RNA Extraction and Reverse‐Transcription Polymerase Chain Reaction
To study the messenger RNA (mRNA) expression of the MME gene, we performed reverse‐transcription polymerase chain reaction (RT‐PCR) in individuals from some families with MME mutations. Whole blood was collected into PAXgene Blood RNA Tubes (Qiagen), and total RNA was prepared from blood using the PAXgene Blood RNA Kit (Qiagen) in order to generate a complementary DNA (cDNA) pool by RT‐PCR using the High‐Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA), according to the manufacturer's instructions. PCR primers for the β‐actin housekeeping gene were used as the internal control. MME cDNAs were amplified using the following primer pairs: (1) forward primer located in exon 6: 5′‐TGATAGCAGAGGTGGAGAACC‐3′ and reverse primer in exon 9: 5′‐CATCGATGGGCAATCTTTCT‐3′; (II) forward primer in exon 4: 5′‐AATGTCATTCCCGAGACCAG‐3′, reverse primer in exon 7: 5′‐TCATCAGTGCCAACAAACAA‐3′. The expected sizes of the RT‐PCR products were 350bp (base pairs) and 344bp for primer pairs 1 and 2, respectively. PCR products were subjected to agarose gel electrophoresis and sequenced using the Sanger method.