Genomic DNA from tips of mouse tails obtained at ~10 d of age was genotyped in a single PCR reaction with the following primers: Apc-Int13F2 (GAGAAACCCTGTCTCGAAAAAA) and Apc-Int13R2 (AGTGCTGTTTCTATGAGTCAAC), resulting in 320-bp and 430-bp products from the wild-type and conditional ApcCKO allele, respectively. For the detection of Cre-mediated deleted Apc allele, ApcΔ580, the primer Apc-Int14R4 (TTGGCAGACTGTGTATATAAGC) in combination with Apc-Int13F2 resulted in 500-bp product. Primers Cre-F1 (TCCAATTTACTGACCGTACACC) and Cre-R1 (CCGACGATGAAGCATGTTTAG) were used for detection of cre transgene in the germline, resulting in 300-bp products. Amplification was performed in a 25-μl volume containing 15 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 0.2 mM dNTP, 0.2μM of each primer, and 1.25 U of AmpliTaq Gold (Applied Biosystems, Foster City, California, United States). The reactions were heated for 10 min at 94 °C to heat-activate the enzyme followed by 30 PCR cycles at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 45 s, followed by the final extension for 5 min at 72 °C.