Materials and Methods

Materials
Recombinant human M-CSF was purchased from R&D Systems (Minneapolis, MN). Ro-31-8220, Gö-6976, Rotterin, and BAPTA/AM were obtained from Calbiochem (San Diego, CA). Low endotoxin RPMI and X-vivo serum free medium were obtained from Lonza Walkersville Inc (Walkersville, MD). Fetal bovine serum (FBS, certified <0.06 endotoxin units/ml endotoxin levels) was purchased from Atlanta Biological (Lawrenceville, GA). All other cell culture reagents were obtained through Invitrogen (Carlsbad, CA). PKCα NF-κB p65, Lamin B, β-actin, and GAPDH antibodies, anti-mouse and rabbit IgG-HRP conjugated antibodies, and PKCα siRNA were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Phospho-NFκB p65 (Ser276 or Ser536) antibodies were purchased from Cell Signaling Technology (Danvers, MA). DNA constructs pTAL-SEAP and pNF-κB-SEAP were obtained from Clontech (Mountian View, CA). Expression vectors containing CMV-p65 WT, CMV-p65 276S/A and CMV-p65 536S/A were cloned in pBa5e Puro vector or pFLAG-CMV-2 vector as described previously [49]. Kinase deficient CMV-PKCα (KD-PKCα) or wild type pCMV-PKCα (WT-PKCα) were generous gifts from Alexandra C. Newton (University of California, San Diego, CA). IκBα (NFKBIA) and GAPDH primers for real-time RT-PCR were obtained from SABiosciences (Frederick, MD). A pool of mouse or human PKCα specific siRNA were purchased from Santa Cruz Biotechnology (Santa cruz, CA).

Cell Culture
The murine macrophage cell line RAW 264.7 was purchased from ATCC (Manassas, VA). RAW 264.7 cells were maintained in RPMI supplemented with 5% FBS and antibiotic-antimycotic (1000 U/ml penicillin, 1000 µg/ml streptomycin sulfate, and 250 ng/ml amphotericin B) at 37°C. Mouse embryonic fibroblasts (MEFs) cell line lacking specific NFκB signaling subunits NF-κB p65 (p65−/− cell line) [50] were cultured in DMEM medium supplemented with 10% FBS and antibiotic-antimycotic solution.

Purification of Peripheral Blood Monocytes and Monocyte-Derived Macrophages (MDMs)
Monocytes were isolated from source leukocyte packs obtained from the American Red Cross as described previously [51]. Monocytes used in real time PCR experiments and transfection experiments were purified by positive selection using CD14 Monocyte Isolation Kit from Miltenyi Biotech (Auburn, CA) (>90% pure). In some experiments, monocytes were isolated by clumping method (70% pure). To obtain monocyte-derived macrophages (MDMs), monocytes were cultured in RPMI-1640 medium containing 10% FBS, and 10 µg/ml polymyxin B and 20 ng/ml M-CSF.

Electrophoresis of the Mobility Shift Analysis (EMSA)
Nuclear extracts were isolated from MDMs by using a nuclear extraction kit according to the manufacturer's instruction from Active Motif (Carlsbad, CA). Briefly, MDMs were lysed in hypotonic lysis buffer (20 mM Hepes, pH 7.5; 5 mM NaF, 10 µM Na2MoO4 0.5% NP-40 and 0.1 mM EDTA), and then nuclei were resuspended in lysis buffer supplemented with 0.5 mM DTT and 0.2 mM PMSF. The NF-κB consensus oligonucleotides (sense: AGTTGAGGGGACTTTCCCAGGC; antisense: GCCTGGGAAAGTCCCCTCAACT) labeled with 32P by T4 polynucleokinase (Promega, Madison, WI) were incubated with nuclear extracts in binding buffer (10 mM Tris pH 7.6, 1 mM DTT, 0.5 mM EDTA, 2 µg polydI-dC and 10% Glycerol) at 30°C for 30 minutes. The free DNA and DNA-protein mixtures were resolved in 5% native polyacrylamide gels in 0.5× TBE buffer (45 mM Tris, 45 mM boric acid and 1 mM EDTA, pH 8.3) by electrophoresis. The gel was dried and subjected to autoradiography analysis.

Transient Transfection of RAW 264.7 Cells
RAW 264.7 cells were seeded in 12-well plates in RPMI medium containing 5% FBS one day prior to transfection, Secreted alkaline phosphatase (SEAP) reporter plasmids pTAL-SEAP or pNF-κB-SEAP were transfected into cells using Qiagene Effectene or Attractene transfection kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. For co-transfection studies, PKCα or NF-κB p65 constructs were mixed at a ratio of 5∶1 with the reporter plasmid. For siRNA transfection, 100 nM of PKCα siRNA or control siRNA were used. Cells were incubated with the transfection reagents for 16–24 hours, washed and starved in RPMI without FBS for 4 hours. Samples were then stimulated with 100 ng/ml M-CSF for 4 hours at which point the medium was collected for the SEAP analysis. For inhibition studies, cells were pre-incubated with inhibitors for 30 minutes before M-CSF treatment. On average, we realized 30–40% transfection efficiency as confirmed by GFP expression in Raw 264.7 cells.

Transient Transfection of Primary Human Monocytes
Monocytes were transfected using the human monocyte Amaxa nucleofector kit (Lonza Walkersville Inc, Walkersville, MD) as previously described [51]. Briefly, monocytes were resuspended in Amaxa Nucleofactor solution at a density of 20×106 cells/ml, and 2 µg of total plasmid DNA 100 nM of PKCα siRNA or control siRNA was added and transfected using program Amaxa Y-01. For co-transfection studies, PKCα or NF-κB p65 constructs were mixed at a ratio of 5∶1 with the reporter plasmid. Immediately after transfection, cells were washed with 1 ml of RPMI medium containing 2 mM glutamine and 10% FBS or serum free LGM medium (Lonza Walkersville Inc.) then plated at 4×105 cells/well in 24-well plates. The original medium was replaced by serum free LGM medium without or with M-CSF (100 ng/ml) one hour later. The next day, cell-free supernatants were collected for the SEAP analysis. Cells were stained with Annexin V/propidium iodide (PI). For the inhibition studies, cells were pre-incubated with inhibitor for 30 minutes in X-vivo medium prior to the addition of M-CSF.

Secreted Alkaline Phosphatase (SEAP) Analysis
Secreted alkaline phosphatase activity was analyzed by GreatEscape SEAP kit according to the manufacturer's instruction. Briefly, medium was diluted in the dilution buffer and heated to 65°C to inactivate endogenous phosphatases then incubated with the substrate for 30 minutes. The chemiluminence signal was recorded using a luminometer.

Annexin V/PI Apoptosis Assay
Cell apoptosis assay was performed as described previously [51] using the Annexin V–FITC apoptosis detection kit (BD PharMingen, San Diego, CA). Briefly, human monocytes (5×106) were incubated with inhibitors for 30 minutes in X-vivo medium and restimulated with 100 ng/ml M-CSF overnight. The cells were removed from the culture dish using Accutase (eBioscience, San Diego, CA) and stained with Annexin V–FITC and PI and analyzed by flow cytometry (FACSCalibur; BD PharMingen). Annexin V-FITC and PI double negative cells were considered non-apoptotic cells for statistical analysis.

Western Blot Analysis
Cells were washed with PBS and resuspended in cell lysis buffer. (Cell Signaling Technology) and incubated for 10 minutes on ice then centrifuged to remove the insoluble fraction. The protein concentration was determined by the BCA protein assay (Bio-Rad, Hercules, CA). Cell lysates were separated by SDS-PAGE on 10% polyacrylamide gels and then transferred onto nitrocellulose membranes and subjected to Western blotting. The immunoblotted proteins were detected by ECL reagent (GE Healthcare Bio-Sciences Corp., Piscataway, NJ).

Analysis of PKCα Kinase Activity
Human MDMs were starved for 2 hours before stimulation with M-CSF (0–60 minutes), then washed with cold PBS and removed from the plates. The cells were resuspended in lysis buffer (20 mM Tris, 5 mM MgCl2, 1 mM EGTA, 20 mM β-glycerol phosphate, 1 mM PMSF 2 µg/ml aprotinin and 2 µg/ml leupeptin, pH 7.5), sonicated and centrifuged to obtain whole cell lysates, which were then immunoprecipitated with anti-PKCα antibody and protein G-agarose (Invitrogen). Immune complexes were washed twice, and PKCα activity was analyzed by non-radioactive Peptag assay kit (Promega). Briefly, kinase buffer, activator, peptide protection solution and Peptag peptide were incubated with the immune complexes at 30°C for 30 minutes. Reactions were stopped by boiling for 10 minutes and samples were separated on 0.8% agarose gel. Phosphorylated peptide migrated toward the anode (+), while non-phosphorylated peptide migrated toward the cathode (−). Fluorescein-tagged peptides were visualized by UV light.

RNA Isolation and Quantitative Real-time PCR
MDMs or RAW 264.7 cells were serum-starved overnight or for 2 hours, respectively, prior to incubating with inhibitors for 30 minutes. The cells were restimulated with 100 ng/ml M-CSF and total mRNA was extracted from cells with Trizol (Invitrogen) and 1–2 µg of total RNA was used to synthesized cDNA using SuperScript III (Invitrogen). Quantitative real-time (qRT)-PCR was performed using SYBR Green Master Mix (Applied BioSystems, Carlsbad, CA). The reactions were performed using an ABI PRIZM 7700 machine with software Sequence Detector version 1.7 (Applied Biosystems). The target gene values were normalized to the values of GAPDH as a housekeeping gene and expressed as relative fold increase 2(−ΔΔCt) over the non-stimulated samples (NS).

Statistical Analysis
Statistical comparisons were performed using analysis of variance testing (Minitab software, State Park, PA or SPSS16 software, SPSS Inc. Chicago, IL). Statistical significance was defined as p≤0.05.

Ethics Statement
All research involving human blood (Buffy coat) were ordered from American Red cross and have been approved by the Ohio State University review board (ARC IRB Protocol #2001-26).