Electrophoresis of the Mobility Shift Analysis (EMSA)
Nuclear extracts were isolated from MDMs by using a nuclear extraction kit according to the manufacturer's instruction from Active Motif (Carlsbad, CA). Briefly, MDMs were lysed in hypotonic lysis buffer (20 mM Hepes, pH 7.5; 5 mM NaF, 10 µM Na2MoO4 0.5% NP-40 and 0.1 mM EDTA), and then nuclei were resuspended in lysis buffer supplemented with 0.5 mM DTT and 0.2 mM PMSF. The NF-κB consensus oligonucleotides (sense: AGTTGAGGGGACTTTCCCAGGC; antisense: GCCTGGGAAAGTCCCCTCAACT) labeled with 32P by T4 polynucleokinase (Promega, Madison, WI) were incubated with nuclear extracts in binding buffer (10 mM Tris pH 7.6, 1 mM DTT, 0.5 mM EDTA, 2 µg polydI-dC and 10% Glycerol) at 30°C for 30 minutes. The free DNA and DNA-protein mixtures were resolved in 5% native polyacrylamide gels in 0.5× TBE buffer (45 mM Tris, 45 mM boric acid and 1 mM EDTA, pH 8.3) by electrophoresis. The gel was dried and subjected to autoradiography analysis.