PMC:1359074 / 42637-44136
Annnotations
2_test
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
16462943-15302897-85761030 | 37-39 | 15302897 | denotes | 53 |
T20377 | 37-39 | 15302897 | denotes | 53 |
pmc-enju-pas
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20665 | 1495-1498 | NN | denotes | min |
T20664 | 1493-1494 | CD | denotes | 5 |
T20663 | 1489-1492 | IN | denotes | for |
T20662 | 1486-1488 | NN | denotes | °C |
T20661 | 1483-1485 | CD | denotes | 72 |
T20660 | 1480-1482 | IN | denotes | at |
T20659 | 1470-1479 | NN | denotes | extension |
T20658 | 1464-1469 | JJ | denotes | final |
T20657 | 1462-1463 | DT | denotes | a |
T20656 | 1457-1461 | IN | denotes | with |
T20655 | 1450-1456 | VB | denotes | ending |
T20654 | 1448-1449 | -COMMA- | denotes | , |
T20653 | 1447-1448 | NN | denotes | s |
T20652 | 1444-1446 | CD | denotes | 45 |
T20651 | 1440-1443 | IN | denotes | for |
T20650 | 1437-1439 | NN | denotes | °C |
T20649 | 1434-1436 | CD | denotes | 72 |
T20648 | 1430-1433 | CC | denotes | and |
T20647 | 1428-1429 | -COMMA- | denotes | , |
T20646 | 1427-1428 | NN | denotes | s |
T20645 | 1424-1426 | CD | denotes | 30 |
T20644 | 1420-1423 | IN | denotes | for |
T20643 | 1417-1419 | NN | denotes | °C |
T20642 | 1414-1416 | CD | denotes | 60 |
T20641 | 1412-1413 | -COMMA- | denotes | , |
T20640 | 1411-1412 | NN | denotes | s |
T20639 | 1408-1410 | CD | denotes | 30 |
T20638 | 1404-1407 | IN | denotes | for |
T20637 | 1401-1403 | NN | denotes | °C |
T20636 | 1398-1400 | CD | denotes | 95 |
T20635 | 1395-1397 | IN | denotes | at |
T20634 | 1388-1394 | NN | denotes | cycles |
T20633 | 1385-1387 | CD | denotes | 30 |
T20632 | 1382-1384 | IN | denotes | by |
T20631 | 1373-1381 | VB | denotes | followed |
T20630 | 1369-1372 | NN | denotes | min |
T20629 | 1366-1368 | CD | denotes | 15 |
T20628 | 1362-1365 | IN | denotes | for |
T20627 | 1359-1361 | NN | denotes | °C |
T20626 | 1356-1358 | CD | denotes | 95 |
T20625 | 1354-1355 | -COLON- | denotes | : |
T20624 | 1344-1354 | NN | denotes | conditions |
T20623 | 1334-1343 | JJ | denotes | following |
T20622 | 1330-1333 | DT | denotes | the |
T20621 | 1324-1329 | IN | denotes | under |
T20620 | 1314-1323 | VB | denotes | performed |
T20619 | 1310-1313 | VB | denotes | was |
T20618 | 1306-1309 | NN | denotes | PCR |
T20617 | 1303-1304 | -RRB- | denotes | ) |
T20616 | 1279-1303 | NN | denotes | 5′GCTTCACCACCAACCTCTTC3′ |
T20615 | 1277-1278 | -COMMA- | denotes | , |
T20614 | 1270-1277 | NN | denotes | MHB1689 |
T20613 | 1266-1269 | CC | denotes | and |
T20612 | 1264-1265 | -COLON- | denotes | ; |
T20611 | 1240-1264 | NN | denotes | 5′CGAAGAATAAAAGGCCACCA3′ |
T20610 | 1238-1239 | -COMMA- | denotes | , |
T20609 | 1231-1238 | NN | denotes | MHB1688 |
T20608 | 1223-1230 | NN | denotes | primers |
T20607 | 1222-1223 | -LRB- | denotes | ( |
T20606 | 1213-1221 | NN | denotes | promoter |
T20605 | 1210-1212 | JJ | denotes | ɛy |
T20604 | 1206-1209 | DT | denotes | the |
T20603 | 1203-1205 | IN | denotes | of |
T20602 | 1198-1202 | CD | denotes | +140 |
T20601 | 1195-1197 | TO | denotes | to |
T20600 | 1191-1194 | CD | denotes | −31 |
T20599 | 1179-1190 | NN | denotes | nucleotides |
T20598 | 1176-1178 | TO | denotes | to |
T20597 | 1162-1175 | VB | denotes | corresponding |
T20596 | 1160-1161 | -COMMA- | denotes | , |
T20595 | 1152-1160 | NN | denotes | amplicon |
T20594 | 1145-1151 | JJ | denotes | 172-bp |
T20593 | 1143-1144 | DT | denotes | a |
T20592 | 1135-1142 | VB | denotes | yielded |
T20591 | 1131-1134 | CC | denotes | and |
T20590 | 1121-1130 | VB | denotes | performed |
T20589 | 1117-1120 | VB | denotes | was |
T20588 | 1108-1116 | NN | denotes | promoter |
T20587 | 1105-1107 | JJ | denotes | ɛy |
T20586 | 1101-1104 | DT | denotes | the |
T20585 | 1098-1100 | IN | denotes | of |
T20584 | 1084-1097 | NN | denotes | amplification |
T20583 | 1080-1083 | NN | denotes | PCR |
T20582 | 1070-1078 | NN | denotes | reaction |
T20581 | 1066-1069 | NN | denotes | PCR |
T20580 | 1062-1065 | DT | denotes | the |
T20579 | 1059-1061 | IN | denotes | in |
T20578 | 1050-1058 | NN | denotes | template |
T20577 | 1048-1049 | DT | denotes | a |
T20576 | 1045-1047 | IN | denotes | as |
T20575 | 1040-1044 | VB | denotes | used |
T20574 | 1036-1039 | VB | denotes | was |
T20573 | 1032-1035 | NN | denotes | DNA |
T20572 | 1013-1031 | VB | denotes | immunoprecipitated |
T20571 | 1010-1012 | CC | denotes | or |
T20570 | 1006-1009 | NN | denotes | DNA |
T20569 | 1000-1005 | NN | denotes | Input |
T20568 | 997-998 | NN | denotes | h |
T20567 | 995-996 | CD | denotes | 4 |
T20566 | 991-994 | IN | denotes | for |
T20565 | 988-990 | NN | denotes | °C |
T20564 | 985-987 | CD | denotes | 65 |
T20563 | 982-984 | IN | denotes | at |
T20562 | 977-981 | NN | denotes | NaCl |
T20561 | 975-976 | NN | denotes | M |
T20560 | 973-974 | CD | denotes | 5 |
T20559 | 968-972 | IN | denotes | with |
T20558 | 959-967 | VB | denotes | reversed |
T20557 | 954-958 | VB | denotes | were |
T20556 | 942-953 | NN | denotes | cross-links |
T20555 | 934-941 | NN | denotes | protein |
T20554 | 930-933 | NN | denotes | DNA |
T20553 | 926-929 | DT | denotes | the |
T20552 | 922-925 | CC | denotes | and |
T20551 | 920-921 | -COMMA- | denotes | , |
T20550 | 914-920 | VB | denotes | eluted |
T20549 | 909-913 | VB | denotes | were |
T20548 | 899-908 | NN | denotes | complexes |
T20547 | 880-898 | NN | denotes | chromatin-antibody |
T20546 | 876-879 | DT | denotes | The |
T20545 | 866-874 | NN | denotes | controls |
T20544 | 857-865 | JJ | denotes | negative |
T20543 | 854-856 | IN | denotes | as |
T20542 | 849-853 | VB | denotes | used |
T20541 | 844-848 | VB | denotes | were |
T20540 | 840-843 | CD | denotes | two |
T20539 | 835-839 | JJ | denotes | last |
T20538 | 831-834 | DT | denotes | The |
T20537 | 827-830 | NNP | denotes | Ab. |
T20536 | 819-826 | IN | denotes | without |
T20535 | 812-818 | NN | denotes | sample |
T20534 | 806-811 | JJ | denotes | third |
T20533 | 802-805 | DT | denotes | the |
T20532 | 798-801 | CC | denotes | and |
T20531 | 796-797 | -COMMA- | denotes | , |
T20530 | 793-796 | NN | denotes | IgG |
T20529 | 786-792 | NN | denotes | rabbit |
T20528 | 779-785 | JJ | denotes | normal |
T20527 | 774-778 | IN | denotes | with |
T20526 | 766-773 | VB | denotes | treated |
T20525 | 759-765 | JJ | denotes | second |
T20524 | 757-758 | DT | denotes | a |
T20523 | 755-756 | -COMMA- | denotes | , |
T20522 | 746-755 | NN | denotes | anti-Sox6 |
T20521 | 741-745 | IN | denotes | with |
T20520 | 733-740 | VB | denotes | treated |
T20519 | 726-732 | NN | denotes | sample |
T20518 | 722-725 | CD | denotes | one |
T20517 | 720-721 | -COLON- | denotes | : |
T20516 | 714-720 | NN | denotes | thirds |
T20515 | 709-713 | IN | denotes | into |
T20514 | 703-708 | VB | denotes | split |
T20513 | 698-702 | VB | denotes | were |
T20512 | 690-697 | NN | denotes | samples |
T20511 | 686-689 | DT | denotes | the |
T20510 | 684-685 | -COMMA- | denotes | , |
T20509 | 673-684 | NN | denotes | preclearing |
T20508 | 663-672 | VB | denotes | Following |
T20507 | 660-661 | -RRB- | denotes | ) |
T20506 | 654-660 | NNP | denotes | States |
T20505 | 647-653 | NNP | denotes | United |
T20504 | 645-646 | -COMMA- | denotes | , |
T20503 | 639-645 | NNP | denotes | Jersey |
T20502 | 635-638 | NNP | denotes | New |
T20501 | 633-634 | -COMMA- | denotes | , |
T20500 | 623-633 | NNP | denotes | Piscataway |
T20499 | 621-622 | -COMMA- | denotes | , |
T20498 | 610-621 | NNP | denotes | Biosciences |
T20497 | 601-609 | NNP | denotes | Amersham |
T20496 | 600-601 | -LRB- | denotes | ( |
T20495 | 588-599 | NN | denotes | A-Sepharose |
T20494 | 580-587 | NN | denotes | protein |
T20493 | 575-579 | IN | denotes | with |
T20492 | 564-574 | VB | denotes | precleared |
T20491 | 560-563 | VB | denotes | was |
T20490 | 553-559 | NN | denotes | sample |
T20489 | 543-552 | VB | denotes | remaining |
T20488 | 539-542 | DT | denotes | the |
T20487 | 535-538 | CC | denotes | and |
T20486 | 533-534 | -COMMA- | denotes | , |
T20485 | 526-533 | NN | denotes | control |
T20484 | 520-525 | NN | denotes | input |
T20483 | 516-519 | IN | denotes | for |
T20482 | 510-515 | RB | denotes | aside |
T20481 | 506-509 | VB | denotes | set |
T20480 | 502-505 | VB | denotes | was |
T20479 | 495-501 | NN | denotes | sample |
T20478 | 491-494 | DT | denotes | the |
T20477 | 488-490 | IN | denotes | of |
T20476 | 478-487 | NN | denotes | One-tenth |
T20475 | 474-476 | NN | denotes | bp |
T20474 | 470-473 | CD | denotes | 600 |
T20473 | 466-469 | CC | denotes | and |
T20472 | 462-465 | CD | denotes | 200 |
T20471 | 459-461 | TO | denotes | to |
T20470 | 449-458 | VB | denotes | sonicated |
T20469 | 444-448 | VB | denotes | were |
T20468 | 434-443 | NN | denotes | complexes |
T20467 | 422-433 | JJ | denotes | DNA-protein |
T20466 | 417-420 | NN | denotes | min |
T20465 | 414-416 | CD | denotes | 10 |
T20464 | 410-413 | IN | denotes | for |
T20463 | 406-409 | NN | denotes | ice |
T20462 | 403-405 | IN | denotes | on |
T20461 | 393-402 | VB | denotes | incubated |
T20460 | 389-392 | CC | denotes | and |
T20459 | 387-388 | -COMMA- | denotes | , |
T20458 | 377-387 | NN | denotes | inhibitors |
T20457 | 368-376 | NN | denotes | protease |
T20456 | 357-367 | VB | denotes | containing |
T20455 | 350-356 | NN | denotes | buffer |
T20454 | 344-349 | NN | denotes | lysis |
T20453 | 340-343 | NN | denotes | SDS |
T20452 | 338-339 | DT | denotes | a |
T20451 | 335-337 | IN | denotes | in |
T20450 | 323-334 | VB | denotes | resuspended |
T20449 | 321-322 | -COMMA- | denotes | , |
T20448 | 319-321 | NN | denotes | °C |
T20447 | 317-318 | CD | denotes | 4 |
T20446 | 314-316 | IN | denotes | at |
T20445 | 299-313 | NN | denotes | centrifugation |
T20444 | 296-298 | IN | denotes | by |
T20443 | 286-295 | VB | denotes | collected |
T20442 | 284-285 | -COMMA- | denotes | , |
T20441 | 274-284 | NN | denotes | inhibitors |
T20440 | 265-273 | NN | denotes | protease |
T20439 | 254-264 | VB | denotes | containing |
T20438 | 249-253 | NN | denotes | EDTA |
T20437 | 247-248 | NN | denotes | % |
T20436 | 244-247 | CD | denotes | 0.1 |
T20435 | 239-243 | IN | denotes | with |
T20434 | 230-238 | NN | denotes | solution |
T20433 | 225-229 | NN | denotes | salt |
T20432 | 216-224 | JJ | denotes | balanced |
T20431 | 214-215 | POS | denotes | ' |
T20430 | 209-214 | NNP | denotes | Hanks |
T20429 | 206-208 | CD | denotes | 1× |
T20428 | 197-205 | JJ | denotes | ice-cold |
T20427 | 194-196 | IN | denotes | in |
T20426 | 187-193 | VB | denotes | rinsed |
T20425 | 185-186 | -COMMA- | denotes | , |
T20424 | 183-185 | NN | denotes | °C |
T20423 | 180-182 | CD | denotes | 37 |
T20422 | 177-179 | IN | denotes | at |
T20421 | 173-176 | NN | denotes | min |
T20420 | 170-172 | CD | denotes | 10 |
T20419 | 166-169 | IN | denotes | for |
T20418 | 153-165 | NN | denotes | formaldehyde |
T20417 | 151-152 | NN | denotes | % |
T20416 | 150-151 | CD | denotes | 1 |
T20415 | 145-149 | IN | denotes | with |
T20414 | 137-144 | VB | denotes | treated |
T20413 | 132-136 | VB | denotes | were |
T20412 | 127-131 | NN | denotes | mice |
T20411 | 124-126 | JJ | denotes | WT |
T20410 | 115-123 | JJ | denotes | 15.5-dpc |
T20409 | 109-114 | CD | denotes | three |
T20408 | 104-108 | IN | denotes | from |
T20407 | 98-103 | NN | denotes | cells |
T20406 | 92-97 | NN | denotes | liver |
T20405 | 86-91 | JJ | denotes | fetal |
T20404 | 83-85 | CC | denotes | or |
T20403 | 81-82 | -RRB- | denotes | ) |
T20402 | 78-81 | CD | denotes | 107 |
T20401 | 76-77 | NN | denotes | × |
T20400 | 74-75 | CD | denotes | 4 |
T20399 | 73-74 | -LRB- | denotes | ( |
T20398 | 67-72 | NN | denotes | cells |
T20397 | 63-66 | NN | denotes | MEL |
T20396 | 58-62 | IN | denotes | from |
T20395 | 52-57 | NN | denotes | Cells |
T20394 | 50-51 | -COLON- | denotes | : |
T20393 | 45-50 | NN | denotes | brief |
T20392 | 42-44 | IN | denotes | in |
T20391 | 40-41 | -COMMA- | denotes | , |
T20390 | 39-40 | -RRB- | denotes | ] |
T20389 | 37-39 | CD | denotes | 53 |
T20388 | 36-37 | -LRB- | denotes | [ |
T20387 | 28-35 | NNP | denotes | Nouzova |
T20386 | 25-27 | IN | denotes | by |
T20385 | 15-24 | VB | denotes | described |
T20384 | 12-14 | IN | denotes | As |
T20383 | 5-10 | NN | denotes | assay |
T20382 | 0-4 | NN | denotes | ChIP |
R14488 | T20383 | T20382 | arg1Of | assay,ChIP |
R14489 | T20385 | T20384 | arg2Of | described,As |
R14490 | T20387 | T20385 | arg1Of | Nouzova,described |
R14491 | T20387 | T20386 | arg2Of | Nouzova,by |
R14492 | T20387 | T20388 | arg1Of | Nouzova,[ |
R14493 | T20387 | T20391 | arg1Of | Nouzova,"," |
R14494 | T20387 | T20392 | arg1Of | Nouzova,in |
R14495 | T20387 | T20394 | arg1Of | Nouzova,: |
R14496 | T20389 | T20388 | arg2Of | 53,[ |
R14497 | T20390 | T20388 | arg3Of | ],[ |
R14498 | T20393 | T20392 | arg2Of | brief,in |
R14499 | T20395 | T20396 | arg1Of | Cells,from |
R14500 | T20395 | T20413 | arg1Of | Cells,were |
R14501 | T20395 | T20414 | arg2Of | Cells,treated |
R14502 | T20398 | T20397 | arg1Of | cells,MEL |
R14503 | T20398 | T20399 | arg1Of | cells,( |
R14504 | T20398 | T20404 | arg1Of | cells,or |
R14505 | T20401 | T20399 | arg2Of | ×,( |
R14506 | T20401 | T20400 | arg1Of | ×,4 |
R14507 | T20401 | T20402 | arg1Of | ×,107 |
R14508 | T20403 | T20399 | arg3Of | ),( |
R14509 | T20404 | T20396 | arg2Of | or,from |
R14510 | T20407 | T20404 | arg2Of | cells,or |
R14511 | T20407 | T20405 | arg1Of | cells,fetal |
R14512 | T20407 | T20406 | arg1Of | cells,liver |
R14513 | T20407 | T20408 | arg1Of | cells,from |
R14514 | T20412 | T20408 | arg2Of | mice,from |
R14515 | T20412 | T20409 | arg1Of | mice,three |
R14516 | T20412 | T20410 | arg1Of | mice,15.5-dpc |
R14517 | T20412 | T20411 | arg1Of | mice,WT |
R14518 | T20414 | T20413 | arg2Of | treated,were |
R14519 | T20414 | T20415 | arg1Of | treated,with |
R14520 | T20416 | T20417 | arg1Of | 1,% |
R14521 | T20418 | T20415 | arg2Of | formaldehyde,with |
R14522 | T20418 | T20416 | arg1Of | formaldehyde,1 |
R14523 | T20418 | T20419 | arg1Of | formaldehyde,for |
R14524 | T20421 | T20419 | arg2Of | min,for |
R14525 | T20421 | T20420 | arg1Of | min,10 |
R14526 | T20421 | T20422 | arg1Of | min,at |
R14527 | T20421 | T20425 | arg1Of | min,"," |
R14528 | T20421 | T20426 | arg2Of | min,rinsed |
R14529 | T20421 | T20435 | arg1Of | min,with |
R14530 | T20424 | T20422 | arg2Of | °C,at |
R14531 | T20424 | T20423 | arg1Of | °C,37 |
R14532 | T20426 | T20427 | arg1Of | rinsed,in |
R14533 | T20430 | T20431 | arg2Of | Hanks,' |
R14534 | T20434 | T20427 | arg2Of | solution,in |
R14535 | T20434 | T20428 | arg1Of | solution,ice-cold |
R14536 | T20434 | T20429 | arg1Of | solution,1× |
R14537 | T20434 | T20431 | arg1Of | solution,' |
R14538 | T20434 | T20432 | arg1Of | solution,balanced |
R14539 | T20434 | T20433 | arg1Of | solution,salt |
R14540 | T20436 | T20437 | arg1Of | 0.1,% |
R14541 | T20438 | T20435 | arg2Of | EDTA,with |
R14542 | T20438 | T20436 | arg1Of | EDTA,0.1 |
R14543 | T20438 | T20439 | arg1Of | EDTA,containing |
R14544 | T20441 | T20439 | arg2Of | inhibitors,containing |
R14545 | T20441 | T20440 | arg1Of | inhibitors,protease |
R14546 | T20441 | T20442 | arg1Of | inhibitors,"," |
R14547 | T20441 | T20443 | arg2Of | inhibitors,collected |
R14548 | T20441 | T20450 | arg2Of | inhibitors,resuspended |
R14549 | T20441 | T20461 | arg2Of | inhibitors,incubated |
R14550 | T20445 | T20443 | arg1Of | centrifugation,collected |
R14551 | T20445 | T20444 | arg2Of | centrifugation,by |
R14552 | T20445 | T20446 | arg1Of | centrifugation,at |
R14553 | T20448 | T20446 | arg2Of | °C,at |
R14554 | T20448 | T20447 | arg1Of | °C,4 |
R14555 | T20450 | T20451 | arg1Of | resuspended,in |
R14556 | T20450 | T20460 | arg1Of | resuspended,and |
R14557 | T20455 | T20451 | arg2Of | buffer,in |
R14558 | T20455 | T20452 | arg1Of | buffer,a |
R14559 | T20455 | T20453 | arg1Of | buffer,SDS |
R14560 | T20455 | T20454 | arg1Of | buffer,lysis |
R14561 | T20455 | T20456 | arg1Of | buffer,containing |
R14562 | T20458 | T20456 | arg2Of | inhibitors,containing |
R14563 | T20458 | T20457 | arg1Of | inhibitors,protease |
R14564 | T20460 | T20449 | arg1Of | and,"," |
R14565 | T20460 | T20459 | arg1Of | and,"," |
R14566 | T20461 | T20460 | arg2Of | incubated,and |
R14567 | T20461 | T20462 | arg1Of | incubated,on |
R14568 | T20461 | T20464 | arg1Of | incubated,for |
R14569 | T20463 | T20462 | arg2Of | ice,on |
R14570 | T20466 | T20464 | arg2Of | min,for |
R14571 | T20466 | T20465 | arg1Of | min,10 |
R14572 | T20468 | T20467 | arg1Of | complexes,DNA-protein |
R14573 | T20468 | T20469 | arg1Of | complexes,were |
R14574 | T20468 | T20470 | arg2Of | complexes,sonicated |
R14575 | T20470 | T20469 | arg2Of | sonicated,were |
R14576 | T20470 | T20471 | arg1Of | sonicated,to |
R14577 | T20472 | T20473 | arg1Of | 200,and |
R14578 | T20474 | T20473 | arg2Of | 600,and |
R14579 | T20475 | T20471 | arg2Of | bp,to |
R14580 | T20475 | T20472 | arg1Of | bp,200 |
R14581 | T20475 | T20474 | arg1Of | bp,600 |
R14582 | T20476 | T20477 | arg1Of | One-tenth,of |
R14583 | T20476 | T20480 | arg1Of | One-tenth,was |
R14584 | T20476 | T20481 | arg2Of | One-tenth,set |
R14585 | T20479 | T20477 | arg2Of | sample,of |
R14586 | T20479 | T20478 | arg1Of | sample,the |
R14587 | T20481 | T20480 | arg2Of | set,was |
R14588 | T20481 | T20482 | arg1Of | set,aside |
R14589 | T20481 | T20483 | arg1Of | set,for |
R14590 | T20481 | T20487 | arg1Of | set,and |
R14591 | T20485 | T20483 | arg2Of | control,for |
R14592 | T20485 | T20484 | arg1Of | control,input |
R14593 | T20487 | T20486 | arg1Of | and,"," |
R14594 | T20487 | T20496 | arg1Of | and,( |
R14595 | T20490 | T20488 | arg1Of | sample,the |
R14596 | T20490 | T20489 | arg1Of | sample,remaining |
R14597 | T20490 | T20491 | arg1Of | sample,was |
R14598 | T20490 | T20492 | arg2Of | sample,precleared |
R14599 | T20492 | T20487 | arg2Of | precleared,and |
R14600 | T20492 | T20491 | arg2Of | precleared,was |
R14601 | T20492 | T20493 | arg1Of | precleared,with |
R14602 | T20495 | T20493 | arg2Of | A-Sepharose,with |
R14603 | T20495 | T20494 | arg1Of | A-Sepharose,protein |
R14604 | T20498 | T20497 | arg1Of | Biosciences,Amersham |
R14605 | T20498 | T20499 | arg1Of | Biosciences,"," |
R14606 | T20499 | T20501 | arg1Of | ",","," |
R14607 | T20500 | T20499 | arg2Of | Piscataway,"," |
R14608 | T20501 | T20504 | arg1Of | ",","," |
R14609 | T20503 | T20501 | arg2Of | Jersey,"," |
R14610 | T20503 | T20502 | arg1Of | Jersey,New |
R14611 | T20504 | T20496 | arg2Of | ",",( |
R14612 | T20506 | T20504 | arg2Of | States,"," |
R14613 | T20506 | T20505 | arg1Of | States,United |
R14614 | T20507 | T20496 | arg3Of | ),( |
R14615 | T20509 | T20508 | arg2Of | preclearing,Following |
R14616 | T20512 | T20511 | arg1Of | samples,the |
R14617 | T20512 | T20513 | arg1Of | samples,were |
R14618 | T20512 | T20514 | arg2Of | samples,split |
R14619 | T20514 | T20513 | arg2Of | split,were |
R14620 | T20514 | T20515 | arg1Of | split,into |
R14621 | T20514 | T20532 | arg1Of | split,and |
R14622 | T20516 | T20515 | arg2Of | thirds,into |
R14623 | T20516 | T20517 | arg1Of | thirds,: |
R14624 | T20519 | T20517 | arg2Of | sample,: |
R14625 | T20519 | T20518 | arg1Of | sample,one |
R14626 | T20519 | T20520 | arg2Of | sample,treated |
R14627 | T20520 | T20521 | arg1Of | treated,with |
R14628 | T20522 | T20521 | arg2Of | anti-Sox6,with |
R14629 | T20522 | T20523 | arg1Of | anti-Sox6,"," |
R14630 | T20525 | T20523 | arg2Of | second,"," |
R14631 | T20525 | T20524 | arg1Of | second,a |
R14632 | T20525 | T20526 | arg2Of | second,treated |
R14633 | T20526 | T20527 | arg1Of | treated,with |
R14634 | T20530 | T20527 | arg2Of | IgG,with |
R14635 | T20530 | T20528 | arg1Of | IgG,normal |
R14636 | T20530 | T20529 | arg1Of | IgG,rabbit |
R14637 | T20532 | T20508 | arg1Of | and,Following |
R14638 | T20532 | T20510 | arg1Of | and,"," |
R14639 | T20532 | T20531 | arg1Of | and,"," |
R14640 | T20535 | T20533 | arg1Of | sample,the |
R14641 | T20535 | T20534 | arg1Of | sample,third |
R14642 | T20535 | T20536 | arg1Of | sample,without |
R14643 | T20535 | T20541 | arg1Of | sample,were |
R14644 | T20535 | T20542 | arg2Of | sample,used |
R14645 | T20540 | T20536 | arg2Of | two,without |
R14646 | T20540 | T20537 | arg1Of | two,Ab. |
R14647 | T20540 | T20538 | arg1Of | two,The |
R14648 | T20540 | T20539 | arg1Of | two,last |
R14649 | T20542 | T20532 | arg2Of | used,and |
R14650 | T20542 | T20541 | arg2Of | used,were |
R14651 | T20542 | T20543 | arg1Of | used,as |
R14652 | T20545 | T20543 | arg2Of | controls,as |
R14653 | T20545 | T20544 | arg1Of | controls,negative |
R14654 | T20548 | T20546 | arg1Of | complexes,The |
R14655 | T20548 | T20547 | arg1Of | complexes,chromatin-antibody |
R14656 | T20548 | T20549 | arg1Of | complexes,were |
R14657 | T20548 | T20550 | arg2Of | complexes,eluted |
R14658 | T20550 | T20549 | arg2Of | eluted,were |
R14659 | T20550 | T20552 | arg1Of | eluted,and |
R14660 | T20552 | T20551 | arg1Of | and,"," |
R14661 | T20556 | T20553 | arg1Of | cross-links,the |
R14662 | T20556 | T20554 | arg1Of | cross-links,DNA |
R14663 | T20556 | T20555 | arg1Of | cross-links,protein |
R14664 | T20556 | T20557 | arg1Of | cross-links,were |
R14665 | T20556 | T20558 | arg2Of | cross-links,reversed |
R14666 | T20558 | T20552 | arg2Of | reversed,and |
R14667 | T20558 | T20557 | arg2Of | reversed,were |
R14668 | T20558 | T20559 | arg1Of | reversed,with |
R14669 | T20558 | T20563 | arg1Of | reversed,at |
R14670 | T20560 | T20561 | arg1Of | 5,M |
R14671 | T20562 | T20559 | arg2Of | NaCl,with |
R14672 | T20562 | T20560 | arg1Of | NaCl,5 |
R14673 | T20565 | T20563 | arg2Of | °C,at |
R14674 | T20565 | T20564 | arg1Of | °C,65 |
R14675 | T20565 | T20566 | arg1Of | °C,for |
R14676 | T20568 | T20566 | arg2Of | h,for |
R14677 | T20568 | T20567 | arg1Of | h,4 |
R14678 | T20570 | T20569 | arg1Of | DNA,Input |
R14679 | T20570 | T20571 | arg1Of | DNA,or |
R14680 | T20571 | T20574 | arg1Of | or,was |
R14681 | T20571 | T20575 | arg2Of | or,used |
R14682 | T20573 | T20571 | arg2Of | DNA,or |
R14683 | T20573 | T20572 | arg2Of | DNA,immunoprecipitated |
R14684 | T20575 | T20574 | arg2Of | used,was |
R14685 | T20575 | T20576 | arg1Of | used,as |
R14686 | T20578 | T20576 | arg2Of | template,as |
R14687 | T20578 | T20577 | arg1Of | template,a |
R14688 | T20578 | T20579 | arg1Of | template,in |
R14689 | T20582 | T20579 | arg2Of | reaction,in |
R14690 | T20582 | T20580 | arg1Of | reaction,the |
R14691 | T20582 | T20581 | arg1Of | reaction,PCR |
R14692 | T20584 | T20583 | arg1Of | amplification,PCR |
R14693 | T20584 | T20585 | arg1Of | amplification,of |
R14694 | T20584 | T20589 | arg1Of | amplification,was |
R14695 | T20584 | T20590 | arg2Of | amplification,performed |
R14696 | T20584 | T20592 | arg1Of | amplification,yielded |
R14697 | T20588 | T20585 | arg2Of | promoter,of |
R14698 | T20588 | T20586 | arg1Of | promoter,the |
R14699 | T20588 | T20587 | arg1Of | promoter,ɛy |
R14700 | T20590 | T20589 | arg2Of | performed,was |
R14701 | T20590 | T20591 | arg1Of | performed,and |
R14702 | T20591 | T20596 | arg1Of | and,"," |
R14703 | T20591 | T20597 | arg1Of | and,corresponding |
R14704 | T20592 | T20591 | arg2Of | yielded,and |
R14705 | T20595 | T20592 | arg2Of | amplicon,yielded |
R14706 | T20595 | T20593 | arg1Of | amplicon,a |
R14707 | T20595 | T20594 | arg1Of | amplicon,172-bp |
R14708 | T20598 | T20597 | arg2Of | to,corresponding |
R14709 | T20599 | T20598 | arg2Of | nucleotides,to |
R14710 | T20599 | T20600 | arg1Of | nucleotides,−31 |
R14711 | T20600 | T20601 | arg1Of | −31,to |
R14712 | T20602 | T20601 | arg2Of | +140,to |
R14713 | T20602 | T20603 | arg1Of | +140,of |
R14714 | T20602 | T20607 | arg1Of | +140,( |
R14715 | T20606 | T20603 | arg2Of | promoter,of |
R14716 | T20606 | T20604 | arg1Of | promoter,the |
R14717 | T20606 | T20605 | arg1Of | promoter,ɛy |
R14718 | T20609 | T20610 | arg1Of | MHB1688,"," |
R14719 | T20610 | T20613 | arg1Of | ",",and |
R14720 | T20611 | T20610 | arg2Of | 5′CGAAGAATAAAAGGCCACCA3′,"," |
R14721 | T20613 | T20607 | arg2Of | and,( |
R14722 | T20613 | T20608 | arg1Of | and,primers |
R14723 | T20613 | T20612 | arg1Of | and,; |
R14724 | T20613 | T20615 | arg1Of | and,"," |
R14725 | T20614 | T20613 | arg2Of | MHB1689,and |
R14726 | T20616 | T20615 | arg2Of | 5′GCTTCACCACCAACCTCTTC3′,"," |
R14727 | T20617 | T20607 | arg3Of | ),( |
R14728 | T20618 | T20619 | arg1Of | PCR,was |
R14729 | T20618 | T20620 | arg2Of | PCR,performed |
R14730 | T20620 | T20619 | arg2Of | performed,was |
R14731 | T20620 | T20621 | arg1Of | performed,under |
R14732 | T20620 | T20625 | arg1Of | performed,: |
R14733 | T20624 | T20621 | arg2Of | conditions,under |
R14734 | T20624 | T20622 | arg1Of | conditions,the |
R14735 | T20624 | T20623 | arg1Of | conditions,following |
R14736 | T20627 | T20626 | arg1Of | °C,95 |
R14737 | T20627 | T20628 | arg1Of | °C,for |
R14738 | T20627 | T20631 | arg1Of | °C,followed |
R14739 | T20627 | T20655 | arg1Of | °C,ending |
R14740 | T20630 | T20628 | arg2Of | min,for |
R14741 | T20630 | T20629 | arg1Of | min,15 |
R14742 | T20631 | T20632 | arg1Of | followed,by |
R14743 | T20631 | T20635 | arg1Of | followed,at |
R14744 | T20631 | T20638 | arg1Of | followed,for |
R14745 | T20631 | T20641 | arg1Of | followed,"," |
R14746 | T20631 | T20651 | arg1Of | followed,for |
R14747 | T20631 | T20654 | arg1Of | followed,"," |
R14748 | T20631 | T20655 | modOf | followed,ending |
R14749 | T20634 | T20632 | arg2Of | cycles,by |
R14750 | T20634 | T20633 | arg1Of | cycles,30 |
R14751 | T20637 | T20635 | arg2Of | °C,at |
R14752 | T20637 | T20636 | arg1Of | °C,95 |
R14753 | T20640 | T20638 | arg2Of | s,for |
R14754 | T20640 | T20639 | arg1Of | s,30 |
R14755 | T20643 | T20642 | arg1Of | °C,60 |
R14756 | T20643 | T20644 | arg1Of | °C,for |
R14757 | T20643 | T20648 | arg1Of | °C,and |
R14758 | T20646 | T20644 | arg2Of | s,for |
R14759 | T20646 | T20645 | arg1Of | s,30 |
R14760 | T20648 | T20631 | arg2Of | and,followed |
R14761 | T20648 | T20647 | arg1Of | and,"," |
R14762 | T20650 | T20648 | arg2Of | °C,and |
R14763 | T20650 | T20649 | arg1Of | °C,72 |
R14764 | T20653 | T20651 | arg2Of | s,for |
R14765 | T20653 | T20652 | arg1Of | s,45 |
R14766 | T20655 | T20656 | arg1Of | ending,with |
R14767 | T20655 | T20663 | arg1Of | ending,for |
R14768 | T20659 | T20656 | arg2Of | extension,with |
R14769 | T20659 | T20657 | arg1Of | extension,a |
R14770 | T20659 | T20658 | arg1Of | extension,final |
R14771 | T20659 | T20660 | arg1Of | extension,at |
R14772 | T20662 | T20660 | arg2Of | °C,at |
R14773 | T20662 | T20661 | arg1Of | °C,72 |
R14774 | T20665 | T20663 | arg2Of | min,for |
R14775 | T20665 | T20664 | arg1Of | min,5 |
bionlp-st-ge-2016-test-proteins
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20360 | 1210-1212 | Protein | denotes | ɛy |
T20359 | 1105-1107 | Protein | denotes | ɛy |
T20358 | 751-755 | Protein | denotes | Sox6 |
T20357 | 580-589 | Protein | denotes | protein A |
UBERON-AE
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20340 | 1470-1479 | http://purl.obolibrary.org/obo/UBERON_2000106 | denotes | extension |
T20339 | 92-97 | http://purl.obolibrary.org/obo/UBERON_0002107 | denotes | liver |
GO-BP
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20352 | 344-349 | http://purl.obolibrary.org/obo/GO_0019835 | denotes | lysis |
GO-MF
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20361 | 890-898 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
GO-CC
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20363 | 98-103 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T20362 | 67-72 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T20370 | 890-898 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T20369 | 890-898 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T20368 | 880-889 | http://purl.obolibrary.org/obo/GO_0000785 | denotes | chromatin |
T20367 | 426-443 | http://purl.obolibrary.org/obo/GO_0043234 | denotes | protein complexes |
T20366 | 422-443 | http://purl.obolibrary.org/obo/GO_0097522 | denotes | DNA-protein complexes |
T20365 | 422-443 | http://purl.obolibrary.org/obo/GO_0032993 | denotes | DNA-protein complexes |
T20364 | 422-443 | http://purl.obolibrary.org/obo/GO_0001114 | denotes | DNA-protein complexes |
sentences
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20351 | 1356-1499 | Sentence | denotes | 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min. |
T20350 | 1306-1355 | Sentence | denotes | PCR was performed under the following conditions: |
T20349 | 1080-1305 | Sentence | denotes | PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). |
T20348 | 1000-1079 | Sentence | denotes | Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. |
T20347 | 876-999 | Sentence | denotes | The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. |
T20346 | 663-875 | Sentence | denotes | Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. |
T20345 | 478-662 | Sentence | denotes | One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). |
T20344 | 422-477 | Sentence | denotes | DNA-protein complexes were sonicated to 200 and 600 bp. |
T20343 | 52-421 | Sentence | denotes | Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. |
T20342 | 12-51 | Sentence | denotes | As described by Nouzova [53], in brief: |
T20341 | 0-11 | Sentence | denotes | ChIP assay. |
T330 | 0-11 | Sentence | denotes | ChIP assay. |
T331 | 12-51 | Sentence | denotes | As described by Nouzova [53], in brief: |
T332 | 52-421 | Sentence | denotes | Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. |
T333 | 422-477 | Sentence | denotes | DNA-protein complexes were sonicated to 200 and 600 bp. |
T334 | 478-662 | Sentence | denotes | One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). |
T335 | 663-830 | Sentence | denotes | Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. |
T336 | 831-875 | Sentence | denotes | The last two were used as negative controls. |
T337 | 876-999 | Sentence | denotes | The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. |
T338 | 1000-1079 | Sentence | denotes | Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. |
T339 | 1080-1305 | Sentence | denotes | PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). |
T340 | 1306-1355 | Sentence | denotes | PCR was performed under the following conditions: |
T341 | 1356-1499 | Sentence | denotes | 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min. |
simple1
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20381 | 1210-1212 | Protein | denotes | ɛy |
T20380 | 1105-1107 | Protein | denotes | ɛy |
T20379 | 751-755 | Protein | denotes | Sox6 |
T20378 | 580-589 | Protein | denotes | protein A |
BioNLP16_DUT
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T21019 | 580-589 | Protein | denotes | protein A |
T21022 | 1210-1212 | Protein | denotes | ɛy |
T21021 | 1105-1107 | Protein | denotes | ɛy |
T21020 | 751-755 | Protein | denotes | Sox6 |
BioNLP16_Messiy
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20669 | 1210-1212 | Protein | denotes | ɛy |
T20668 | 1105-1107 | Protein | denotes | ɛy |
T20667 | 751-755 | Protein | denotes | Sox6 |
T20666 | 580-589 | Protein | denotes | protein A |
DLUT931
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20673 | 1210-1212 | Protein | denotes | ɛy |
T20672 | 1105-1107 | Protein | denotes | ɛy |
T20671 | 751-755 | Protein | denotes | Sox6 |
T20670 | 580-589 | Protein | denotes | protein A |
bionlp-st-ge-2016-test-ihmc
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T21018 | 926-954 | Localization | denotes | the DNA protein cross-links |
T21017 | 45-57 | Entity | denotes | brief: Cells |
T21016 | 1013-1035 | Entity | denotes | immunoprecipitated DNA |
T21015 | 109-131 | Protein | denotes | three 15.5-dpc WT mice |
T21014 | 995-1009 | Entity | denotes | 4 h. Input DNA |
T21013 | 746-797 | Protein | denotes | anti-Sox6, a second treated with normal rabbit IgG, |
T21012 | 1176-1221 | Entity | denotes | to nucleotides −31 to +140 of the ɛy promoter |
T21011 | 890-898 | Protein | denotes | antibody |
T21010 | 197-205 | Entity | denotes | ice-cold |
T21009 | 403-409 | Entity | denotes | on ice |
T21008 | 1062-1078 | Protein | denotes | the PCR reaction |
T21007 | 150-176 | Entity | denotes | 1% formaldehyde for 10 min |
T21006 | 876-908 | Entity | denotes | The chromatin-antibody complexes |
T21005 | 973-987 | Entity | denotes | 5 M NaCl at 65 |
T21004 | 880-889 | Entity | denotes | chromatin |
T21003 | 930-933 | Entity | denotes | DNA |
T21002 | 368-387 | Protein | denotes | protease inhibitors |
T21001 | 249-253 | Entity | denotes | EDTA |
T21000 | 1080-1083 | Protein | denotes | PCR |
T20999 | 926-953 | Protein | denotes | the DNA protein cross-links |
T20998 | 1306-1309 | Protein | denotes | PCR |
T20997 | 1210-1212 | Protein | denotes | ɛy |
T20996 | 1105-1107 | Protein | denotes | ɛy |
T20995 | 1098-1116 | Entity | denotes | of the ɛy promoter |
T20994 | 590-599 | Entity | denotes | Sepharose |
T20993 | 338-388 | Protein | denotes | a SDS lysis buffer containing protease inhibitors, |
T20992 | 244-284 | Protein | denotes | 0.1% EDTA containing protease inhibitors |
T20991 | 422-443 | Entity | denotes | DNA-protein complexes |
T20990 | 1206-1221 | Entity | denotes | the ɛy promoter |
R15085 | T20990 | T20997 | partOf | the ɛy promoter,ɛy |
R15086 | T20995 | T20996 | partOf | of the ɛy promoter,ɛy |
R15087 | T20999 | T21018 | themeOf | the DNA protein cross-links,the DNA protein cross-links |
R15088 | T21003 | T21018 | locationOf | DNA,the DNA protein cross-links |
bionlp-st-ge-2016-spacy-parsed
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20986 | 1498-1499 | . | denotes | . |
T20985 | 1495-1498 | NN | denotes | min |
T20984 | 1493-1494 | CD | denotes | 5 |
T20983 | 1489-1492 | IN | denotes | for |
T20982 | 1487-1488 | NNP | denotes | C |
T20981 | 1486-1487 | CD | denotes | ° |
T20980 | 1483-1485 | CD | denotes | 72 |
T20979 | 1480-1482 | IN | denotes | at |
T20978 | 1470-1479 | NN | denotes | extension |
T20977 | 1464-1469 | JJ | denotes | final |
T20976 | 1462-1463 | DT | denotes | a |
T20975 | 1457-1461 | IN | denotes | with |
T20974 | 1450-1456 | VBG | denotes | ending |
T20973 | 1448-1449 | , | denotes | , |
T20972 | 1447-1448 | PRP | denotes | s |
T20971 | 1444-1446 | CD | denotes | 45 |
T20970 | 1440-1443 | IN | denotes | for |
T20969 | 1438-1439 | NNP | denotes | C |
T20968 | 1437-1438 | NN | denotes | ° |
T20967 | 1434-1436 | CD | denotes | 72 |
T20966 | 1430-1433 | CC | denotes | and |
T20965 | 1428-1429 | , | denotes | , |
T20964 | 1427-1428 | PRP | denotes | s |
T20963 | 1424-1426 | CD | denotes | 30 |
T20962 | 1420-1423 | IN | denotes | for |
T20961 | 1418-1419 | NNP | denotes | C |
T20960 | 1417-1418 | NN | denotes | ° |
T20959 | 1414-1416 | CD | denotes | 60 |
T20958 | 1412-1413 | , | denotes | , |
T20957 | 1411-1412 | PRP | denotes | s |
T20956 | 1408-1410 | CD | denotes | 30 |
T20955 | 1404-1407 | IN | denotes | for |
T20954 | 1402-1403 | NNP | denotes | C |
T20953 | 1401-1402 | CD | denotes | ° |
T20952 | 1398-1400 | CD | denotes | 95 |
T20951 | 1395-1397 | IN | denotes | at |
T20950 | 1388-1394 | NNS | denotes | cycles |
T20949 | 1385-1387 | CD | denotes | 30 |
T20948 | 1382-1384 | IN | denotes | by |
T20947 | 1373-1381 | VBN | denotes | followed |
T20946 | 1369-1372 | NN | denotes | min |
T20945 | 1366-1368 | CD | denotes | 15 |
T20944 | 1362-1365 | IN | denotes | for |
T20943 | 1360-1361 | NNP | denotes | C |
T20942 | 1359-1360 | NN | denotes | ° |
T20941 | 1356-1358 | CD | denotes | 95 |
T20940 | 1354-1355 | : | denotes | : |
T20939 | 1344-1354 | NNS | denotes | conditions |
T20938 | 1334-1343 | JJ | denotes | following |
T20937 | 1330-1333 | DT | denotes | the |
T20936 | 1324-1329 | IN | denotes | under |
T20935 | 1314-1323 | VBN | denotes | performed |
T20934 | 1310-1313 | VBD | denotes | was |
T20933 | 1306-1309 | NNP | denotes | PCR |
T20932 | 1304-1305 | . | denotes | . |
T20931 | 1303-1304 | -RRB- | denotes | ) |
T20930 | 1302-1303 | NNP | denotes | ′ |
T20929 | 1281-1302 | NNP | denotes | GCTTCACCACCAACCTCTTC3 |
T20928 | 1280-1281 | NN | denotes | ′ |
T20927 | 1279-1280 | CD | denotes | 5 |
T20926 | 1277-1278 | , | denotes | , |
T20925 | 1270-1277 | NNP | denotes | MHB1689 |
T20924 | 1266-1269 | CC | denotes | and |
T20923 | 1264-1265 | : | denotes | ; |
T20922 | 1263-1264 | NN | denotes | ′ |
T20921 | 1242-1263 | CD | denotes | CGAAGAATAAAAGGCCACCA3 |
T20920 | 1241-1242 | NN | denotes | ′ |
T20919 | 1240-1241 | CD | denotes | 5 |
T20918 | 1238-1239 | , | denotes | , |
T20917 | 1231-1238 | NNP | denotes | MHB1688 |
T20916 | 1223-1230 | NNS | denotes | primers |
T20915 | 1222-1223 | -LRB- | denotes | ( |
T20914 | 1213-1221 | NN | denotes | promoter |
T20913 | 1210-1212 | JJ | denotes | ɛy |
T20912 | 1206-1209 | DT | denotes | the |
T20911 | 1203-1205 | IN | denotes | of |
T20910 | 1198-1202 | CD | denotes | +140 |
T20909 | 1195-1197 | TO | denotes | to |
T20908 | 1192-1194 | CD | denotes | 31 |
T20907 | 1191-1192 | VBP | denotes | − |
T20906 | 1179-1190 | NNS | denotes | nucleotides |
T20905 | 1176-1178 | TO | denotes | to |
T20904 | 1162-1175 | JJ | denotes | corresponding |
T20903 | 1160-1161 | , | denotes | , |
T20902 | 1152-1160 | NN | denotes | amplicon |
T20901 | 1145-1151 | JJ | denotes | 172-bp |
T20900 | 1143-1144 | DT | denotes | a |
T20899 | 1135-1142 | VBD | denotes | yielded |
T20898 | 1131-1134 | CC | denotes | and |
T20897 | 1121-1130 | VBN | denotes | performed |
T20896 | 1117-1120 | VBD | denotes | was |
T20895 | 1108-1116 | NN | denotes | promoter |
T20894 | 1105-1107 | JJ | denotes | ɛy |
T20893 | 1101-1104 | DT | denotes | the |
T20892 | 1098-1100 | IN | denotes | of |
T20891 | 1084-1097 | NN | denotes | amplification |
T20890 | 1080-1083 | NNP | denotes | PCR |
T20889 | 1078-1079 | . | denotes | . |
T20888 | 1070-1078 | NN | denotes | reaction |
T20887 | 1066-1069 | NNP | denotes | PCR |
T20886 | 1062-1065 | DT | denotes | the |
T20885 | 1059-1061 | IN | denotes | in |
T20884 | 1050-1058 | NN | denotes | template |
T20883 | 1048-1049 | DT | denotes | a |
T20882 | 1045-1047 | IN | denotes | as |
T20881 | 1040-1044 | VBN | denotes | used |
T20880 | 1036-1039 | VBD | denotes | was |
T20879 | 1032-1035 | NN | denotes | DNA |
T20878 | 1013-1031 | JJ | denotes | immunoprecipitated |
T20877 | 1010-1012 | CC | denotes | or |
T20876 | 1006-1009 | NNP | denotes | DNA |
T20875 | 1000-1005 | NNP | denotes | Input |
T20874 | 997-999 | NN | denotes | h. |
T20873 | 995-996 | CD | denotes | 4 |
T20872 | 991-994 | IN | denotes | for |
T20871 | 989-990 | NNP | denotes | C |
T20870 | 988-989 | CD | denotes | ° |
T20869 | 985-987 | CD | denotes | 65 |
T20868 | 982-984 | IN | denotes | at |
T20867 | 977-981 | NNP | denotes | NaCl |
T20866 | 975-976 | NNP | denotes | M |
T20865 | 973-974 | CD | denotes | 5 |
T20864 | 968-972 | IN | denotes | with |
T20863 | 959-967 | VBN | denotes | reversed |
T20862 | 954-958 | VBD | denotes | were |
T20861 | 942-953 | NNS | denotes | cross-links |
T20860 | 934-941 | NN | denotes | protein |
T20859 | 930-933 | NNP | denotes | DNA |
T20858 | 926-929 | DT | denotes | the |
T20857 | 922-925 | CC | denotes | and |
T20856 | 920-921 | , | denotes | , |
T20855 | 914-920 | VBN | denotes | eluted |
T20854 | 909-913 | VBD | denotes | were |
T20853 | 899-908 | NNS | denotes | complexes |
T20852 | 880-898 | JJ | denotes | chromatin-antibody |
T20851 | 876-879 | DT | denotes | The |
T20850 | 874-875 | . | denotes | . |
T20849 | 866-874 | NNS | denotes | controls |
T20848 | 857-865 | JJ | denotes | negative |
T20847 | 854-856 | IN | denotes | as |
T20846 | 849-853 | VBN | denotes | used |
T20845 | 844-848 | VBD | denotes | were |
T20844 | 840-843 | CD | denotes | two |
T20843 | 835-839 | JJ | denotes | last |
T20842 | 831-834 | DT | denotes | The |
T20841 | 829-830 | . | denotes | . |
T20840 | 827-829 | NNP | denotes | Ab |
T20839 | 819-826 | IN | denotes | without |
T20838 | 812-818 | NN | denotes | sample |
T20837 | 806-811 | JJ | denotes | third |
T20836 | 802-805 | DT | denotes | the |
T20835 | 798-801 | CC | denotes | and |
T20834 | 796-797 | , | denotes | , |
T20833 | 793-796 | NNP | denotes | IgG |
T20832 | 786-792 | NN | denotes | rabbit |
T20831 | 779-785 | JJ | denotes | normal |
T20830 | 774-778 | IN | denotes | with |
T20829 | 766-773 | VBN | denotes | treated |
T20828 | 759-765 | JJ | denotes | second |
T20827 | 757-758 | DT | denotes | a |
T20826 | 755-756 | , | denotes | , |
T20825 | 746-755 | JJ | denotes | anti-Sox6 |
T20824 | 741-745 | IN | denotes | with |
T20823 | 733-740 | VBN | denotes | treated |
T20822 | 726-732 | NN | denotes | sample |
T20821 | 722-725 | CD | denotes | one |
T20820 | 720-721 | : | denotes | : |
T20819 | 714-720 | NNS | denotes | thirds |
T20818 | 709-713 | IN | denotes | into |
T20817 | 703-708 | VBN | denotes | split |
T20816 | 698-702 | VBD | denotes | were |
T20815 | 690-697 | NNS | denotes | samples |
T20814 | 686-689 | DT | denotes | the |
T20813 | 684-685 | , | denotes | , |
T20812 | 673-684 | NN | denotes | preclearing |
T20811 | 663-672 | VBG | denotes | Following |
T20810 | 661-662 | . | denotes | . |
T20809 | 660-661 | -RRB- | denotes | ) |
T20808 | 654-660 | NNPS | denotes | States |
T20807 | 647-653 | NNP | denotes | United |
T20806 | 645-646 | , | denotes | , |
T20805 | 639-645 | NNP | denotes | Jersey |
T20804 | 635-638 | NNP | denotes | New |
T20689 | 42-44 | IN | denotes | in |
T20688 | 40-41 | , | denotes | , |
T20687 | 39-40 | NNP | denotes | ] |
T20686 | 37-39 | CD | denotes | 53 |
T20685 | 36-37 | NNP | denotes | [ |
T20684 | 28-35 | NNP | denotes | Nouzova |
T20683 | 25-27 | IN | denotes | by |
T20682 | 15-24 | VBN | denotes | described |
T20681 | 12-14 | IN | denotes | As |
T20680 | 10-11 | . | denotes | . |
T20679 | 5-10 | NN | denotes | assay |
T20678 | 0-4 | NN | denotes | ChIP |
T20803 | 633-634 | , | denotes | , |
T20802 | 623-633 | NNP | denotes | Piscataway |
T20801 | 621-622 | , | denotes | , |
T20800 | 610-621 | NNP | denotes | Biosciences |
T20799 | 601-609 | NNP | denotes | Amersham |
T20798 | 600-601 | -LRB- | denotes | ( |
T20797 | 588-599 | JJ | denotes | A-Sepharose |
T20796 | 580-587 | NN | denotes | protein |
T20795 | 575-579 | IN | denotes | with |
T20794 | 564-574 | VBN | denotes | precleared |
T20793 | 560-563 | VBD | denotes | was |
T20792 | 553-559 | NN | denotes | sample |
T20791 | 543-552 | VBG | denotes | remaining |
T20790 | 539-542 | DT | denotes | the |
T20789 | 535-538 | CC | denotes | and |
T20788 | 533-534 | , | denotes | , |
T20787 | 526-533 | NN | denotes | control |
T20786 | 520-525 | NN | denotes | input |
T20785 | 516-519 | IN | denotes | for |
T20784 | 510-515 | RB | denotes | aside |
T20783 | 506-509 | VBN | denotes | set |
T20782 | 502-505 | VBD | denotes | was |
T20781 | 495-501 | NN | denotes | sample |
T20780 | 491-494 | DT | denotes | the |
T20779 | 488-490 | IN | denotes | of |
T20778 | 478-487 | NN | denotes | One-tenth |
T20777 | 476-477 | . | denotes | . |
T20776 | 474-476 | NN | denotes | bp |
T20775 | 470-473 | CD | denotes | 600 |
T20774 | 466-469 | CC | denotes | and |
T20773 | 462-465 | CD | denotes | 200 |
T20772 | 459-461 | TO | denotes | to |
T20771 | 449-458 | VBN | denotes | sonicated |
T20770 | 444-448 | VBD | denotes | were |
T20769 | 434-443 | NNS | denotes | complexes |
T20768 | 422-433 | JJ | denotes | DNA-protein |
T20767 | 420-421 | . | denotes | . |
T20766 | 417-420 | NN | denotes | min |
T20765 | 414-416 | CD | denotes | 10 |
T20764 | 410-413 | IN | denotes | for |
T20763 | 406-409 | NN | denotes | ice |
T20762 | 403-405 | IN | denotes | on |
T20761 | 393-402 | VBD | denotes | incubated |
T20760 | 389-392 | CC | denotes | and |
T20759 | 387-388 | , | denotes | , |
T20758 | 377-387 | NNS | denotes | inhibitors |
T20757 | 368-376 | NN | denotes | protease |
T20756 | 357-367 | VBG | denotes | containing |
T20755 | 350-356 | NN | denotes | buffer |
T20754 | 344-349 | NN | denotes | lysis |
T20753 | 340-343 | NNP | denotes | SDS |
T20752 | 338-339 | DT | denotes | a |
T20751 | 335-337 | IN | denotes | in |
T20750 | 323-334 | VBD | denotes | resuspended |
T20749 | 321-322 | , | denotes | , |
T20748 | 320-321 | NNP | denotes | C |
T20747 | 319-320 | CD | denotes | ° |
T20746 | 317-318 | CD | denotes | 4 |
T20745 | 314-316 | IN | denotes | at |
T20744 | 299-313 | NN | denotes | centrifugation |
T20743 | 296-298 | IN | denotes | by |
T20742 | 286-295 | VBN | denotes | collected |
T20741 | 284-285 | , | denotes | , |
T20740 | 274-284 | NNS | denotes | inhibitors |
T20739 | 265-273 | NN | denotes | protease |
T20738 | 254-264 | VBG | denotes | containing |
T20737 | 249-253 | NNP | denotes | EDTA |
T20736 | 247-248 | NN | denotes | % |
T20735 | 244-247 | CD | denotes | 0.1 |
T20734 | 239-243 | IN | denotes | with |
T20733 | 230-238 | NN | denotes | solution |
T20732 | 225-229 | NN | denotes | salt |
T20731 | 216-224 | JJ | denotes | balanced |
T20730 | 214-215 | POS | denotes | ' |
T20729 | 209-214 | NNP | denotes | Hanks |
T20728 | 207-208 | CD | denotes | × |
T20727 | 206-207 | CD | denotes | 1 |
T20726 | 197-205 | JJ | denotes | ice-cold |
T20725 | 194-196 | IN | denotes | in |
T20724 | 187-193 | VBD | denotes | rinsed |
T20723 | 185-186 | , | denotes | , |
T20722 | 184-185 | NNP | denotes | C |
T20721 | 183-184 | CD | denotes | ° |
T20720 | 180-182 | CD | denotes | 37 |
T20719 | 177-179 | IN | denotes | at |
T20718 | 173-176 | NN | denotes | min |
T20717 | 170-172 | CD | denotes | 10 |
T20716 | 166-169 | IN | denotes | for |
T20715 | 153-165 | NN | denotes | formaldehyde |
T20714 | 151-152 | NN | denotes | % |
T20713 | 150-151 | CD | denotes | 1 |
T20712 | 145-149 | IN | denotes | with |
T20711 | 137-144 | VBN | denotes | treated |
T20710 | 132-136 | VBD | denotes | were |
T20709 | 127-131 | NNS | denotes | mice |
T20708 | 124-126 | NNP | denotes | WT |
T20707 | 115-123 | JJ | denotes | 15.5-dpc |
T20706 | 109-114 | CD | denotes | three |
T20705 | 104-108 | IN | denotes | from |
T20704 | 98-103 | NNS | denotes | cells |
T20703 | 92-97 | NN | denotes | liver |
T20702 | 86-91 | JJ | denotes | fetal |
T20701 | 83-85 | CC | denotes | or |
T20700 | 81-82 | -RRB- | denotes | ) |
T20699 | 78-81 | CD | denotes | 107 |
T20698 | 76-77 | CD | denotes | × |
T20697 | 74-75 | CD | denotes | 4 |
T20696 | 73-74 | -LRB- | denotes | ( |
T20695 | 67-72 | NNS | denotes | cells |
T20694 | 63-66 | NNP | denotes | MEL |
T20693 | 58-62 | IN | denotes | from |
T20692 | 52-57 | NNS | denotes | Cells |
T20691 | 50-51 | : | denotes | : |
T20690 | 45-50 | NN | denotes | brief |
R14776 | T20678 | T20679 | compound | ChIP,assay |
R14777 | T20679 | T20679 | ROOT | assay,assay |
R14778 | T20680 | T20679 | punct | .,assay |
R14779 | T20681 | T20682 | mark | As,described |
R14780 | T20682 | T20711 | advcl | described,treated |
R14781 | T20683 | T20682 | agent | by,described |
R14782 | T20684 | T20685 | compound | Nouzova,[ |
R14783 | T20685 | T20687 | nmod | [,] |
R14784 | T20686 | T20687 | nummod | 53,] |
R14785 | T20687 | T20683 | pobj | ],by |
R14786 | T20688 | T20682 | punct | ",",described |
R14787 | T20689 | T20682 | prep | in,described |
R14788 | T20690 | T20689 | pobj | brief,in |
R14789 | T20691 | T20711 | punct | :,treated |
R14790 | T20692 | T20711 | nsubjpass | Cells,treated |
R14791 | T20693 | T20692 | prep | from,Cells |
R14792 | T20694 | T20695 | compound | MEL,cells |
R14793 | T20695 | T20693 | pobj | cells,from |
R14794 | T20696 | T20695 | punct | (,cells |
R14795 | T20697 | T20699 | nummod | 4,107 |
R14796 | T20698 | T20699 | nummod | ×,107 |
R14797 | T20699 | T20695 | appos | 107,cells |
R14798 | T20700 | T20699 | punct | ),107 |
R14799 | T20701 | T20699 | cc | or,107 |
R14800 | T20702 | T20704 | amod | fetal,cells |
R14801 | T20703 | T20704 | compound | liver,cells |
R14802 | T20704 | T20711 | nsubjpass | cells,treated |
R14803 | T20705 | T20704 | prep | from,cells |
R14804 | T20706 | T20709 | nummod | three,mice |
R14805 | T20707 | T20709 | amod | 15.5-dpc,mice |
R14806 | T20708 | T20709 | compound | WT,mice |
R14807 | T20709 | T20705 | pobj | mice,from |
R14808 | T20710 | T20711 | auxpass | were,treated |
R14809 | T20711 | T20711 | ROOT | treated,treated |
R14810 | T20712 | T20711 | prep | with,treated |
R14811 | T20713 | T20714 | nummod | 1,% |
R14812 | T20714 | T20715 | compound | %,formaldehyde |
R14813 | T20715 | T20712 | pobj | formaldehyde,with |
R14814 | T20716 | T20711 | prep | for,treated |
R14815 | T20717 | T20718 | nummod | 10,min |
R14816 | T20718 | T20716 | pobj | min,for |
R14817 | T20719 | T20711 | prep | at,treated |
R14818 | T20720 | T20721 | nummod | 37,° |
R14819 | T20721 | T20722 | nummod | °,C |
R14820 | T20722 | T20719 | pobj | C,at |
R14821 | T20723 | T20711 | punct | ",",treated |
R14822 | T20724 | T20711 | conj | rinsed,treated |
R14823 | T20725 | T20724 | prep | in,rinsed |
R14824 | T20726 | T20729 | amod | ice-cold,Hanks |
R14825 | T20727 | T20728 | nummod | 1,× |
R14826 | T20728 | T20729 | compound | ×,Hanks |
R14827 | T20729 | T20733 | poss | Hanks,solution |
R14828 | T20730 | T20729 | case | ',Hanks |
R14829 | T20731 | T20733 | amod | balanced,solution |
R14830 | T20732 | T20733 | compound | salt,solution |
R14831 | T20733 | T20725 | pobj | solution,in |
R14832 | T20734 | T20733 | prep | with,solution |
R14833 | T20735 | T20736 | nummod | 0.1,% |
R14834 | T20736 | T20737 | compound | %,EDTA |
R14835 | T20737 | T20738 | nsubj | EDTA,containing |
R14836 | T20738 | T20734 | pcomp | containing,with |
R14837 | T20739 | T20740 | compound | protease,inhibitors |
R14838 | T20740 | T20738 | dobj | inhibitors,containing |
R14839 | T20741 | T20740 | punct | ",",inhibitors |
R14840 | T20742 | T20740 | acl | collected,inhibitors |
R14841 | T20743 | T20742 | agent | by,collected |
R14842 | T20744 | T20743 | pobj | centrifugation,by |
R14843 | T20745 | T20742 | prep | at,collected |
R14844 | T20746 | T20747 | nummod | 4,° |
R14845 | T20747 | T20748 | nummod | °,C |
R14846 | T20748 | T20745 | pobj | C,at |
R14847 | T20749 | T20748 | punct | ",",C |
R14848 | T20750 | T20724 | conj | resuspended,rinsed |
R14849 | T20751 | T20750 | prep | in,resuspended |
R14850 | T20752 | T20755 | det | a,buffer |
R14851 | T20753 | T20755 | compound | SDS,buffer |
R14852 | T20754 | T20755 | compound | lysis,buffer |
R14853 | T20755 | T20751 | pobj | buffer,in |
R14854 | T20756 | T20755 | acl | containing,buffer |
R14855 | T20757 | T20758 | compound | protease,inhibitors |
R14856 | T20758 | T20756 | dobj | inhibitors,containing |
R14857 | T20759 | T20750 | punct | ",",resuspended |
R14858 | T20760 | T20750 | cc | and,resuspended |
R14859 | T20761 | T20750 | conj | incubated,resuspended |
R14860 | T20762 | T20761 | prep | on,incubated |
R14861 | T20763 | T20762 | pobj | ice,on |
R14862 | T20764 | T20761 | prep | for,incubated |
R14863 | T20765 | T20766 | nummod | 10,min |
R14864 | T20766 | T20764 | pobj | min,for |
R14865 | T20767 | T20711 | punct | .,treated |
R14866 | T20768 | T20769 | amod | DNA-protein,complexes |
R14867 | T20769 | T20771 | nsubjpass | complexes,sonicated |
R14868 | T20770 | T20771 | auxpass | were,sonicated |
R14869 | T20771 | T20771 | ROOT | sonicated,sonicated |
R14870 | T20772 | T20771 | prep | to,sonicated |
R14871 | T20773 | T20776 | nummod | 200,bp |
R14872 | T20774 | T20773 | cc | and,200 |
R14873 | T20775 | T20773 | conj | 600,200 |
R14874 | T20776 | T20772 | pobj | bp,to |
R14875 | T20777 | T20771 | punct | .,sonicated |
R14876 | T20778 | T20783 | nsubjpass | One-tenth,set |
R14877 | T20779 | T20778 | prep | of,One-tenth |
R14878 | T20780 | T20781 | det | the,sample |
R14879 | T20781 | T20779 | pobj | sample,of |
R14880 | T20782 | T20783 | auxpass | was,set |
R14881 | T20783 | T20783 | ROOT | set,set |
R14882 | T20784 | T20783 | advmod | aside,set |
R14883 | T20785 | T20783 | prep | for,set |
R14884 | T20786 | T20787 | compound | input,control |
R14885 | T20787 | T20785 | pobj | control,for |
R14886 | T20788 | T20783 | punct | ",",set |
R14887 | T20789 | T20783 | cc | and,set |
R14888 | T20790 | T20792 | det | the,sample |
R14889 | T20791 | T20792 | amod | remaining,sample |
R14890 | T20792 | T20794 | nsubjpass | sample,precleared |
R14891 | T20793 | T20794 | auxpass | was,precleared |
R14892 | T20794 | T20783 | conj | precleared,set |
R14893 | T20795 | T20794 | prep | with,precleared |
R14894 | T20796 | T20797 | compound | protein,A-Sepharose |
R14895 | T20797 | T20795 | pobj | A-Sepharose,with |
R14896 | T20798 | T20800 | punct | (,Biosciences |
R14897 | T20799 | T20800 | compound | Amersham,Biosciences |
R14898 | T20800 | T20797 | appos | Biosciences,A-Sepharose |
R14899 | T20801 | T20800 | punct | ",",Biosciences |
R14900 | T20802 | T20800 | npadvmod | Piscataway,Biosciences |
R14901 | T20803 | T20802 | punct | ",",Piscataway |
R14902 | T20804 | T20805 | compound | New,Jersey |
R14903 | T20805 | T20802 | conj | Jersey,Piscataway |
R14904 | T20806 | T20805 | punct | ",",Jersey |
R14905 | T20807 | T20808 | compound | United,States |
R14906 | T20808 | T20802 | appos | States,Piscataway |
R14907 | T20809 | T20802 | punct | ),Piscataway |
R14908 | T20810 | T20794 | punct | .,precleared |
R14909 | T20811 | T20817 | prep | Following,split |
R14910 | T20812 | T20811 | pobj | preclearing,Following |
R14911 | T20813 | T20817 | punct | ",",split |
R14912 | T20814 | T20815 | det | the,samples |
R14913 | T20815 | T20817 | nsubjpass | samples,split |
R14914 | T20816 | T20817 | auxpass | were,split |
R14915 | T20817 | T20817 | ROOT | split,split |
R14916 | T20818 | T20817 | prep | into,split |
R14917 | T20819 | T20818 | pobj | thirds,into |
R14918 | T20820 | T20817 | punct | :,split |
R14919 | T20821 | T20822 | nummod | one,sample |
R14920 | T20822 | T20829 | nsubjpass | sample,treated |
R14921 | T20823 | T20822 | acl | treated,sample |
R14922 | T20824 | T20823 | prep | with,treated |
R14923 | T20825 | T20824 | pobj | anti-Sox6,with |
R14924 | T20826 | T20825 | punct | ",",anti-Sox6 |
R14925 | T20827 | T20828 | det | a,second |
R14926 | T20828 | T20829 | amod | second,treated |
R14927 | T20829 | T20817 | conj | treated,split |
R14928 | T20830 | T20829 | prep | with,treated |
R14929 | T20831 | T20832 | amod | normal,rabbit |
R14930 | T20832 | T20833 | compound | rabbit,IgG |
R14931 | T20833 | T20830 | pobj | IgG,with |
R14932 | T20834 | T20829 | punct | ",",treated |
R14933 | T20835 | T20829 | cc | and,treated |
R14934 | T20836 | T20838 | det | the,sample |
R14935 | T20837 | T20838 | amod | third,sample |
R14936 | T20838 | T20829 | conj | sample,treated |
R14937 | T20839 | T20838 | prep | without,sample |
R14938 | T20840 | T20839 | pobj | Ab,without |
R14939 | T20841 | T20829 | punct | .,treated |
R14940 | T20842 | T20844 | det | The,two |
R14941 | T20843 | T20844 | amod | last,two |
R14942 | T20844 | T20846 | nsubjpass | two,used |
R14943 | T20845 | T20846 | auxpass | were,used |
R14944 | T20846 | T20846 | ROOT | used,used |
R14945 | T20847 | T20846 | prep | as,used |
R14946 | T20848 | T20849 | amod | negative,controls |
R14947 | T20849 | T20847 | pobj | controls,as |
R14948 | T20850 | T20846 | punct | .,used |
R14949 | T20851 | T20853 | det | The,complexes |
R14950 | T20852 | T20853 | amod | chromatin-antibody,complexes |
R14951 | T20853 | T20855 | nsubjpass | complexes,eluted |
R14952 | T20854 | T20855 | auxpass | were,eluted |
R14953 | T20855 | T20855 | ROOT | eluted,eluted |
R14954 | T20856 | T20855 | punct | ",",eluted |
R14955 | T20857 | T20855 | cc | and,eluted |
R14956 | T20858 | T20860 | det | the,protein |
R14957 | T20859 | T20860 | compound | DNA,protein |
R14958 | T20860 | T20861 | compound | protein,cross-links |
R14959 | T20861 | T20863 | nsubjpass | cross-links,reversed |
R14960 | T20862 | T20863 | auxpass | were,reversed |
R14961 | T20863 | T20855 | conj | reversed,eluted |
R14962 | T20864 | T20863 | prep | with,reversed |
R14963 | T20865 | T20867 | nummod | 5,NaCl |
R14964 | T20866 | T20867 | compound | M,NaCl |
R14965 | T20867 | T20864 | pobj | NaCl,with |
R14966 | T20868 | T20863 | prep | at,reversed |
R14967 | T20869 | T20871 | nummod | 65,C |
R14968 | T20870 | T20871 | nummod | °,C |
R14969 | T20871 | T20868 | pobj | C,at |
R14970 | T20872 | T20863 | prep | for,reversed |
R14971 | T20873 | T20874 | nummod | 4,h. |
R14972 | T20874 | T20876 | compound | h.,DNA |
R14973 | T20875 | T20876 | compound | Input,DNA |
R14974 | T20876 | T20872 | pobj | DNA,for |
R14975 | T20877 | T20876 | cc | or,DNA |
R14976 | T20878 | T20879 | amod | immunoprecipitated,DNA |
R14977 | T20879 | T20876 | conj | DNA,DNA |
R14978 | T20880 | T20881 | auxpass | was,used |
R14979 | T20881 | T20863 | conj | used,reversed |
R14980 | T20882 | T20881 | prep | as,used |
R14981 | T20883 | T20884 | det | a,template |
R14982 | T20884 | T20882 | pobj | template,as |
R14983 | T20885 | T20884 | prep | in,template |
R14984 | T20886 | T20888 | det | the,reaction |
R14985 | T20887 | T20888 | compound | PCR,reaction |
R14986 | T20888 | T20885 | pobj | reaction,in |
R14987 | T20889 | T20863 | punct | .,reversed |
R14988 | T20890 | T20891 | compound | PCR,amplification |
R14989 | T20891 | T20897 | nsubjpass | amplification,performed |
R14990 | T20892 | T20891 | prep | of,amplification |
R14991 | T20893 | T20895 | det | the,promoter |
R14992 | T20894 | T20895 | amod | ɛy,promoter |
R14993 | T20895 | T20892 | pobj | promoter,of |
R14994 | T20896 | T20897 | auxpass | was,performed |
R14995 | T20897 | T20897 | ROOT | performed,performed |
R14996 | T20898 | T20897 | cc | and,performed |
R14997 | T20899 | T20897 | conj | yielded,performed |
R14998 | T20900 | T20902 | det | a,amplicon |
R14999 | T20901 | T20902 | amod | 172-bp,amplicon |
R15000 | T20902 | T20899 | dobj | amplicon,yielded |
R15001 | T20903 | T20902 | punct | ",",amplicon |
R15002 | T20904 | T20902 | amod | corresponding,amplicon |
R15003 | T20905 | T20907 | aux | to,− |
R15004 | T20906 | T20905 | pobj | nucleotides,to |
R15005 | T20907 | T20904 | xcomp | −,corresponding |
R15006 | T20908 | T20910 | quantmod | 31,+140 |
R15007 | T20909 | T20910 | quantmod | to,+140 |
R15008 | T20910 | T20907 | dobj | +140,− |
R15009 | T20911 | T20910 | prep | of,+140 |
R15010 | T20912 | T20914 | det | the,promoter |
R15011 | T20913 | T20914 | amod | ɛy,promoter |
R15012 | T20914 | T20911 | pobj | promoter,of |
R15013 | T20915 | T20916 | punct | (,primers |
R15014 | T20916 | T20914 | appos | primers,promoter |
R15015 | T20917 | T20922 | nmod | MHB1688,′ |
R15016 | T20918 | T20917 | punct | ",",MHB1688 |
R15017 | T20919 | T20920 | nummod | 5,′ |
R15018 | T20920 | T20922 | nmod | ′,′ |
R15019 | T20921 | T20922 | nummod | CGAAGAATAAAAGGCCACCA3,′ |
R15020 | T20922 | T20916 | dobj | ′,primers |
R15021 | T20923 | T20916 | punct | ;,primers |
R15022 | T20924 | T20916 | cc | and,primers |
R15023 | T20925 | T20916 | conj | MHB1689,primers |
R15024 | T20926 | T20925 | punct | ",",MHB1689 |
R15025 | T20927 | T20928 | nummod | 5,′ |
R15026 | T20928 | T20930 | compound | ′,′ |
R15027 | T20929 | T20930 | compound | GCTTCACCACCAACCTCTTC3,′ |
R15028 | T20930 | T20925 | conj | ′,MHB1689 |
R15029 | T20931 | T20930 | punct | ),′ |
R15030 | T20932 | T20897 | punct | .,performed |
R15031 | T20933 | T20935 | nsubjpass | PCR,performed |
R15032 | T20934 | T20935 | auxpass | was,performed |
R15033 | T20935 | T20935 | ROOT | performed,performed |
R15034 | T20936 | T20935 | prep | under,performed |
R15035 | T20937 | T20939 | det | the,conditions |
R15036 | T20938 | T20939 | amod | following,conditions |
R15037 | T20939 | T20936 | pobj | conditions,under |
R15038 | T20940 | T20939 | punct | :,conditions |
R15039 | T20941 | T20942 | nummod | 95,° |
R15040 | T20942 | T20943 | compound | °,C |
R15041 | T20943 | T20939 | appos | C,conditions |
R15042 | T20944 | T20943 | prep | for,C |
R15043 | T20945 | T20946 | nummod | 15,min |
R15044 | T20946 | T20944 | pobj | min,for |
R15045 | T20947 | T20939 | acl | followed,conditions |
R15046 | T20948 | T20947 | agent | by,followed |
R15047 | T20949 | T20950 | nummod | 30,cycles |
R15048 | T20950 | T20948 | pobj | cycles,by |
R15049 | T20951 | T20950 | prep | at,cycles |
R15050 | T20952 | T20951 | pobj | 95,at |
R15051 | T20953 | T20954 | nummod | °,C |
R15052 | T20954 | T20950 | conj | C,cycles |
R15053 | T20955 | T20947 | prep | for,followed |
R15054 | T20956 | T20955 | pobj | 30,for |
R15055 | T20957 | T20939 | appos | s,conditions |
R15056 | T20958 | T20935 | punct | ",",performed |
R15057 | T20959 | T20960 | nummod | 60,° |
R15058 | T20960 | T20961 | compound | °,C |
R15059 | T20961 | T20935 | npadvmod | C,performed |
R15060 | T20962 | T20935 | prep | for,performed |
R15061 | T20963 | T20962 | pobj | 30,for |
R15062 | T20964 | T20935 | dep | s,performed |
R15063 | T20965 | T20935 | punct | ",",performed |
R15064 | T20966 | T20935 | cc | and,performed |
R15065 | T20967 | T20969 | nummod | 72,C |
R15066 | T20968 | T20969 | compound | °,C |
R15067 | T20969 | T20935 | conj | C,performed |
R15068 | T20970 | T20969 | prep | for,C |
R15069 | T20971 | T20970 | pobj | 45,for |
R15070 | T20972 | T20969 | appos | s,C |
R15071 | T20973 | T20969 | punct | ",",C |
R15072 | T20974 | T20935 | advcl | ending,performed |
R15073 | T20975 | T20974 | prep | with,ending |
R15074 | T20976 | T20978 | det | a,extension |
R15075 | T20977 | T20978 | amod | final,extension |
R15076 | T20978 | T20975 | pobj | extension,with |
R15077 | T20979 | T20978 | prep | at,extension |
R15078 | T20980 | T20981 | nummod | 72,° |
R15079 | T20981 | T20979 | pobj | °,at |
R15080 | T20982 | T20978 | npadvmod | C,extension |
R15081 | T20983 | T20978 | prep | for,extension |
R15082 | T20984 | T20985 | nummod | 5,min |
R15083 | T20985 | T20983 | pobj | min,for |
R15084 | T20986 | T20935 | punct | .,performed |
bionlp-st-ge-2016-test-tees
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20377 | 880-898 | Protein | denotes | chromatin-antibody |
T20376 | 793-796 | Protein | denotes | IgG |
T20375 | 751-755 | Protein | denotes | Sox6 |
testone
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20330 | 1210-1212 | Protein | denotes | ɛy |
T20329 | 1105-1107 | Protein | denotes | ɛy |
T20328 | 751-755 | Protein | denotes | Sox6 |
T20327 | 580-589 | Protein | denotes | protein A |
test3
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20338 | 1210-1212 | Protein | denotes | ɛy |
T20337 | 1105-1107 | Protein | denotes | ɛy |
T20336 | 751-755 | Protein | denotes | Sox6 |
T20335 | 580-589 | Protein | denotes | protein A |
T20334 | 1210-1212 | Protein | denotes | ɛy |
T20333 | 1105-1107 | Protein | denotes | ɛy |
T20332 | 751-755 | Protein | denotes | Sox6 |
T20331 | 580-589 | Protein | denotes | protein A |