Table 6 List of the used oligonucleotides FVB/N PrP-/- mice Name SEQUENCE (5' -3') Prnp 5' CAACCGAGCTGAAGCATTCTG Prnp 3' CGACATCAGTCCACATAGTC scg5 5' CCTTTATGAGAAAATGAAGGG scg5 3' GGACAGATTTCTTTGCCACA Tg37xNFH-Cre mice Name SEQUENCE (5' -3') Ifitm3 5' TCAGCATCCTGATGGTTGTT Ifitm3 3' TGTTACACCTGCGTGTAGGG AV451297.1 5' CCCGAAGCGTTTACTTTGAA AV451297.1 3' CCCTCTTAATCATGGCCTCA Erf1 5' TCGCTCCACCAACTAAGAAC Erf1 3' AAACACGGGAAACCTCACC Prnp Tg37 5' GAAGGAGTCCCAGGCCTATT Prnp Tg37 3' GCAGGAATGAGACACCACCT Glrx3 5' CATAAGCATGGTGTCCAAGG Glrx3 3' TGCCTTCTCTGCTTCGTAGA Riken D17 5' AAGCCTTCATAGCGAGTGGA Riken D17 3' TTCCAGACAAGTGGACCTGA Bace1 5' TCGACCACTCGCTATACACG Bace1 3' CTCCTTGCAGTCCATCTTGAG Fgf2 B 5' AGCGGCTCTACTGCAAGAAC Fgf2 B 3' GCCGTCCATCTTCCTTCATA Atp13a1 5' CGTGACAAGGGTGAAGATGG Atp13a1 3' ATAGTAAGAGAAGGCATTCC BB217622.2 5' CCAGTTCCGTCAAAGTACCC BB217622.2 3' CATGCAGATCTTCAGGTCCA β-actin 5' TGTTACCAACTGGGACGACA β-actin 3' GGGGTGTTGAAGGTCTCAAA The sequences of the oligonucleotides used in the QPCR experiments are listed; including those of the housekeeping gene that was used in the three described analyses. The sets of primers for the Erf1, Glrx3, BB217622.2 and the AV451297.1 loci were designed within a single exon. All the other sets were designed over exon-exon borders.