Fig. 1  Size-exclusion chromatography and limited proteolysis of MxiC. a, Elution of MxiCFL (continuous line) and MxiCNΔ73 (broken line) from a HiLoad 16/60 Superdex 200 column pre-equilibrated in 20 mM Tris (pH 7.5), 150 mM NaCl. MxiCFL and MxiCNΔ73 elute as monomers as single, slightly asymmetric peaks. b, SDS-PAGE of limited proteolysis of MxiCFL. Degradation of purified MxiCFL was considerable after storage at 4 °C for eight weeks (lane 1). Limited proteolysis was carried out on freshly purified MxiCFL incubated for 2 h at 20 °C with an increasing mass ratio of protein:subtilisin from 20 μg:2 ng to 20 μg:80 ng (lanes 2–6). Methods: DNA fragments of the mxiC gene encoding residues 1–355 (full length, MxiCFL) and 74–355 (N-terminal truncation, MxiCNΔ73) were produced by PCR (FLf, CATATGCTTGATGTTAAAAATACAGGAGTTTTT; N73f, CATATGAGTCAGGAACGTATTTTAGAT; FLr, GAATTCTTATCTAGAAAGCTCTTTCTTGTATGCACT) and cloned into the NdeI-EcoRI sites of the pET28b vector. These constructs include an N-terminal His6-tag and a thrombin cleavage site. MxiC constructs were expressed in Escherichia coli BL21 (DE3) cells grown in LB medium containing 34 μg ml− 1 kanamycin. Cells were grown at 37 °C until an A600 nm of ∼ 0.6 was reached, whereupon they were cooled to 20 °C and protein over-expression was induced by the addition of IPTG (1.0 mM final concentration). After ∼ 16 h, cells were harvested by centrifugation (15 min, 5000g, 4 °C) and pellets were frozen at – 80 °C. Cell pellets were resuspended in lysis buffer (20 mM Tris (pH 7.5), 500 mM NaCl and Complete EDTA-free Protease Inhibitor Cocktail, Roche) and lysed using an Emulsiflex-C5 Homogeniser (Glen Creston, UK). The resultant cell suspension was centrifuged (20 min, 20,000g, 4 °C) and the soluble fraction was applied to a pre-charged HisTrap FF nickel affinity column (GE Life Sciences). Protein was eluted using a gradient of 0–1 M imidazole in 20 mM Tris (pH 7.5), 500 mM NaCl and fractions containing MxiC were further purified by size-exclusion chromatography as described above. SDS-PAGE analysis revealed MxiCFL and MxiCNΔ73 to be pure (data not shown). Fractions containing purified MxiC were pooled and concentrated using Millipore Ultra-15 10 k MWCO centrifugal filtration devices to 7 mg ml− 1 and stored at 4 °C. Selenomethionine (SeMet)-labeled MxiC was produced by expression in the E.coli met− auxotrophic strain B834 (DE3). Cultures were grown in LB medium to an A600 nm of 0.9 then pelleted (15 min, 4000g, 4 °C) and washed in PBS three times before being used to inoculate SelenoMet Medium Base™ containing SelenoMet Nutrient Mix™ (Molecular Dimensions). Cells were grown and induced as described above. SeMet-labeled protein was purified as described above. Full incorporation of selenomethionine was confirmed by mass spectrometry. Dynamic light-scattering experiments were performed on a Viscotek model 802 DLS instrument using the OmniSIZE 2.0 acquisition and control software according to the manufacturer's instructions at 20 °C on a 1 mg ml− 1 protein sample in 20 mM Tris (pH 7.5), 150 mM NaCl.