MATERIALS AND METHODS

Plasmids
The plasmids pcDNA-3xHA-IκB-α, p3xFLAG-CMV-Tat, p3xFLAG-CMV-Tat C(22,25,27)A, p3xFLAG-CMV-Tat R(49,52,53,55,56,57)A, pGEX-2T-Tat, pGEX-2T-Tat C(22,25,27)A and pGEX-2T-Tat R(49,52,53,55,56,57)A were previously described (50). The plasmids pNL4-3.Luc.R-E- and pHXB2-env were obtained from the AIDS Research & Reference Reagent Program, Division of AIDS, NIAID, NIH, USA; pκBluc and pSV-β-Gal were purchased from Promega (Madison, WI, USA). The plasmids pRc/CMV-3xHA-p65, pRc/CMV-3xHA-p65ΔC(1–318), pRc/CMV-3xHA-p65ΔN(122–551), p3xFLAG-CMV-Tat T,N(23,24)A, p3xFLAG-CMV-Tat K(50,51)A, pGEX-2T-Tat T,N(23,24)A, pGEX-2T-Tat K(50,51)A and pNL4-3.FLAG-Tat.R-E- were generated as described in Supplementary Data.

Cells, transfection, treatments and luciferase assay
HeLa, p50−/−p65−/− mouse embryonic fibroblasts (MEFs) (52) and 293T cells were cultured in Dulbecco's modified Eagle's medium; Jurkat, U937 cells and human peripheral blood mononuclear cells (PBMCs) were cultured in RPMI 1640. PBMCs were isolated as previously described (53). Media were supplemented with 10% heat-inactivated fetal calf serum and 2 mM l-glutamine (Lonza Cologne AG, Germany). HeLa, p50−/−p65−/− MEFs and 293T were transfected with DNA by using FuGENE HD (Roche Diagnostic GmbH, Mannheim, Germany), according to the manufacturer's protocol; total DNA amounts were equalized by transfection of pRc/CMV empty vector (Invitrogen, Carlsbad, CA, USA). For pulse-stimulation, HeLa cells were treated with phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich, St Louis, MO, USA) (20 ng/ml) for 5 min, or tumor necrosis factor-α (TNF-α; Sigma-Aldrich) (20 ng/ml) for 30 min, washed twice in complete culture medium and then returned to culture. For luciferase assays, pSV-β-Gal was co-transfected with pκBluc to monitor the transfection efficiency. Forty-eight-hour post-transfection, cells were lysed in lysis buffer of Dual Light Luciferase System (Tropix, Bedford, MA, USA) and the luciferase and β-galactosidase activities were evaluated by using Dual Light Luciferase System (Tropix) in a bioluminometer (Turner Biosystem, Sunnyvale, CA, USA). The ratio of firefly luciferase activity to β-galactosidase activity was expressed as relative light units.

RNA interference
Jurkat or U937 cells were transfected by electroporation using a Bio-Rad apparatus (Bio-Rad Laboratories, Hercules, CA, USA). Briefly, aliquots (5 × 106 cells) were suspended in 0.3 ml of RPMI 1640 supplemented with 20% fetal calf serum and subjected to a double electrical pulse (0.22 V, 960 µF) in the presence of annealed siRNA (200 pmol); electroporated cells were washed and cultured in complete medium. RNA interference was performed with: siRNA Tat sense, CUGCUUGUACCAAUUGCUAUU and siRNA Tat antisense, UAGCAAUUGGUACAAGCAGUU; siRNA control sense, CUGCUUGUCACA AUUGCUAUU and siRNA control antisense, UAGCAAUUGUGACAAGCAGUU. RNA interference of p65 and IκB-α was performed with SMART pool siRNA p65 and IκB-α (Dharmacon, Chicago, IL, USA).

Pseudotyped virions and single round infection
293T cells (1 × 107) were transfected with pNL4-3.Luc.R-E- or pNL4-3.FLAG-Tat.R-E- (10 µg) together with pHXB2 Env (10 µg), and 48-h post-transfection cell supernatant was collected. Enzyme-linked immunosorbent assay (ELISA) using anti-p24 antibody measured virion concentration. PBMCs, Jurkat or U937 cells (5 × 107) were infected with HXB2 Env-pseudotyped virions (500 ng of p24) by spinoculation, as previously described (50).

Cell extracts, western blotting, IKK activity and NF-κB DNA binding
Total, nuclear and cytosolic extracts were performed as previously described (54); details are reported in Supplementary Data. Western blotting analysis was performed by resuspending protein aliquots in loading buffer (125 mM Tris–HCl, pH 6.8, 5% SDS, 1% bromophenol blue, 10% β-mercaptoethanol, 25% glycerol), resolved on 12% SDS–PAGE, transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA, USA) and incubated with primary antibodies (1:1000) followed by incubation with horseradish-peroxidase-linked mouse or rabbit IgG (1:2000) (GE Healthcare Amersham, Little Chalfont, Buckinghamshire, UK) in PBS containing 5% non-fat dry milk (Bio-Rad Laboratories). Proteins were detected by chemiluminescence using the ECL System (GE Healthcare Amersham). Primary antibodies were purchased from: Santa Cruz Biotechnology, Santa Cruz, CA, USA (anti-HA F7, anti-IκB-α C15, anti-Histone H1, anti-Hexokinase-II); Sigma-Aldrich (anti-FLAG M2, anti-γ-Tubulin); Upstate, Lake Placid, NY, USA (anti-p65). Densitometry of single bands was analysed by ImageJ software package (NIH, USA). IKK activity was evaluated in cytosolic extracts using the HTScan IKK kinase assay kit (Cell Signaling Technology, Danvers, MA, USA). Binding of p65, p50 and FLAG-Tat to the double-stranded NF-κB oligonucleotide was measured using NF-κB Combo Transcription Factor Assay kit (Cayman Chemical Company, Ann Arbor, MI, USA). Electrophoretic Mobility Shift Assay (EMSA) was performed as previously described (55); details are described in Supplementary Data.

In vitro translation
HA-IκB-α, p65 and Tat were expressed under the T7 promoter and in vitro translated using the TnT quick coupled transcription/translation system (Promega), as previously reported (50). Details are described in Supplementary Data.

Immunoprecipitation assay and GST-pull down
Immunoprecipitation, GST-pull down, and production of GST proteins in Escherichia coli strain BL21 were performed as previously reported (50). Details are described in Supplementary Data.

Real-time PCR
Total RNA was extracted from cells by using the TRIzol reagent (Invitrogen); RNA aliquots (200 ng) were reverse transcribed using Random Examers (Roche) and Superscript III Reverse Transcriptase (Invitrogen), according to the manufacturer's protocol. Real-time PCR was performed with the iQ Green Super mix (Bio-Rad Laboratories) and carried out with the iCycler iQ Real-Time detection system (Bio-Rad Laboratories) under the following conditions: 95°C, 1 min; (94°C, 10 s; 60°C, 30 s) ×40. Primers for Tat and MIP-1α are listed in Supplementary Data. Real-time PCR of CSF3, LTA, NFKBIA, TLR2, GAPDH and ACTB was performed using the RT2 profiler PCR Array-Human NF-κB signaling pathway (QIAGEN Sciences, MD, USA). Reactions were carried out in triplicate, and gene expression levels were calculated relative to GAPDH mRNA levels as endogenous control. Relative expression was calculated as 2(Ct gene under investigation − Ct GAPDH).

Chromatin immunoprecipitation assay
Cells were fixed by adding formaldehyde (Sigma-Aldrich) at the final concentration of 1%. After 10 min, ice-cold PBS plus 0.125 M glycine was added, and plates were transferred on ice, washed extensively with PBS, and scraped. After centrifugation, cells were 10 min lysed in lysis buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP-40) supplemented with 1× Complete Protease Inhibitor (Roche Diagnostic GmbH). Nuclei were pelletted (1000 × g, 5 min), and resuspended in sonication buffer (50 mM Tris–HCl pH 8.0, 1% SDS, 10 mM EDTA). Chromatin was sonicated using Bandelin Sonoplus GM70 (Bandelin Electronic, Berlin, Germany), centrifuged (14 000 × g, 15 min), and supernatant was 10-fold diluted in dilution buffer (0.01% SDS, 16.7 mM Tris–HCl pH 8.0, 1.1% Triton X-100, 167 mM NaCl, 1.2 mM EDTA). Samples were pre-cleared by 3-h incubation with 20 µl of protein G agarose beads followed by incubation with antibodies against the analysed proteins. Primary antibodies were: anti-p65 (sc-372), anti-IκBα (sc-203) and rabbit IgG (sc-2027) from Santa Cruz Biotechnology; anti-FLAG M2 from Sigma–Aldrich. Immunoprecipitations were carried out at 4°C overnight and immune complexes were collected with protein G agarose beads, washed five times with low salt buffer (20 mM Tris–HCl pH 8.0, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl), four times with high salt buffer (20 mM Tris–HCl pH 8.0, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 500 mM NaCl), once with TE buffer (10 mM Tris–HCl pH 8.0, 1 mM EDTA), and extracted in TE buffer containing 2% SDS. Protein–DNA cross-links were reverted by heating at 65°C overnight. DNA was further purified by QIAquick PCR purification kit (QIAGEN) and eluted in 50 µl sterile distilled water. Specific enrichment in NF-κB enhancer sequences was measured by real-time PCR of chromatin immunoprecipitation (ChIP) eluates using SYBR GreenER Master Mix (Invitrogen). Reactions were carried out with the iCycler iQ Real-Time detection system (Bio-Rad Laboratories) using the following conditions: 95°C, 1 min; (94°C, 10 s; 60°C, 30 s) ×40. Primers used for MIP-1α, GAPDH and ACTB are listed in Supplementary Data. Real-time PCR of CSF3, LTA, NFKBIA and TLR2 were performed using the Custom ChIP array (QIAGEN). For each sample, values were normalized to input DNA and reported as % of input over the rabbit IgG control.

Statistical analysis
Statistical analysis was performed by two-tail unpaired Student's t-test. Data were reported as means ± SE. Differences between the means were considered as statistically significant at the 95% level (P < 0.05).