MATERIALS AND METHODS

Cell culture
The human T cell lines A3.01 and PM1 (NIBSC, UK) and the human myeloid cell line U937 (NIBSC, UK) were grown in complete RPMI 1640 medium supplemented with 10% fetal bovine serum, 2 mM l-glutamine and 100 U/ml penicillin–streptomycin. The human hepatic cell lines HepG2 and Huh7 (kindly provided by Dr Thomas Pietschmann, Department of Molecular Virology, University of Heidelberg) as well as HeLa cells were maintained in Dulbecco's high glucose modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 2 mM l-glutamine and 100 U/ml penicillin–streptomycin. Cells lines were incubated at 37°C with 100% humidity in 5–7% CO2 and passaged using standard cell culture techniques.

Plasmids
For cloning of an APOBEC3G promoter-driven reporter plasmid, genomic DNA was prepared from the T cell line PM1 using the DNeasy Kit (Qiagen). The DNA sequence ranging from positions −959 to +66 relative to the identified transcription start was amplified via PCR using the primers 3Gprom1025 (5′-TGTGAACGCGTTGCTGCAGGCCATCTGGATGTATATG-3′) and 3Gpromreverse (5′-ACAGCAGATCTAGGGACCTCTGATAAAGACAGG-3′). PCR reactions were performed with Pwo DNA Polymerase (Roche) using the following cycle conditions: one cycle 94°C for 2 min; 30 cycles 94°C for 30 s, 58°C for 60 s, 72°C for 60 s; one cycle 72°C for 7 min. The amplicon was ligated into the promoterless luciferase reporter plasmid pGL3-Basic (Promega) via MluI and BglII restriction sites, which were introduced by the primers. The resulting construct contained 1025 bp of the A3G promoter and was designated pGL3-APOprom1025. Reporter plasmids containing shorter fragments of the APOBEC3G promoter were constructed using pGL3-APOprom1025 as template and the following forward primers: for plasmid pGL3-APOprom502 (containing sequence −436/+66): 3Gprom502 (5′-TGTGAACGCGTTCCATAACATGGGGACAAGA-3′); for plasmid pGL3-APOprom225 (containing sequence −159/+66): 3Gprom225 (5′-TGTGAACGCGTCGAGGGCAGGATCCGGGAGT-3′); for plasmid pGL3-APOprom180 (containing sequence −114/+66): 3Gprom180 (5′-TGTGAACGCGTTCTTGATGGTGGAGAGGAGG-3′); for plasmid pGL3-APOprom150 (containing sequence −84/+66): 3Gprom150 (5′-TGTGAACGCGTGCGGGACCACCAGGGGAGGGGCTT-3′); for plasmid pGL3-APOprom120 (containing sequence −54/+66): 3Gprom120 (5′-TGTGAACGCGTTGCTGGCTCAGCCTGGTGTG-3′); for plasmid pGL3-APOprom60 (containing sequence +7/+66): 3Gprom60 (5′-TGTGAACGCGTCCCTTTGCAATTGCCTTG-3′); each in combination with the reverse primer 3Gpromreverse (described above). PCR reactions were performed with Pfu Ultra Hotstart (Stratagene) using the following cycle conditions: one cycle 94°C for 2 min; 30 cycles 94°C for 45 s, 58°C for 45 s, 72°C for 60 s; one cycle 72°C for 7 min. As for pGL3-APOprom1025, MluI and BglII restriction sites were introduced via the primers and PCR products were ligated into pGL3-Basic (Promega) via these restriction sites. pGL3-APOprom180mut carries two point mutations (bold) and was generated using the primer 3GProm180mut (5′-TGTGAACGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGTTCGGGACCACCAG-3′) in combination with primer 3Gpromreverse. This PCR was performed with an annealing temperature of 65°C. pGL3promE1 (containing nucleotides −114/−85) and pGL3promE2 (containing nucleotides −92/−63) were constructed by annealing the following single-stranded oligonucleotides: 114_85Plus (5′- CGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGGA-3′) and 114_85Minus (5′- GATCTCCAGCTGGAGCCTCCTCTCCACCATCAAGAA-3′) or 92-63Plus (5′-CGCGTCCAGCTGGGCGGGACCACCAGGGGAGGGGCA-3′) and 92_63Minus (5′-GATCTGCCCCTCCCCTGGTGGTCCCGCCCAGCTGGA-3′). After annealing, the double-stranded oligonucleotides which contained the respective 30 bp of the APOBEC3G promoter and sticky ends compatible with MluI and BglII restriction sites were ligated into the pGL3-Promoter (Promega) vector. The sequences of all constructed plasmids were verified by sequence analysis. Nucleotide −219 of the cloned APOBEC3G promoter differs from the sequence in the database (GenBank™ accession number DQ147772). An A-to-C substitution is present at this position. Numbering is relative to the major transcriptional start site we identified.
The reporter plasmids pGL3-Control and phRG-TK were purchased from Promega. pGL2-CVX contains two repeats of the IFN-responsive GAS (gamma activated sequence) elements (GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG) of the guanylate-binding protein (GBP) gene in front of a CMV minimal promoter and was kindly provided by Ute Pägelow and Mario Köster from the Helmholtz-Zentrum für Infektionsforschung. Plasmid pNL4-3 (NIBSC, UK) contains the full-length HIV-1NL4-3 genome and has been described previously (34). pcDNA3.1Vif was generously provided by Nathaniel R. Landau from the Salk Institute, La Jolla. It was generated by amplifying the Vif gene from pNL4-3 and ligating it into the pcDNA3.1 vector via BamHI and XhoI restriction sites. A 3′-WPRE element was included into the XhoI site. pBS-kRSPA-TatHIV-1(NL4-3) was constructed by amplifying the two exons of Tat via PCR reaction using the molecular clone pNL4-3 as template and the following primer sets: exon1, 5ÜXho1HIV-Tat1Plus (5′-GCATGCTCGAGATGGAGCCAGTAGATCCTAG-3′) and HIV-Tat1Minus (5′-TGCTTTGATAGAGAAGCTTGATG-3′); exon2, 15FHIV-Tat2Plus (5′-TTCTCTATCAAAGCAACCCACCTCCCAATCCCG-3′) and 5ÜSpe1HIV-Tat2Minus (5′-GACGTACTAGTCTATTCCTTCGGGCCTGTC-3′). XhoI and SpeI restriction sites were introduced via the primers. The sense-primer of exon2 starts with a 15-mer which is homologous to the 3′ end of exon1 and necessary for fusion of both exons. PCRs were performed with Expand High Fidelity PCR System (Roche) using the following conditions: one cycle 94°C for 3 min; 35 cycles 94°C for 45 s, 55°C for 45 s, 68°C for 45 s; one cycle 68°C for 7 min. For fusion of both exons, the following PCR conditions were applied: one cycle 94°C for 3 min; 35 cycles 94°C for 45 s, 58°C for 45 s, 68°C for 60 s. After 10 cycles without primers, the sense-primer of exon1 and the antisense-primer of exon2 were added for the remaining cycles. The resulting amplicon was ligated into the pBS-kRSPA vector (35) via XhoI and SpeI restriction sites.

5′-Rapid amplification of cDNA ends analysis (RACE)
Total RNA was isolated from A3.01 T cells using RNeasy mini kit (Qiagen). The transcriptional start sites of A3G were identified using the 5′/3′ RACE Kit, 2nd Generation (Roche) according to the manufacturer's instructions. The following primers were used: RACE-APO3G1 (5′-TATCCCTTGTACACTTTGT-3′) for cDNA synthesis, RACE-APO3G2 (5′-CATACTCCTGGTCACGAT-3′) for the first PCR and RACE-APO3Gnest (5′-GAATACACCTGGCCTCGAA-3′) for the nested PCR. Reaction products were analyzed by agarose gel electrophoresis, purified using QIAquick gel extraction kit (Qiagen), T/A-cloned into vector pCR4-TOPO (Invitrogen) and sequenced.

Luciferase assay
For transient transfection of A3.01 and U937 cells, DMRIE-C transfection reagent (Life Technologies) was used (36). Cells were seeded in 6-well tissue culture plates (5 × 105 cells per well) in 1.5 ml Opti-MEM (Life Technologies) containing 0.5 µg firefly luciferase reporter plasmid and 3.5 µl DMRIE-C. After 4–5 h of incubation, 1.5 ml complete RPMI medium were added. HepG2 and Huh7 cell lines were transfected using LipofectAMINE Plus as recommended by the manufacturer (Life Technologies). Briefly, exponential growing cells (1.5 × 106) were transfected with 5 µl LipofectAMINE, 6 µl PLUS reagent and the required amount of plasmid DNA in a final volume of 1 ml Opti-MEM. Following 4 h of incubation, cells were washed in PBS and 3 ml of complete DMEM medium were added.
For cotransfection of reporter plasmids and siRNA into HeLa cells, HiPerfect transfection reagent (Qiagen) was used according to the manufacturer's protocol for cotransfection of adherent cells with siRNA and plasmid DNA.
Two days after transfection of the respective cell lines, cells were harvested in 100 µl (suspension cells) or 300 µl (adherent cells) of Passive Lysis Buffer (Promega) and luciferase assay was performed using the Dual Luciferase Assay System (Promega) according to the manufacturer's instructions. As an internal control, 50 ng (adherent cells) or 100 ng (suspension cells) of ph-RG-TK plasmid (Promega), which constitutively expresses renilla luciferase was cotransfected in every sample and firefly luciferase activities were normalized to renilla luciferase activities. Mean values (±SD) of a representative experiment performed in triplicate are shown in the figures. For stimulation of cells, final concentrations of 20 ng/ml TPA (Sigma) or 30 ng/ml IFN-α or 30 ng/ml IFN-γ (Tebu-Bio) were applied approximately 15 h before harvesting for luciferase assay.

Electrophoretic mobility shift assay (EMSA)
For preparation of nuclear extracts, 5 × 106 A3.01 T cells were washed in cold PBS and resuspended in 500 µl buffer A (10 mM HEPES pH7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM PMSF). After incubation for 15 min on ice, swollen cells were pressed 10 times through a syringe with a 26G needle and centrifuged at 5000 r.p.m. for 5 min. Pellets contained the nuclei and were washed in buffer A for two times and resuspended in 50 µl buffer C (20 mM HEPES pH 7.9, 400 mM NaCl, 1 mM EDTA, 1 mM EGTA 1 mM DTT, 1 mM PMSF). After shaking for 30 min at 4°C and centrifugation for 10 min at 13 000 r.p.m., supernatants were used as nuclear extracts.
EMSA probes were generated by annealing the following complementary oligonucleotides: APO-Sp1/3, 5′- CCAGCTGGGCGGGACCACCAGGGGAGGGGC-3′ and 5′-GCCCCTCCCCTGGTGGTCCCGCCCAGCTGG-3′; APO-Sp1/3mut, 5′- CCAGCTGTTCGGGACCACCAGGGGAGGGGC-3′ and 5′- GCCCCTCCCCTGGTGGTCCCGAACAGCTGG-3′ according to standard procedures. Nucleotides differing from the original promoter sequence are shown in bold type. A commercially available Sp1 probe (sc-2502, referred to as Sp1cons) was purchased from Santa Cruz Biotechnology. The double-stranded oligonucleotides were 5′ end-labeled using T4 polynucleotide kinase (New England Biolabs) and [γ-32P]ATP (3000 Ci/mmol, Amersham) and purified by using Nick G50 columns (Amersham).
For EMSA, 5 µg of nuclear proteins were preincubated on ice with 2 µg of poly(dI-dC) (Roche) as an unspecific competitor and 1 µg of bovine serum albumin in band shift buffer (50 mM Tris, 150 mM KCl, 5 mM EDTA, 2.5 mM dithiothreitol, 20% Ficoll) for 15 min. 32P-labeled oligonucleotides (50 000 c.p.m.) were added in a total volume of 20 µl, incubated on ice for 20 min and loaded onto 5% native polyacrylamide gels in 0.5×Tris-borate-EDTA buffer. Upon fractionation, gels were dried and exposed for autoradiography. For competition experiments, 1- or 30-fold molar excess of the unlabeled APO-Sp1/3 or APO-Sp1/3mut oligonucleotides was added to the preincubation mixture. For supershift experiments, 2 µg Sp1 antibody (sc-59x, Santa Cruz Biotechnology) or Sp3 antibody (sc-644x, Santa Cruz Biotechnology) were added to the preincubation mixture and preincubation time was extended to 30 min.

Chromatin immunoprecipitation (ChIP) assay
A3.01 cells were treated with RPMI culture medium containing 1% formaldehyde for 10 min. at 37°C. Cells were washed twice with ice-cold PBS and incubated for 10 min. on ice after resuspension in SDS lysis buffer (ChIP Assay Kit, Upstate). After centrifugation, pellets were resuspended in MNase reaction buffer (10 mM Tris-HCl pH 7.5, 10 mM NaCl, 3 mM MgCl2, 1 mM CaCl2, 4% NP-40). DNA digestion was performed using 50 U Micrococcal Nuclease (Fermentas) and 1 × 107 cells per tube in a volume of 1.5 ml. After 2 min, reaction was stopped by adding 30 µl 200 mM EGTA. Further steps were performed using the Chromatin Immunoprecipitation Assay Kit (Upstate) according to the manufacturer's instructions. 1 × 107 cells and 2 µg antibody (Sp1(Pep2) sc-59, Sp3(D-20) sc-644 or actin(H-196) sc-7210, Santa Cruz Biotechnology) were used for each immunoprecipitation. All buffers were freshly supplied with protease inhibitors. After phenol/chloroform extraction and ethanol precipitation, DNA was resolved in 16 µl H2O. Immunoprecipitated DNA was detected by nested PCR using 4 µl of the resolved DNA in the first PCR, and 1 µl for the nested PCR. For amplification of the A3G promoter, the following primers were used: ChIP3Gplus 5′-ccacggtggcctccgagggtga-3′ and ChIP3Gminus: 5′-ctctccaccatcaagacagac-3′ (1. PCR); ChIP3G2plus: 5′-tactctccctccctgtcccca-3′ and ChIP3G nested minus: 5′-aggctgatgcctccgcag-3′ (nested PCR). Taq polymerase (Qiagen) was used together with the following cycle conditions: one cycle 94°C for 2 min; 30 cycles 94°C for 30 s, 60°C for 60 s, 72°C for 2 min; one cycle 72°C for 10 min. As a negative control, a region in the A3G gene was targeted using the primers ChIP3Gneg_plus: 5′-taagtaccacccagagatgag-3′ and ChIP3Gneg_minus: 5′-catgatcttcatggtggcacg-3′ for both PCR steps. PCR conditions were the same as for the A3G promoter sequence, with the exception that annealing temperature was decreased to 55°C.

RNA interference and western blot analysis
Sp1 and Sp3 translation was silenced in HeLa cells using the siRNA duplexes Hs_SP1_1_HP and Hs_SP3_1_HP (Qiagen). A nonspecific siRNA (Qiagen) was used as control. HeLa cells were transfected with 150 or 300 ng siRNA per 6-well, using the HiPerfect transfection reagent (Qiagen) according to the manufacturer's protocol for reverse transfection of adherent cells in 6-well plates.
Forty-eight hours after transfection, HeLa cells were harvested for detection of Sp1 and Sp3 proteins. Cells were washed in PBS, lysed in RIPA (25 mM Tris pH 8.0, 137 mM NaCl, 1% Glycerol, 0.5% sodium deoxycholate, 1% NP-40, 2 mM EDTA pH 8, 0.1% SDS and protease inhibitors) and lysates were cleared by centrifugation. After boiling with Laemmli′s buffer, samples were subjected to SDS–polyacrylamide gel electrophoresis followed by transfer to a nitrocellulose membrane. Sp1 and Sp3 proteins were detected using α-Sp1(Pep2) antibody (sc-59, Santa Cruz) or α-Sp3(D-20) antibody (sc-644, Santa Cruz) followed by incubation with α-rabbit-HRP (Amersham Biosciences). For detection of tubulin, α-tubulin (B5-1-2, Sigma) and α-mouse-HRP (Amersham Biosciences) antibodies were used. Signals were visualized by enhanced chemiluminescence (ECL, Amersham Biosciences).