Analysis for tissue-specific recombination.
Genotype/tissue-specific recombination of the conditional allele was examined by both PCR and RT-PCR. DNA samples extracted from various tissues collected at the time of autopsy were examined by genotyping PCR as described. RNA extracted from various tissue homogenates in Trizol reagent were examined for expression of wild-type and truncated Apc alleles by SuperScript One-Step RT-PCR with Platinum Taq (Invitrogen, Carlsbad, California, United States), following manufacturer's protocol. Approximately 200 ng of total RNA from either skin, liver, or thymus from each genotype was reverse-transcribed using primers Apc-F546 (TGAGGAATTTGTCTTGGCGAG) and Apc-R721 (GCACTTCCCATGGCAATCATT), resulting in 528-bp and 313-bp products from the wild-type/ApcCKO alleles and ApcΔ580 allele, respectively.