Chromatin Immunoprecipitation (ChIP) Assay
ChIP assays were performed using a commercially available Magna-ChIP™ kit (Millipore), as recommended by the manufacturer, with minor modifications. Briefly, after crosslinking the chromatin with 1% formaldehyde at room temperature for 10 min and neutralizing with glycine for 5 min at room temperature, cells were washed with cold PBS, scraped and collected on ice. Cells extracts were prepared using a commercially available kit (Millipore). Nuclear lysates were sonicated 5 times for 15 sec with 1 min intervals on ice using a Sonic Dismembrator (Fisher). An equal amount of chromatin was immunoprecipitated at 4°C overnight with at least 1 µg of the following antibodies: C/EBP-β (sc-150X), p-C/EBP-β (T217) (sc-16993X), normal rabbit IgG (sc-2027)(Santa Cruz Biotechnologies) and RNA polymerase II (Clone CTD4H8)(Millipore). Immunoprecipitated products were collected after incubation with Protein G coated magnetic beads (Millipore). The beads were washed, the bound chromatin was eluted in ChIP Elution Buffer (Millipore) and the proteins were digested with Proteinase K for 2 hrs at 62°C. The DNA was then purified using the QIAquick PCR Purification Kit (Qiagen). DNA was amplified by semi-quantitative PCR or by qPCR using the SYBR green method and primers specific for the SerpinB2 proximal promoter: forward (−338/−315) 5′AAGACTCCCACAGATGGTGGCTGT3’; reverse (−5/+19) 5′TTCTTGGAAAGCTGGCACTGTGTG3’.