Materials and Methods

Construction of targeting vectors.
To target the Apc locus, we obtained BAC clone RP23-233F17 that contains all the sequence of Apc except for the 5′ UTR and exon 1. Using a recombineering-based method for generating conditional mutations [12,13], subcloning of BAC and further modifications were conducted. The genomic sequence encompassing Apc exons 11 to 15 was first subcloned into pBR322 vector, and then a loxP site was introduced into intron 13 followed by loxP-FRT-PGKneor-FRT selection cassette into intron14 of the Apc gene (Figure 1A).

Generation of ApcCKO ES cells and mice.
The linearized targeting vectors were electroporated into 129/S-derived ES cells, WW6 cells [15]. All candidate G418-resistant ES clones were screened by long-range gene-specific PCR using Expand Long Template PCR System (Roche, Indianapolis, Indiana, United States), followed by sequencing to validate the correct insertion of the single loxP site and the selection cassette. Two ES clones with correct ApcCKON/+ modification were injected into C57BL/6J blastocysts, after which chimeric mice with high levels of ES cell contribution were backcrossed to C57BL/6J females to produce heterozygous F1 offspring. The genomic DNA samples obtained from the tail of F1 offspring were subsequently analyzed by Southern blot analysis to further confirm the correct homologous recombination. By crossing the heterozygous mice to FLPe deleter mice [34], PGKneor cassette was deleted in the germline by FRT-mediated recombination to generate mice with the final ApcCKO allele. ApcCKO heterozygous mice were crossed together to generate homozygous mice, and the homozygous offspring were interbred for maintenance.

Generation of ApcΔ580 mice.
ApcCKO heterozygote mice were crossed with Cre deleter mice, EIIA-cre transgenic mice that express Cre in early embryo [35], to knockout the Apc allele in the germline, consequently creating a knockout strain (Figure 1A). The resultant ApcΔ580/+ mice were maintained by backcrossing to C57BL/6J females.

Generation of K14-cre; ApcCKO/CKO mice.
The mice analyzed in this study were generated by crossing ApcCKO heterozygote mice of the F1 generation (C57BL/6J × 129/S background) with K14-cre transgenic mice (FVB background). K14-cre; ApcCKO/+ male mice thus generated were then crossed with ApcCKO/CKO females to generate homozygous and heterozygous ApcCKO offspring either with or without K14-cre. The mice were intercrossed thereafter for maintenance.

Genotyping of mice.
Genomic DNA from tips of mouse tails obtained at ~10 d of age was genotyped in a single PCR reaction with the following primers: Apc-Int13F2 (GAGAAACCCTGTCTCGAAAAAA) and Apc-Int13R2 (AGTGCTGTTTCTATGAGTCAAC), resulting in 320-bp and 430-bp products from the wild-type and conditional ApcCKO allele, respectively. For the detection of Cre-mediated deleted Apc allele, ApcΔ580, the primer Apc-Int14R4 (TTGGCAGACTGTGTATATAAGC) in combination with Apc-Int13F2 resulted in 500-bp product. Primers Cre-F1 (TCCAATTTACTGACCGTACACC) and Cre-R1 (CCGACGATGAAGCATGTTTAG) were used for detection of cre transgene in the germline, resulting in 300-bp products. Amplification was performed in a 25-μl volume containing 15 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 0.2 mM dNTP, 0.2μM of each primer, and 1.25 U of AmpliTaq Gold (Applied Biosystems, Foster City, California, United States). The reactions were heated for 10 min at 94 °C to heat-activate the enzyme followed by 30 PCR cycles at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 45 s, followed by the final extension for 5 min at 72 °C.

Skin permeability assay.
Unfixed and freshly isolated E18.5 embryos were rinsed in PBS and then submerged in X-gal reaction mix at pH 4.5 (100 mM NaPO4, 1.3 mM MgCl2, 3 mM K3Fe(CN)6, 3 mM K4Fe(CN)6, and 1 mg/ml X-gal) at room temperature overnight [36]. At this pH in the absence of epidermal barrier, the solution penetrates epidermis and an endogenous β-galactosidase–like activity catalyzes production of a blue precipitate. After staining, embryos were washed twice in PBS, fixed overnight at 4 °C in 4% paraformaldehyde, and were photographed using a 35 mm Nikon digital camera.

Skeletal preparations.
The skinned and eviscerated bodies of the oldest surviving KA mutants (P16–P17) and their age-matched littermates were placed into 1% potassium hydroxide (KOH) for 5 d. The bodies were transferred into a fresh solution of 1% KOH containing a few drops of 0.5% alizarin red S (Sigma, St. Louis, Missouri, United States) and left for another 5 d. The stained bodies were stored in glycerin and viewed under a dissection microscope.

Analysis for tissue-specific recombination.
Genotype/tissue-specific recombination of the conditional allele was examined by both PCR and RT-PCR. DNA samples extracted from various tissues collected at the time of autopsy were examined by genotyping PCR as described. RNA extracted from various tissue homogenates in Trizol reagent were examined for expression of wild-type and truncated Apc alleles by SuperScript One-Step RT-PCR with Platinum Taq (Invitrogen, Carlsbad, California, United States), following manufacturer's protocol. Approximately 200 ng of total RNA from either skin, liver, or thymus from each genotype was reverse-transcribed using primers Apc-F546 (TGAGGAATTTGTCTTGGCGAG) and Apc-R721 (GCACTTCCCATGGCAATCATT), resulting in 528-bp and 313-bp products from the wild-type/ApcCKO alleles and ApcΔ580 allele, respectively.

BrdU labeling.
Mice were injected intraperitoneally with approximately 50 μg/g body weight of BrdU (Sigma) dissolved in PBS 2 h before their death. Tissue samples were fixed in Bouin's and processed as described below.

Histological and immunochemical analysis.
Mutant mice and age-matching littermates were humanely killed at various ages by CO2 inhalation. Mice were skinned and pieces of skin were either snap-frozen in liquid nitrogen or immediately homogenized in Trizol reagent and stored at −80 °C until molecular analysis, or fixed flat on a piece of paper towel in Bouin's solution for histological and immunohistochemical examinations. The mice were then dissected for gross examination, various tissues were similarly collected for future molecular analyses, and then the whole body was fixed in Bouin's solution. The samples were then submitted to Rodent Histopathological Core for processing and histopathological examinations.
For immunohistochemistry, 5-μm paraffin-embedded tissue sections were deparafinized in xylene, followed by alcohol rehydration. After quenching endogenous peroxidases in 3% H2O2 in methanol, the slides were rinsed in distilled water, and an antigen retrieval step was carried out in a microwave oven for a total of 10 min in preheated citrate buffer (pH 6.0). The slides were then incubated with primary antibodies at room temperature overnight. Antibodies used were β-catenin (BD Transduction Lab, San Diego, California, United States), keratins 1, 5, 6, 14, involucrin, loricrin (Covance, Berkeley, California, United States), keratin 8 (Abcam, Cambridge, United Kingdom), Ki67 (Vector Laboratories, Burlingame, California, United States) and BrdU (Roche). Biotinylated secondary antibodies (donkey anti-rabbit and goat anti-mouse IgG, 1:250; Jackson ImmunoResearch, West Grove, Pennsylvania, United States), followed by the Vectastain Elite ABC kit (Vector Laboratories) were used for detection. The slides were stained with DAB and counterstained with Mayer's hematoxylin.

In situ hybridization.
Section ISH using rat Shh probe [37] and whole-mount ISH using β-catenin probe [38] were performed as previously described [39,40]. Riboprobes labeled with DIG were detected with BM purple AP substrate precipitation solution (Roche).