PMC:1359074 / 33677-35285 JSON TXT

Annnotations TAB JSON ListView MergeView

2_test

{"project":"2_test","denotations":[{"id":"16462943-1737096-85761022","span":{"begin":383,"end":385},"obj":"1737096"},{"id":"16462943-2748594-85761023","span":{"begin":823,"end":825},"obj":"2748594"},{"id":"T43787","span":{"begin":383,"end":385},"obj":"1737096"},{"id":"T59528","span":{"begin":823,"end":825},"obj":"2748594"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

pmc-enju-pas

bionlp-st-ge-2016-test-proteins

{"project":"bionlp-st-ge-2016-test-proteins","denotations":[{"id":"T16048","span":{"begin":1041,"end":1043},"obj":"Protein"},{"id":"T16047","span":{"begin":989,"end":991},"obj":"Protein"},{"id":"T16046","span":{"begin":950,"end":960},"obj":"Protein"},{"id":"T16045","span":{"begin":862,"end":864},"obj":"Protein"},{"id":"T16044","span":{"begin":693,"end":703},"obj":"Protein"},{"id":"T16043","span":{"begin":648,"end":650},"obj":"Protein"},{"id":"T16042","span":{"begin":359,"end":367},"obj":"Protein"},{"id":"T16041","span":{"begin":249,"end":250},"obj":"Protein"},{"id":"T16040","span":{"begin":148,"end":157},"obj":"Protein"},{"id":"T16039","span":{"begin":92,"end":94},"obj":"Protein"},{"id":"T16038","span":{"begin":4,"end":6},"obj":"Protein"}],"namespaces":[{"prefix":"_base","uri":"http://bionlp.dbcls.jp/ontology/ge.owl#"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

bionlp-st-ge-2016-uniprot

{"project":"bionlp-st-ge-2016-uniprot","denotations":[{"id":"T16445","span":{"begin":950,"end":960},"obj":"http://www.uniprot.org/uniprot/P08659"},{"id":"T16444","span":{"begin":693,"end":703},"obj":"http://www.uniprot.org/uniprot/P08659"}],"namespaces":[{"prefix":"_base","uri":"http://www.uniprot.org/uniprot/"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

GO-BP

{"project":"GO-BP","denotations":[{"id":"T16013","span":{"begin":458,"end":473},"obj":"http://purl.obolibrary.org/obo/GO_0006351"},{"id":"T16012","span":{"begin":428,"end":441},"obj":"http://purl.obolibrary.org/obo/GO_0006351"},{"id":"T16011","span":{"begin":251,"end":265},"obj":"http://purl.obolibrary.org/obo/GO_0016458"},{"id":"T16010","span":{"begin":361,"end":367},"obj":"http://purl.obolibrary.org/obo/GO_0005344"},{"id":"T16009","span":{"begin":151,"end":157},"obj":"http://purl.obolibrary.org/obo/GO_0005344"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

GO-MF

{"project":"GO-MF","denotations":[{"id":"T16055","span":{"begin":361,"end":367},"obj":"http://purl.obolibrary.org/obo/GO_0005344"},{"id":"T16054","span":{"begin":151,"end":157},"obj":"http://purl.obolibrary.org/obo/GO_0005344"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

sentences

{"project":"sentences","denotations":[{"id":"T16004","span":{"begin":1473,"end":1608},"obj":"Sentence"},{"id":"T16003","span":{"begin":1079,"end":1472},"obj":"Sentence"},{"id":"T16002","span":{"begin":1002,"end":1078},"obj":"Sentence"},{"id":"T16001","span":{"begin":769,"end":1001},"obj":"Sentence"},{"id":"T16000","span":{"begin":571,"end":768},"obj":"Sentence"},{"id":"T15999","span":{"begin":454,"end":570},"obj":"Sentence"},{"id":"T15998","span":{"begin":388,"end":453},"obj":"Sentence"},{"id":"T15997","span":{"begin":114,"end":387},"obj":"Sentence"},{"id":"T15996","span":{"begin":0,"end":113},"obj":"Sentence"},{"id":"T252","span":{"begin":0,"end":113},"obj":"Sentence"},{"id":"T253","span":{"begin":114,"end":387},"obj":"Sentence"},{"id":"T254","span":{"begin":388,"end":453},"obj":"Sentence"},{"id":"T255","span":{"begin":454,"end":570},"obj":"Sentence"},{"id":"T256","span":{"begin":571,"end":768},"obj":"Sentence"},{"id":"T257","span":{"begin":769,"end":1001},"obj":"Sentence"},{"id":"T258","span":{"begin":1002,"end":1078},"obj":"Sentence"},{"id":"T259","span":{"begin":1079,"end":1472},"obj":"Sentence"},{"id":"T260","span":{"begin":1473,"end":1608},"obj":"Sentence"}],"namespaces":[{"prefix":"_base","uri":"http://pubannotation.org/ontology/tao.owl#"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

simple1

{"project":"simple1","denotations":[{"id":"T16067","span":{"begin":1041,"end":1043},"obj":"Protein"},{"id":"T16066","span":{"begin":989,"end":991},"obj":"Protein"},{"id":"T16065","span":{"begin":950,"end":960},"obj":"Protein"},{"id":"T16064","span":{"begin":862,"end":864},"obj":"Protein"},{"id":"T16063","span":{"begin":693,"end":703},"obj":"Protein"},{"id":"T16062","span":{"begin":648,"end":650},"obj":"Protein"},{"id":"T16061","span":{"begin":359,"end":367},"obj":"Protein"},{"id":"T16060","span":{"begin":249,"end":250},"obj":"Protein"},{"id":"T16059","span":{"begin":148,"end":157},"obj":"Protein"},{"id":"T16058","span":{"begin":92,"end":94},"obj":"Protein"},{"id":"T16057","span":{"begin":4,"end":6},"obj":"Protein"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

BioNLP16_DUT

{"project":"BioNLP16_DUT","denotations":[{"id":"T17094","span":{"begin":975,"end":981},"obj":"Positive_regulation"},{"id":"T17093","span":{"begin":961,"end":971},"obj":"Gene_expression"},{"id":"T17092","span":{"begin":256,"end":265},"obj":"Negative_regulation"},{"id":"T17086","span":{"begin":1041,"end":1043},"obj":"Protein"},{"id":"T17085","span":{"begin":950,"end":960},"obj":"Protein"},{"id":"T17084","span":{"begin":862,"end":864},"obj":"Protein"},{"id":"T17083","span":{"begin":989,"end":991},"obj":"Protein"},{"id":"T17082","span":{"begin":693,"end":703},"obj":"Protein"},{"id":"T17081","span":{"begin":648,"end":650},"obj":"Protein"},{"id":"T17080","span":{"begin":359,"end":367},"obj":"Protein"},{"id":"T17079","span":{"begin":249,"end":250},"obj":"Protein"},{"id":"T17078","span":{"begin":148,"end":157},"obj":"Protein"},{"id":"T17077","span":{"begin":92,"end":94},"obj":"Protein"},{"id":"T17076","span":{"begin":4,"end":6},"obj":"Protein"}],"relations":[{"id":"R11932","pred":"themeOf","subj":"T17079","obj":"T17092"},{"id":"R11933","pred":"themeOf","subj":"T17085","obj":"T17093"},{"id":"R11935","pred":"themeOf","subj":"T17093","obj":"T17094"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

BioNLP16_Messiy

{"project":"BioNLP16_Messiy","denotations":[{"id":"T16456","span":{"begin":648,"end":650},"obj":"Protein"},{"id":"T16455","span":{"begin":359,"end":367},"obj":"Protein"},{"id":"T16454","span":{"begin":249,"end":250},"obj":"Protein"},{"id":"T16453","span":{"begin":148,"end":157},"obj":"Protein"},{"id":"T16452","span":{"begin":92,"end":94},"obj":"Protein"},{"id":"T16451","span":{"begin":4,"end":6},"obj":"Protein"},{"id":"T16470","span":{"begin":961,"end":971},"obj":"Gene_expression"},{"id":"T16469","span":{"begin":236,"end":244},"obj":"Positive_regulation"},{"id":"T16468","span":{"begin":256,"end":265},"obj":"Negative_regulation"},{"id":"T16467","span":{"begin":16,"end":24},"obj":"Negative_regulation"},{"id":"T16461","span":{"begin":1041,"end":1043},"obj":"Protein"},{"id":"T16460","span":{"begin":950,"end":960},"obj":"Protein"},{"id":"T16459","span":{"begin":862,"end":864},"obj":"Protein"},{"id":"T16458","span":{"begin":989,"end":991},"obj":"Protein"},{"id":"T16457","span":{"begin":693,"end":703},"obj":"Protein"}],"relations":[{"id":"R11455","pred":"themeOf","subj":"T16451","obj":"T16467"},{"id":"R11456","pred":"themeOf","subj":"T16454","obj":"T16468"},{"id":"R11457","pred":"themeOf","subj":"T16460","obj":"T16470"},{"id":"R11460","pred":"themeOf","subj":"T16468","obj":"T16469"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

DLUT931

{"project":"DLUT931","denotations":[{"id":"T16540","span":{"begin":961,"end":971},"obj":"Gene_expression"},{"id":"T16539","span":{"begin":236,"end":244},"obj":"Positive_regulation"},{"id":"T16538","span":{"begin":256,"end":265},"obj":"Negative_regulation"},{"id":"T16537","span":{"begin":16,"end":24},"obj":"Negative_regulation"},{"id":"T16531","span":{"begin":1041,"end":1043},"obj":"Protein"},{"id":"T16530","span":{"begin":950,"end":960},"obj":"Protein"},{"id":"T16529","span":{"begin":862,"end":864},"obj":"Protein"},{"id":"T16528","span":{"begin":989,"end":991},"obj":"Protein"},{"id":"T16527","span":{"begin":693,"end":703},"obj":"Protein"},{"id":"T16526","span":{"begin":648,"end":650},"obj":"Protein"},{"id":"T16525","span":{"begin":359,"end":367},"obj":"Protein"},{"id":"T16524","span":{"begin":249,"end":250},"obj":"Protein"},{"id":"T16523","span":{"begin":148,"end":157},"obj":"Protein"},{"id":"T16522","span":{"begin":92,"end":94},"obj":"Protein"},{"id":"T16521","span":{"begin":4,"end":6},"obj":"Protein"}],"relations":[{"id":"R11469","pred":"themeOf","subj":"T16521","obj":"T16537"},{"id":"R11470","pred":"themeOf","subj":"T16524","obj":"T16538"},{"id":"R11471","pred":"themeOf","subj":"T16530","obj":"T16540"},{"id":"R11474","pred":"themeOf","subj":"T16538","obj":"T16539"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

bionlp-st-ge-2016-test-ihmc

bionlp-st-ge-2016-spacy-parsed

bionlp-st-ge-2016-test-tees

{"project":"bionlp-st-ge-2016-test-tees","denotations":[{"id":"T16499","span":{"begin":778,"end":782},"obj":"Protein"},{"id":"T16498","span":{"begin":587,"end":596},"obj":"Gene_expression"},{"id":"T16497","span":{"begin":587,"end":596},"obj":"Gene_expression"},{"id":"T16496","span":{"begin":712,"end":716},"obj":"Protein"},{"id":"T16495","span":{"begin":685,"end":708},"obj":"Protein"},{"id":"T16494","span":{"begin":606,"end":619},"obj":"Protein"},{"id":"T16493","span":{"begin":597,"end":601},"obj":"Protein"},{"id":"T16492","span":{"begin":359,"end":372},"obj":"Protein"},{"id":"T16491","span":{"begin":294,"end":299},"obj":"Protein"},{"id":"T16490","span":{"begin":148,"end":157},"obj":"Protein"},{"id":"T16489","span":{"begin":92,"end":112},"obj":"Protein"},{"id":"T16507","span":{"begin":1556,"end":1563},"obj":"Protein"},{"id":"T16506","span":{"begin":1542,"end":1554},"obj":"Protein"},{"id":"T16505","span":{"begin":1416,"end":1423},"obj":"Protein"},{"id":"T16504","span":{"begin":1103,"end":1112},"obj":"Protein"},{"id":"T16503","span":{"begin":961,"end":971},"obj":"Gene_expression"},{"id":"T16502","span":{"begin":950,"end":960},"obj":"Protein"},{"id":"T16501","span":{"begin":800,"end":809},"obj":"Protein"},{"id":"T16500","span":{"begin":783,"end":787},"obj":"Protein"}],"relations":[{"id":"R11461","pred":"themeOf","subj":"T16493","obj":"T16497"},{"id":"R11462","pred":"themeOf","subj":"T16494","obj":"T16498"},{"id":"R11463","pred":"themeOf","subj":"T16502","obj":"T16503"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

testone

{"project":"testone","denotations":[{"id":"T15960","span":{"begin":975,"end":981},"obj":"Positive_regulation"},{"id":"T15959","span":{"begin":961,"end":971},"obj":"Gene_expression"},{"id":"T15958","span":{"begin":256,"end":265},"obj":"Negative_regulation"},{"id":"T15952","span":{"begin":1041,"end":1043},"obj":"Protein"},{"id":"T15951","span":{"begin":989,"end":991},"obj":"Protein"},{"id":"T15950","span":{"begin":950,"end":960},"obj":"Protein"},{"id":"T15949","span":{"begin":862,"end":864},"obj":"Protein"},{"id":"T15948","span":{"begin":693,"end":703},"obj":"Protein"},{"id":"T15947","span":{"begin":648,"end":650},"obj":"Protein"},{"id":"T15946","span":{"begin":359,"end":367},"obj":"Protein"},{"id":"T15945","span":{"begin":249,"end":250},"obj":"Protein"},{"id":"T15944","span":{"begin":148,"end":157},"obj":"Protein"},{"id":"T15943","span":{"begin":92,"end":94},"obj":"Protein"},{"id":"T15942","span":{"begin":4,"end":6},"obj":"Protein"}],"relations":[{"id":"R11066","pred":"themeOf","subj":"T15945","obj":"T15958"},{"id":"R11067","pred":"themeOf","subj":"T15950","obj":"T15959"},{"id":"R11068","pred":"themeOf","subj":"T15959","obj":"T15960"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

test3

{"project":"test3","denotations":[{"id":"T15989","span":{"begin":1041,"end":1043},"obj":"Protein"},{"id":"T15988","span":{"begin":989,"end":991},"obj":"Protein"},{"id":"T15987","span":{"begin":975,"end":981},"obj":"Positive_regulation"},{"id":"T15986","span":{"begin":961,"end":971},"obj":"Gene_expression"},{"id":"T15985","span":{"begin":950,"end":960},"obj":"Protein"},{"id":"T15984","span":{"begin":862,"end":864},"obj":"Protein"},{"id":"T15983","span":{"begin":693,"end":703},"obj":"Protein"},{"id":"T15982","span":{"begin":648,"end":650},"obj":"Protein"},{"id":"T15981","span":{"begin":359,"end":367},"obj":"Protein"},{"id":"T15980","span":{"begin":249,"end":250},"obj":"Protein"},{"id":"T15979","span":{"begin":148,"end":157},"obj":"Protein"},{"id":"T15978","span":{"begin":92,"end":94},"obj":"Protein"},{"id":"T15977","span":{"begin":4,"end":6},"obj":"Protein"},{"id":"T15971","span":{"begin":1041,"end":1043},"obj":"Protein"},{"id":"T15970","span":{"begin":989,"end":991},"obj":"Protein"},{"id":"T15969","span":{"begin":950,"end":960},"obj":"Protein"},{"id":"T15968","span":{"begin":862,"end":864},"obj":"Protein"},{"id":"T15967","span":{"begin":693,"end":703},"obj":"Protein"},{"id":"T15966","span":{"begin":648,"end":650},"obj":"Protein"},{"id":"T15965","span":{"begin":359,"end":367},"obj":"Protein"},{"id":"T15964","span":{"begin":249,"end":250},"obj":"Protein"},{"id":"T15963","span":{"begin":148,"end":157},"obj":"Protein"},{"id":"T15962","span":{"begin":92,"end":94},"obj":"Protein"},{"id":"T15961","span":{"begin":4,"end":6},"obj":"Protein"}],"relations":[{"id":"R11069","pred":"themeOf","subj":"T15985","obj":"T15986"},{"id":"R11070","pred":"themeOf","subj":"T15986","obj":"T15987"}],"text":"The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20)."}

PMC:1359074 / 33677-35285 JSONTXT

Annnotations TAB JSON ListView MergeView

PMC:1359074 / 33677-35285 JSON TXT