western blotting with anti-FLAG antibody. Anti-GAPDH (glyceraldehyde-3-phosphate dehydrogenase) antibody was used as a loading control. b Quantitation of GFAP band intensity in (a) normalized to GAPDH band intensity (n = 3). NS: not significant"}