Generation of EXD2−/− cells by CRISP/Cas9
The following guide RNA (gRNA) sequences targeting first exon of EXD2 were selected using Optimized CRISPR Design tool (http://crispr.mit.edu; 54: gRNA1 AAGGCATCCAGCGCCGCCGA, gRNA2 CCCTACAGCCACACCCAGAA.
DNA oligonucleotides were purchased from IDT and cloned into pX335-GFP vector 48 to generate targeting constructs that were subsequently co-transfected in an equimolar ratio into HeLa cells using Lipofectamine. 24 hours after transfection, cells were sorted using a MoFlo cell sorter (Beckman Coulter) for cells expressing Cas9 nickase (GFP-positive cells) and left to recover for 6 days before sorting for single cells and allowing colonies to form. EXD2 expression was analysed by western blotting. Two clones showing loss of all detectable EXD2 were selected for subsequent analysis.