Genotyping
DNA for genotyping was isolated from 1.0–2.0 mm tail clips by digesting with Proteinase K (Fisher) at 55°C in a buffer composed of 0.45% NP40 (Sigma), 0.45% Tween 20 (Fisher) and 1X PCR buffer (Promega). The product of this digestion was diluted (1:10) in sterile H2O and used for genotyping without further purification. Microsatellite genotyping was performed using standard PCR and gel electrophoresis protocols. Reaction conditions for each marker are listed in Additional File 1 and 2.
MMU2 congenic mice were genotyped for hg using a two primer genotyping assay. One primer set (HG-F, ctcctgtctgggctgtgag and HG-R, caaaggcagaagtggggtaa) spanned the hg deletion producing a 447 bp product in hg/hg and +/hg mice. The other set (CRADD3a.F, gtccatcagcattcctgaaa and CRADD3.R, tgtccagcaacagcattgtc) amplified a 232 bp Cradd amplicon (located within the hg deletion) in +/+ and +/hg mice [54]. The PCR annealing temperature was 55°C and the MgCl2 concentration was 1.5 mM.