In situ hybridization
In situ hybridization was carried out on 12-μm paraffin sections using digoxigenin-labeled RNA probes (Roche Diagnostics, Indianapolis, Indiana, United States) according to standard protocols (Wilkinson and Nieto 1993). Embryos and postnatal skin samples were obtained from intercrosses of deH/+ mice. Embryos E13.5 or younger were fixed for 24 h; those older than E13.5 and postnatal skin were fixed for 36–48 h prior to embedding. The Tbx15 probe was generated by RT–PCR using primers GGCGGCTAAAATGAGTGAAC and TGCCTGCTTTGGTGATGAT (corresponds to exons 1 and 2), and the En1 probe was generated by PCR from genomic DNA using primers ACGCACCAGGAAGCTAAAGA and AGCAACGAAAACGAAACTGG (located in the last exon). The Agouti probe corresponds to the protein-coding sequence.