Mutation Analyses
Gene fragments of hotspot mutation regions in BRAF (exon 15) and NRAS (exon 2) were amplified by PCR in separate reactions to screen for common mutations found in melanomas. Standard PCR reactions were carried out using Amplitaq Gold DNA polymerase in 1× PCR buffer (Applied Biosystems) according to manufacturer's instructions. Primers: BRAF exon 15 Forward: 5′-TCA TAATGCTTGCTCTGATAGGA and Reverse: 5′-GGCCAAAAATTTAATCAGTGGA (annealing temperature 59°C); and NRAS exon 2 Forward: 5′-GGTGAAACCTGTTTGTTGGA and Reverse: 5′-TTCAGAACACAAAGATCATC (55°C).
BRAF and NRAS PCR products were sequenced in both directions using an ABI3100 Automated DNA Sequencer with a 36 cm capillary array, ABI POP-7 polymer and ABI Prism BigDye Terminator Cycle Sequencing Kit version 1.1 (Applied Biosystems) according to the manufacturer's instructions. Sequence analysis was carried out using CodonCode Aligner sequencing software (CodonCode Corporation, Dedham, MA, USA) and mutation detection was based on BRAF and NRAS cDNA sequences (Genbank accession nos. NM_004333 and NM_00254, respectively).