Id |
Subject |
Object |
Predicate |
Lexical cue |
T15988 |
25-29 |
VBN |
denotes |
used |
T15995 |
11-20 |
NN |
denotes |
construct |
T15997 |
6-10 |
NN |
denotes |
AQP2 |
T15998 |
21-24 |
VBD |
denotes |
was |
T15999 |
30-32 |
IN |
denotes |
in |
T16000 |
33-34 |
DT |
denotes |
a |
T16001 |
39-47 |
NN |
denotes |
reaction |
T16002 |
35-38 |
NN |
denotes |
PCR |
T16003 |
48-52 |
IN |
denotes |
with |
T16004 |
53-56 |
DT |
denotes |
the |
T16005 |
65-68 |
NN |
denotes |
Sp6 |
T16006 |
57-64 |
NNS |
denotes |
primers |
T16007 |
69-72 |
CC |
denotes |
and |
T16008 |
73-74 |
CD |
denotes |
5 |
T16009 |
76-108 |
NN |
denotes |
GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
T16010 |
74-75 |
SYM |
denotes |
′ |
T16011 |
75-76 |
HYPH |
denotes |
- |
T16012 |
108-109 |
HYPH |
denotes |
- |
T16013 |
109-110 |
CD |
denotes |
3 |
T16014 |
110-111 |
SYM |
denotes |
′ |
T16015 |
112-114 |
TO |
denotes |
to |
T16016 |
115-121 |
VB |
denotes |
remove |
T16017 |
122-125 |
DT |
denotes |
the |
T16018 |
131-136 |
NN |
denotes |
codon |
T16019 |
126-130 |
NN |
denotes |
stop |
T16020 |
137-139 |
IN |
denotes |
of |
T16021 |
140-144 |
NN |
denotes |
AQP2 |
T16022 |
144-145 |
. |
denotes |
. |
T16024 |
146-149 |
DT |
denotes |
The |
R4636 |
T15995 |
T15988 |
nsubjpass |
construct,used |
R4638 |
T15997 |
T15995 |
compound |
AQP2,construct |
R4639 |
T15998 |
T15988 |
auxpass |
was,used |
R4640 |
T15999 |
T15988 |
prep |
in,used |
R4641 |
T16000 |
T16001 |
det |
a,reaction |
R4642 |
T16001 |
T15999 |
pobj |
reaction,in |
R4643 |
T16002 |
T16001 |
compound |
PCR,reaction |
R4644 |
T16003 |
T16001 |
prep |
with,reaction |
R4645 |
T16004 |
T16005 |
det |
the,Sp6 |
R4646 |
T16005 |
T16003 |
pobj |
Sp6,with |
R4647 |
T16006 |
T16005 |
compound |
primers,Sp6 |
R4648 |
T16007 |
T16005 |
cc |
and,Sp6 |
R4649 |
T16008 |
T16009 |
nummod |
5,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4650 |
T16009 |
T16005 |
conj |
GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG,Sp6 |
R4651 |
T16010 |
T16008 |
punct |
′,5 |
R4652 |
T16011 |
T16009 |
punct |
-,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4653 |
T16012 |
T16009 |
punct |
-,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4654 |
T16013 |
T16009 |
nummod |
3,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4655 |
T16014 |
T16009 |
punct |
′,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4656 |
T16015 |
T16016 |
aux |
to,remove |
R4657 |
T16016 |
T15988 |
advcl |
remove,used |
R4658 |
T16017 |
T16018 |
det |
the,codon |
R4659 |
T16018 |
T16016 |
dobj |
codon,remove |
R4660 |
T16019 |
T16018 |
compound |
stop,codon |
R4661 |
T16020 |
T16018 |
prep |
of,codon |
R4662 |
T16021 |
T16020 |
pobj |
AQP2,of |
R4663 |
T16022 |
T15988 |
punct |
.,used |