Cloning of Y87G2A.14 from C.elegans
A cDNA corresponding to the C. elegans Y87G2A.14 gene on chromosome 1 (GenBank accession no. CAB54476) was amplified from a cDNA library by PCR using as forward and reverse primers 5' GCAAATCATGAAGTGTGTGGTTAGCCGAGCTG 3' and 5' TAAATGAATTCACTAAATTTTGGATTTCGGTTC 3' respectively. These primers provided a BspH1 restriction site at the start of the amplified gene and an EcoR1 site at the end. After amplification with Pfu DNA polymerase, the DNA was recovered by phenol/chloroform extraction and digested with BspH1 and EcoR1. The digest was gel-purified and the restriction fragment ligated into the Nco1 and EcoR1 restriction sites of pET-32b(+) as both BspH1 and Nco1 form compatible ends with each other. The resulting construct, pETY87G2A.14, yielded Y87G2A.14 downstream of the 109-amino acid thioredoxin (Trx) fusion and His-tag and S-tag sequences under the control of an IPTG-inducible promoter. The structure of the insert was confirmed by sequencing. The construct was propagated by transformation of E. coli XL1-Blue cells.