MATERIALS AND METHODS

Animals
All mice were maintained under identical conditions recommended by the Institutional Animal Care and Use Committee of Northwestern University. Men1+/− (FVB;129S-Men1tm1Ctre) mice were obtained from the Jackson Laboratory. These mice were developed on a mixed FVB/N, 129S6 background 3. Cdk4+/− mice and Cdk2+/− mice were generated in the C57BL/6; 129sv mixed background as previously described 14, 18. Men1+/− mice were bred with Cdk4+/− mice or Cdk2+/− mice to generate mice doubly heterozygous for Men1 and Cdk4, or Men1 and Cdk2. Subsequently, Men+/−; Cdk4−/− mice and Men+/−; Cdk2−/− mice were generated by intercross breeding of double heterozygotes in each group. Mice were genotyped by PCR and monitored as described previously 3, 14, 18. Cohorts were housed and analyzed in a common setting. All mice were sacrificed and subjected to necropsy at 15 months of age. At least 10 animals were analyzed per genotype. Our previous study demonstrated that a majority of Cdk4−/− males and some females develop diabetes mellitus within 8 weeks of age and many of them die in several months with hyperglycemia 14. Thus, blood glucose levels were measured weekly on male Cdk4+/− mice beginning at 6 weeks of age, and periodically on female Cdk4+/− mice using a Precision Extra glucometer (Abbott Laboratories). To prevent diabetic Cdk4+/− mice from premature death, Linbit insulin implants (LinShin Canada, Inc) were delivered subcutaneously to transiently anesthetized mice when random blood glucose measurements exceeded 250 mg/dl. Physical conditions of all mice were carefully monitored on daily basis until the 15-month endpoint.

Histopathology, Immunofluorescence, and Immunohistochemistry
Tissues of organs were removed and fixed in 10% neutral buffered formalin, or snap frozen in liquid nitrogen. The gross sizes of pituitaries or pituitary masses were measured using an electronic ruler. After macroscopic evaluation during necropsy, tissues were embedded in paraffin, sectioned at 5 μm thickness and stained with hematoxylin and eosin (H&E). Pituitary and pancreatic sections were examined and photographed using a Zeiss Axiovert microscope and Axiovision software. Additional sections were taken for immunofluorescence and immunohistochemical analyses, performed as previously described 45. To measure proliferating and mitotic cells, sections were blocked with normal goat serum in phosphate-buffered saline and incubated with a polyclonal antibody against Ki67 (NCL-Ki67 at a dilution of 1:1,000; Novocastra Laboratories) and with biotin-conjugated secondary antibody (Vector Laboratories). Other primary antibodies used were anti-insulin (Zymed) and anti-Cdk4 (Santa Cruz). Immunocomplexes were detected using the Vectastain ABC alkaline phosphatase kit according to the manufacturer's instructions (Vector Laboratories). For quantification of Ki67-positive islet cells, at least 1,000 cells in total were counted within each category of the following three: nonhyperplastic islets, hyperplastic islets and islet tumors.

Assay for loss of heterozygosity
Pituitary tumors or non-tumorigenic pituitary tissues were sampled from 15-month-old mice, and genomic DNA was extracted. DNA samples from livers of each mice were also prepared as non-tumorigenic controls. The wild-type and mutant alleles of Men1 were amplified by PCR (95°C, 1 min; 95°C, 30 s; 60°C, 30 s; 72°C, 1 min, for 35 cycles; 72°C, 10 min; 4°C hold) , which yielded 300-bp and 638-bp amplicons, respectively. The three primers used for the reactions were oIMR1484: CCCACATCCAGTCCCTCTTCAGCT; oIMR1485: CCCTCTGGCTATTCAATGGCAGGG; oIMR1486: CATAAAATCGCAGCAGGTGGGCAA, as suggested by JAX.

Cell culture, flow cytometry and immunoblotting
Rat insulinoma INS-1 cells were cultured in RPMI-1640 medium (Invitrogen), supplemented with 10% heat inactivated fetal bovine serum (HyClone/Thermo Fisher Scientific), 1 mM sodium pyruvate, 2 mM L-glutamate, 0.05 mM 2-mercaptoethanol, 10 mM HEPES and penicillin/streptomycin. Cells were transfected with Smart Pool Cdk2 siRNA or Cdk4 siRNA or control dsRNA (Dharmacon/Thermo Fisher Scientific), using the RNAiMax lipofection reagent (GiBCO/Invitrogen). For stimulation of cell cycle progression, cells at 48 h posttransfection were incubated in the medium with low (0.1 mM) glucose for 48 h, followed by incubation in the medium with high (11 mM) glucose. At various times after stimulation with high glucose, cells were harvested for immunoblotting and flow cytometry. At 30 min before each harvesting point, bromodeoxyuridine (BrdU, Sigma/Aldrich) was added to the medium. Immunoblotting and flow cytometry were performed as described previously 14. Anti-BrdU antibody for flow cytometry was obtained from Pharmingen/BD Biosciences. Antibodies against CDK2, CDK4, CDK6, Cyclin D1, Cyclin D3, Cyclin E and Actin were purchased from Santa Cruz Biotechnology. Anti-total RB antibody was from Pharmingen/BD Biosciences, and the phospho-specific antibodies against RB and p130 were from Cell Signaling Technology.

Statistical Analyses
The data on tumor incidences in mice with different genotypes were examined statistically by Fisher's exact test.