MMU2 congenic mice were genotyped for hg using a two primer genotyping assay. One primer set (HG-F, ctcctgtctgggctgtgag and HG-R, caaaggcagaagtggggtaa) spanned the hg deletion producing a 447 bp product in hg/hg and +/hg mice. The other set (CRADD3a.F, gtccatcagcattcctgaaa and CRADD3.R, tgtccagcaacagcattgtc) amplified a 232 bp Cradd amplicon (located within the hg deletion) in +/+ and +/hg mice [54]. The PCR annealing temperature was 55°C and the MgCl2 concentration was 1.5 mM.