CORD-19:b75e7f3f923023185daed6f29e5beca4eddfc109 JSONTXT

Annnotations TAB JSON ListView MergeView

CORD-19-PD-HP

Id Subject Object Predicate Lexical cue hp_id
T1 189-194 Phenotype denotes fever http://purl.obolibrary.org/obo/HP_0001945
T2 1173-1178 Phenotype denotes tumor http://purl.obolibrary.org/obo/HP_0002664
T3 2769-2774 Phenotype denotes fever http://purl.obolibrary.org/obo/HP_0001945
T4 2997-3002 Phenotype denotes fever http://purl.obolibrary.org/obo/HP_0001945
T5 3763-3768 Phenotype denotes fever http://purl.obolibrary.org/obo/HP_0001945
T6 3794-3799 Phenotype denotes fever http://purl.obolibrary.org/obo/HP_0001945
T7 33147-33157 Phenotype denotes stomatitis http://purl.obolibrary.org/obo/HP_0010280
T8 33200-33216 Phenotype denotes immunodeficiency http://purl.obolibrary.org/obo/HP_0002721
T9 39007-39012 Phenotype denotes fever http://purl.obolibrary.org/obo/HP_0001945
T10 45976-45985 Phenotype denotes hepatitis http://purl.obolibrary.org/obo/HP_0012115
T11 50929-50938 Phenotype denotes agitation http://purl.obolibrary.org/obo/HP_0000713

CORD-19-PD-MONDO

Id Subject Object Predicate Lexical cue mondo_id
T55832 1173-1178 Disease denotes tumor http://purl.obolibrary.org/obo/MONDO_0005070
T1 1173-1178 Disease denotes tumor http://purl.obolibrary.org/obo/MONDO_0005070
T84931 2763-2774 Disease denotes Lassa fever http://purl.obolibrary.org/obo/MONDO_0005820
T2 2763-2774 Disease denotes Lassa fever http://purl.obolibrary.org/obo/MONDO_0005820
T90800 2991-3002 Disease denotes Lassa fever http://purl.obolibrary.org/obo/MONDO_0005820
T3 2991-3002 Disease denotes Lassa fever http://purl.obolibrary.org/obo/MONDO_0005820
T99212 3524-3552 Disease denotes lymphocytic choriomeningitis http://purl.obolibrary.org/obo/MONDO_0001449
T4 3524-3552 Disease denotes lymphocytic choriomeningitis http://purl.obolibrary.org/obo/MONDO_0001449
T70557 3741-3768 Disease denotes Argentine hemorrhagic fever http://purl.obolibrary.org/obo/MONDO_0017874
T5 3741-3768 Disease denotes Argentine hemorrhagic fever http://purl.obolibrary.org/obo/MONDO_0017874
T54864 3773-3799 Disease denotes Bolivian hemorrhagic fever http://purl.obolibrary.org/obo/MONDO_0017875
T6 3773-3799 Disease denotes Bolivian hemorrhagic fever http://purl.obolibrary.org/obo/MONDO_0017875
T96123 5549-5558 Disease denotes influenza http://purl.obolibrary.org/obo/MONDO_0005812
T7 5549-5558 Disease denotes influenza http://purl.obolibrary.org/obo/MONDO_0005812
T65711 19308-19317 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T8 19308-19317 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T17600 19405-19414 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T9 19405-19414 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T27142 19720-19729 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T10 19720-19729 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T18086 21188-21197 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T11 21188-21197 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T27763 22782-22791 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T12 22782-22791 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T35274 22933-22942 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T13 22933-22942 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T90309 25154-25169 Disease denotes virus infection http://purl.obolibrary.org/obo/MONDO_0005108
T14 25154-25169 Disease denotes virus infection http://purl.obolibrary.org/obo/MONDO_0005108
T28362 25160-25169 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T15 25160-25169 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T52105 33137-33157 Disease denotes vesicular stomatitis http://purl.obolibrary.org/obo/MONDO_0025028
T16 33137-33157 Disease denotes vesicular stomatitis http://purl.obolibrary.org/obo/MONDO_0025028
T84714 33147-33157 Disease denotes stomatitis http://purl.obolibrary.org/obo/MONDO_0004842
T17 33147-33157 Disease denotes stomatitis http://purl.obolibrary.org/obo/MONDO_0004842
T12729 33171-33180 Disease denotes influenza http://purl.obolibrary.org/obo/MONDO_0005812
T18 33171-33180 Disease denotes influenza http://purl.obolibrary.org/obo/MONDO_0005812
T86688 33200-33216 Disease denotes immunodeficiency http://purl.obolibrary.org/obo/MONDO_0021094
T19 33200-33216 Disease denotes immunodeficiency http://purl.obolibrary.org/obo/MONDO_0021094
T99020 33257-33266 Disease denotes influenza http://purl.obolibrary.org/obo/MONDO_0005812
T20 33257-33266 Disease denotes influenza http://purl.obolibrary.org/obo/MONDO_0005812
T32371 34539-34548 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T21 34539-34548 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T58377 36510-36516 Disease denotes dengue http://purl.obolibrary.org/obo/MONDO_0005502
T22 36510-36516 Disease denotes dengue http://purl.obolibrary.org/obo/MONDO_0005502
T36836 36554-36557 Disease denotes NS1 http://purl.obolibrary.org/obo/MONDO_0008104
T23 36554-36557 Disease denotes NS1 http://purl.obolibrary.org/obo/MONDO_0008104
T63915 36559-36562 Disease denotes NS3 http://purl.obolibrary.org/obo/MONDO_0012371
T24 36559-36562 Disease denotes NS3 http://purl.obolibrary.org/obo/MONDO_0012371
T31067 37307-37310 Disease denotes NS1 http://purl.obolibrary.org/obo/MONDO_0008104
T25 37307-37310 Disease denotes NS1 http://purl.obolibrary.org/obo/MONDO_0008104
T4405 37490-37493 Disease denotes NS1 http://purl.obolibrary.org/obo/MONDO_0008104
T26 37490-37493 Disease denotes NS1 http://purl.obolibrary.org/obo/MONDO_0008104
T84964 37589-37598 Disease denotes influenza http://purl.obolibrary.org/obo/MONDO_0005812
T27 37589-37598 Disease denotes influenza http://purl.obolibrary.org/obo/MONDO_0005812
T44245 37827-37837 Disease denotes infectious http://purl.obolibrary.org/obo/MONDO_0005550
T28 37827-37837 Disease denotes infectious http://purl.obolibrary.org/obo/MONDO_0005550
T21985 39001-39012 Disease denotes Lassa fever http://purl.obolibrary.org/obo/MONDO_0005820
T29 39001-39012 Disease denotes Lassa fever http://purl.obolibrary.org/obo/MONDO_0005820
T97673 39088-39097 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T30 39088-39097 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T35330 42095-42103 Disease denotes pancreas http://purl.obolibrary.org/obo/MONDO_0021040
T31 42095-42103 Disease denotes pancreas http://purl.obolibrary.org/obo/MONDO_0021040
T84126 42344-42359 Disease denotes virus infection http://purl.obolibrary.org/obo/MONDO_0005108
T32 42344-42359 Disease denotes virus infection http://purl.obolibrary.org/obo/MONDO_0005108
T57611 42350-42359 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T33 42350-42359 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T53808 45174-45176 Disease denotes HD http://purl.obolibrary.org/obo/MONDO_0007739
T34 45174-45176 Disease denotes HD http://purl.obolibrary.org/obo/MONDO_0007739
T15453 45976-45985 Disease denotes hepatitis http://purl.obolibrary.org/obo/MONDO_0002251
T54425 45976-45991 Disease denotes hepatitis delta http://purl.obolibrary.org/obo/MONDO_0005789
T36 45976-45985 Disease denotes hepatitis http://purl.obolibrary.org/obo/MONDO_0002251
T35 45976-45991 Disease denotes hepatitis delta http://purl.obolibrary.org/obo/MONDO_0005789
T7947 46157-46159 Disease denotes HD http://purl.obolibrary.org/obo/MONDO_0007739
T37 46157-46159 Disease denotes HD http://purl.obolibrary.org/obo/MONDO_0007739
T30007 50673-50676 Disease denotes TBS http://purl.obolibrary.org/obo/MONDO_0007142
T38 50673-50676 Disease denotes TBS http://purl.obolibrary.org/obo/MONDO_0007142
T98183 50860-50863 Disease denotes TBS http://purl.obolibrary.org/obo/MONDO_0007142
T39 50860-50863 Disease denotes TBS http://purl.obolibrary.org/obo/MONDO_0007142
T58793 55398-55400 Disease denotes TB http://purl.obolibrary.org/obo/MONDO_0018076
T40 55398-55400 Disease denotes TB http://purl.obolibrary.org/obo/MONDO_0018076

CORD-19-PD-UBERON

Id Subject Object Predicate Lexical cue uberon_id
T1 6408-6413 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T2 9127-9132 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T3 14260-14265 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T4 38483-38488 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T5 42017-42022 Body_part denotes brain http://purl.obolibrary.org/obo/UBERON_0000955
T6 42024-42028 Body_part denotes lung http://purl.obolibrary.org/obo/UBERON_0002048
T7 42034-42040 Body_part denotes kidney http://purl.obolibrary.org/obo/UBERON_0002113
T8 42057-42065 Body_part denotes placenta http://purl.obolibrary.org/obo/UBERON_0001987
T9 42067-42072 Body_part denotes liver http://purl.obolibrary.org/obo/UBERON_0002107
T10 42095-42103 Body_part denotes pancreas http://purl.obolibrary.org/obo/UBERON_0001264
T11 42197-42203 Body_part denotes tissue http://purl.obolibrary.org/obo/UBERON_0000479
T12 42326-42332 Body_part denotes tissue http://purl.obolibrary.org/obo/UBERON_0000479
T13 42831-42835 Body_part denotes face http://purl.obolibrary.org/obo/UBERON_0001456
T14 44976-44981 Body_part denotes scale http://purl.obolibrary.org/obo/UBERON_0002542
T15 50632-50636 Body_part denotes milk http://purl.obolibrary.org/obo/UBERON_0001913
T16 56408-56412 Body_part denotes milk http://purl.obolibrary.org/obo/UBERON_0001913
T17 56534-56539 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T18 57533-57538 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977

CORD-19-Sentences

Id Subject Object Predicate Lexical cue
T79685 0-113 Sentence denotes Comprehensive Interactome Analysis Reveals that STT3B Is Required for N-Glycosylation of Lassa Virus Glycoprotein
TextSentencer_T1 0-113 Sentence denotes Comprehensive Interactome Analysis Reveals that STT3B Is Required for N-Glycosylation of Lassa Virus Glycoprotein
T82632 115-123 Sentence denotes Abstract
TextSentencer_T2 115-123 Sentence denotes Abstract
T19032 124-205 Sentence denotes Lassa virus (LASV) is the causative agent of a fatal hemorrhagic fever in humans.
TextSentencer_T3 124-205 Sentence denotes Lassa virus (LASV) is the causative agent of a fatal hemorrhagic fever in humans.
T84782 206-376 Sentence denotes The glycoprotein (GP) of LASV mediates viral entry into host cells, and correct processing and modification of GP by host factors is a prerequisite for virus replication.
TextSentencer_T4 206-376 Sentence denotes The glycoprotein (GP) of LASV mediates viral entry into host cells, and correct processing and modification of GP by host factors is a prerequisite for virus replication.
T15478 377-518 Sentence denotes Here, using an affinity purification-coupled mass spectrometry (AP-MS) strategy, 591 host proteins were identified as interactors of LASV GP.
TextSentencer_T5 377-518 Sentence denotes Here, using an affinity purification-coupled mass spectrometry (AP-MS) strategy, 591 host proteins were identified as interactors of LASV GP.
T37459 519-665 Sentence denotes Gene ontology analysis was performed to functionally annotate these proteins, and the oligosaccharyltransferase (OST) complex was highly enriched.
TextSentencer_T6 519-665 Sentence denotes Gene ontology analysis was performed to functionally annotate these proteins, and the oligosaccharyltransferase (OST) complex was highly enriched.
T28657 666-960 Sentence denotes Functional studies conducted by using CRISPR-Cas9-mediated knockouts showed that STT3A and STT3B, the two catalytically active isoforms of the OST complex, are essential for the propagation of the recombinant arenavirus rLCMV/LASV glycoprotein precursor, mainly via affecting virus infectivity.
TextSentencer_T7 666-960 Sentence denotes Functional studies conducted by using CRISPR-Cas9-mediated knockouts showed that STT3A and STT3B, the two catalytically active isoforms of the OST complex, are essential for the propagation of the recombinant arenavirus rLCMV/LASV glycoprotein precursor, mainly via affecting virus infectivity.
T90422 961-1104 Sentence denotes Knockout of STT3B, but not STT3A, caused hypoglycosylation of LASV GP, indicating a preferential requirement of LASV for the STT3B-OST isoform.
TextSentencer_T8 961-1104 Sentence denotes Knockout of STT3B, but not STT3A, caused hypoglycosylation of LASV GP, indicating a preferential requirement of LASV for the STT3B-OST isoform.
T74342 1105-1319 Sentence denotes Furthermore, double knockout of magnesium transporter 1 (MAGT1) and tumor suppressor candidate 3 (TUSC3), two specific subunits of STT3B-OST, also caused hypoglycosylation of LASV GP and affected virus propagation.
TextSentencer_T9 1105-1319 Sentence denotes Furthermore, double knockout of magnesium transporter 1 (MAGT1) and tumor suppressor candidate 3 (TUSC3), two specific subunits of STT3B-OST, also caused hypoglycosylation of LASV GP and affected virus propagation.
T6100 1320-1475 Sentence denotes Site-directed mutagenesis analysis revealed that the oxidoreductase CXXC active-site motif of MAGT1 or TUSC3 is essential for the glycosylation of LASV GP.
TextSentencer_T10 1320-1475 Sentence denotes Site-directed mutagenesis analysis revealed that the oxidoreductase CXXC active-site motif of MAGT1 or TUSC3 is essential for the glycosylation of LASV GP.
T32741 1476-1589 Sentence denotes NGI-1, a small-molecule OST inhibitor, can effectively reduce virus infectivity without affecting cell viability.
TextSentencer_T11 1476-1589 Sentence denotes NGI-1, a small-molecule OST inhibitor, can effectively reduce virus infectivity without affecting cell viability.
T40222 1590-1720 Sentence denotes The STT3Bdependent N-glycosylation of GP is conserved among other arenaviruses, including both the Old World and New World groups.
TextSentencer_T12 1590-1720 Sentence denotes The STT3Bdependent N-glycosylation of GP is conserved among other arenaviruses, including both the Old World and New World groups.
T61931 1721-1866 Sentence denotes Our study provided a systematic view of LASV GP-host interactions and revealed the preferential requirement of STT3B for LASV GP N-glycosylation.
TextSentencer_T13 1721-1866 Sentence denotes Our study provided a systematic view of LASV GP-host interactions and revealed the preferential requirement of STT3B for LASV GP N-glycosylation.
T63906 1867-2013 Sentence denotes IMPORTANCE Glycoproteins play vital roles in the arenavirus life cycle by facilitating virus entry and participating in the virus budding process.
TextSentencer_T14 1867-2013 Sentence denotes IMPORTANCE Glycoproteins play vital roles in the arenavirus life cycle by facilitating virus entry and participating in the virus budding process.
T99662 2014-2174 Sentence denotes N-glycosylation of GPs is responsible for their proper functioning; however, little is known about the host factors on which the virus depends for this process.
TextSentencer_T15 2014-2174 Sentence denotes N-glycosylation of GPs is responsible for their proper functioning; however, little is known about the host factors on which the virus depends for this process.
T52166 2175-2389 Sentence denotes In this study, a comprehensive LASV GP interactome was characterized, and further study revealed that STT3Bdependent N-glycosylation was preferentially required by arenavirus GPs and critical for virus infectivity.
TextSentencer_T16 2175-2389 Sentence denotes In this study, a comprehensive LASV GP interactome was characterized, and further study revealed that STT3Bdependent N-glycosylation was preferentially required by arenavirus GPs and critical for virus infectivity.
T39281 2390-2520 Sentence denotes The two specific thioredoxin subunits of STT3B-OST MAGT1 and TUSC3 were found to be essential for the N-glycosylation of viral GP.
TextSentencer_T17 2390-2520 Sentence denotes The two specific thioredoxin subunits of STT3B-OST MAGT1 and TUSC3 were found to be essential for the N-glycosylation of viral GP.
T14943 2521-2615 Sentence denotes NGI-1, a smallmolecule inhibitor of OST, also showed a robust inhibitory effect on arenavirus.
TextSentencer_T18 2521-2615 Sentence denotes NGI-1, a smallmolecule inhibitor of OST, also showed a robust inhibitory effect on arenavirus.
T20089 2616-2789 Sentence denotes Our study provides new insights into LASV GP-host interactions and extends the potential targets for the development of novel therapeutics against Lassa fever in the future.
TextSentencer_T19 2616-2789 Sentence denotes Our study provides new insights into LASV GP-host interactions and extends the potential targets for the development of novel therapeutics against Lassa fever in the future.
T80618 2791-2884 Sentence denotes 2018 and led to more than 100 deaths, reemphasizing the threat of LASV on public health (4) .
TextSentencer_T20 2791-2884 Sentence denotes 2018 and led to more than 100 deaths, reemphasizing the threat of LASV on public health (4) .
T27153 2885-3118 Sentence denotes There is no U.S Food and Drug Administration-approved vaccine for LASV, and the only treatment option for Lassa fever is the nucleoside analog drug ribavirin, which is most effective when given in the early stage of the disease (5) .
TextSentencer_T21 2885-3118 Sentence denotes There is no U.S Food and Drug Administration-approved vaccine for LASV, and the only treatment option for Lassa fever is the nucleoside analog drug ribavirin, which is most effective when given in the early stage of the disease (5) .
T66308 3119-3266 Sentence denotes Due to its high morbidity and mortality rates, LASV is classified as a biosafety level 4 (BSL-4) agent (6) and a category A priority pathogen (7) .
TextSentencer_T22 3119-3266 Sentence denotes Due to its high morbidity and mortality rates, LASV is classified as a biosafety level 4 (BSL-4) agent (6) and a category A priority pathogen (7) .
T88595 3267-3435 Sentence denotes LASV belongs to the Mammarenavirus genus (member of the Arenaviridae family) (8), a genus of enveloped, negative-strand RNA viruses that can be divided into two groups:
TextSentencer_T23 3267-3435 Sentence denotes LASV belongs to the Mammarenavirus genus (member of the Arenaviridae family) (8), a genus of enveloped, negative-strand RNA viruses that can be divided into two groups:
T688 3436-3475 Sentence denotes Old World (OW) and New World (NW) (9) .
TextSentencer_T24 3436-3475 Sentence denotes Old World (OW) and New World (NW) (9) .
T97884 3476-3819 Sentence denotes The OW family of arenaviruses includes LASV and lymphocytic choriomeningitis virus (LCMV), a neglected human pathogen distributed worldwide (10, 11) , while the NW family of arenaviruses includes Junín virus (JUNV) and Machupo virus (MACV), the causative agents of Argentine hemorrhagic fever and Bolivian hemorrhagic fever, respectively (9) .
TextSentencer_T25 3476-3819 Sentence denotes The OW family of arenaviruses includes LASV and lymphocytic choriomeningitis virus (LCMV), a neglected human pathogen distributed worldwide (10, 11) , while the NW family of arenaviruses includes Junín virus (JUNV) and Machupo virus (MACV), the causative agents of Argentine hemorrhagic fever and Bolivian hemorrhagic fever, respectively (9) .
T8159 3820-3987 Sentence denotes The glycoprotein (GP) of LASV forms spikes on the surface of the virion and is the sole antigen responsible for eliciting a virus-neutralizing antibody response (12) .
TextSentencer_T26 3820-3987 Sentence denotes The glycoprotein (GP) of LASV forms spikes on the surface of the virion and is the sole antigen responsible for eliciting a virus-neutralizing antibody response (12) .
T48497 3988-4460 Sentence denotes The LASV GP is synthesized as a single glycoprotein precursor (GPC) and is subsequently cleaved into three segments by host signal peptidase (13) and subtilisin-kexin-isozyme-1/site 1 protease (SKI-1/S1P) (14) (15) (16) , producing a stable signal peptide (SSP), a receptor binding subunit (GP1), and a class I membrane fusion subunit (GP2), which together form a trimer of GP heterotrimers on the virion surface through noncovalent interactions (17) (18) (19) (20) (21) .
TextSentencer_T27 3988-4460 Sentence denotes The LASV GP is synthesized as a single glycoprotein precursor (GPC) and is subsequently cleaved into three segments by host signal peptidase (13) and subtilisin-kexin-isozyme-1/site 1 protease (SKI-1/S1P) (14) (15) (16) , producing a stable signal peptide (SSP), a receptor binding subunit (GP1), and a class I membrane fusion subunit (GP2), which together form a trimer of GP heterotrimers on the virion surface through noncovalent interactions (17) (18) (19) (20) (21) .
T51665 4461-4690 Sentence denotes GPs of NW arenaviruses, such as JUNV and MACV, bind to transferrin receptor 1 (TfR1) to facilitate entry (22) , while OW arenaviruses use alpha-dystroglycan (␣-DG) or neuropilin-2 (NRP2) as their cell surface receptors (23, 24) .
TextSentencer_T28 4461-4690 Sentence denotes GPs of NW arenaviruses, such as JUNV and MACV, bind to transferrin receptor 1 (TfR1) to facilitate entry (22) , while OW arenaviruses use alpha-dystroglycan (␣-DG) or neuropilin-2 (NRP2) as their cell surface receptors (23, 24) .
T43565 4691-4933 Sentence denotes Upon delivery to the late endosome, the GP of LASV undergoes an acidic pH-induced receptor switch to the intracellular receptor LAMP1, thereby facilitating membrane fusion to release the viral ribonucleoprotein complex into the cytosol (25) .
TextSentencer_T29 4691-4933 Sentence denotes Upon delivery to the late endosome, the GP of LASV undergoes an acidic pH-induced receptor switch to the intracellular receptor LAMP1, thereby facilitating membrane fusion to release the viral ribonucleoprotein complex into the cytosol (25) .
T48091 4934-5090 Sentence denotes Arenavirus GPs also play an important role in the budding of virus progeny by interacting with Z protein, which provides the driving force of budding (26) .
TextSentencer_T30 4934-5090 Sentence denotes Arenavirus GPs also play an important role in the budding of virus progeny by interacting with Z protein, which provides the driving force of budding (26) .
T87849 5091-5268 Sentence denotes By recruiting the matrix protein Z and the assembled nucleocapsid to virus budding sites, GP determines the apical release of nascent LASV from polarized epithelial cells (27) .
TextSentencer_T31 5091-5268 Sentence denotes By recruiting the matrix protein Z and the assembled nucleocapsid to virus budding sites, GP determines the apical release of nascent LASV from polarized epithelial cells (27) .
T66818 5269-5518 Sentence denotes Asparagine-linked (N-)glycosylation plays an important role in the folding, stabilization, oligomerization, quality control, sorting, and transport of GPs (28, 29) , and all of these processes are essential for maintaining normal viral GP functions.
TextSentencer_T32 5269-5518 Sentence denotes Asparagine-linked (N-)glycosylation plays an important role in the folding, stabilization, oligomerization, quality control, sorting, and transport of GPs (28, 29) , and all of these processes are essential for maintaining normal viral GP functions.
T18934 5519-5729 Sentence denotes For example, glycosylation of influenza hemagglutinin (HA) directs the proper folding and trafficking of nascent polypeptides (30) and thus modulates the viral binding ability and regulates viral release (31) .
TextSentencer_T33 5519-5729 Sentence denotes For example, glycosylation of influenza hemagglutinin (HA) directs the proper folding and trafficking of nascent polypeptides (30) and thus modulates the viral binding ability and regulates viral release (31) .
T91802 5730-5810 Sentence denotes Loss of glycans in HIV-1 gp120 significantly reduces virus binding to CD4 (32) .
TextSentencer_T34 5730-5810 Sentence denotes Loss of glycans in HIV-1 gp120 significantly reduces virus binding to CD4 (32) .
T10500 5811-5935 Sentence denotes LASV GP possesses 11 potential sites for N-glycan modification, 7 of which are necessary for its proteolytic cleavage (33) .
TextSentencer_T35 5811-5935 Sentence denotes LASV GP possesses 11 potential sites for N-glycan modification, 7 of which are necessary for its proteolytic cleavage (33) .
T11446 5936-6223 Sentence denotes Despite the lack of cleavage in these latter glycosylation mutants, transport of a single glycosylation site-mutated GPC to the cell surface is not impaired, indicating that a single N-glycosylation site and proteolytic cleavage are not necessary for its intracellular trafficking (33) .
TextSentencer_T36 5936-6223 Sentence denotes Despite the lack of cleavage in these latter glycosylation mutants, transport of a single glycosylation site-mutated GPC to the cell surface is not impaired, indicating that a single N-glycosylation site and proteolytic cleavage are not necessary for its intracellular trafficking (33) .
T11052 6224-6346 Sentence denotes N-glycans in LASV GP also promote immune evasion in humans by shielding the virus from host neutralizing antibodies (34) .
TextSentencer_T37 6224-6346 Sentence denotes N-glycans in LASV GP also promote immune evasion in humans by shielding the virus from host neutralizing antibodies (34) .
T84484 6347-6518 Sentence denotes This finding is in line with historical reports that passive serum therapy provided to cynomolgus monkeys or patients generated only limited protection efficacy (35, 36) .
TextSentencer_T38 6347-6518 Sentence denotes This finding is in line with historical reports that passive serum therapy provided to cynomolgus monkeys or patients generated only limited protection efficacy (35, 36) .
T89631 6519-6647 Sentence denotes Novel therapeutic strategies to control arenavirus-induced diseases require a thorough understanding of virus-host interactions.
TextSentencer_T39 6519-6647 Sentence denotes Novel therapeutic strategies to control arenavirus-induced diseases require a thorough understanding of virus-host interactions.
T20091 6648-6725 Sentence denotes However, little is known about the comprehensive host interactome of LASV GP.
TextSentencer_T40 6648-6725 Sentence denotes However, little is known about the comprehensive host interactome of LASV GP.
T30960 6726-6933 Sentence denotes In this study, an affinity purificationcoupled mass spectrometry (AP-MS) strategy was used to identify host proteins interacting with LASV GP, and the oligosaccharyltransferase (OST) complex was highlighted.
TextSentencer_T41 6726-6933 Sentence denotes In this study, an affinity purificationcoupled mass spectrometry (AP-MS) strategy was used to identify host proteins interacting with LASV GP, and the oligosaccharyltransferase (OST) complex was highlighted.
T93606 6934-7212 Sentence denotes The OST complex is responsible for the N-glycosylation process in the endoplasmic reticulum (ER) lumen, where it catalytically transfers a preassembled oligosaccharide to the amide group of an asparagine residue within the consensus N-X-T/S motif of a nascent polypeptide (37) .
TextSentencer_T42 6934-7212 Sentence denotes The OST complex is responsible for the N-glycosylation process in the endoplasmic reticulum (ER) lumen, where it catalytically transfers a preassembled oligosaccharide to the amide group of an asparagine residue within the consensus N-X-T/S motif of a nascent polypeptide (37) .
T98243 7213-7437 Sentence denotes Multiple subunits of the mammalian OST complex have been reported, including defender against cell death 1 (DAD1), OST48, OST4, OSTC, ribophorin I (RPN1), ribophorin II (RPN2), TUSC3, MAGT1, STT3A, and STT3B (38) (39) (40) .
TextSentencer_T43 7213-7437 Sentence denotes Multiple subunits of the mammalian OST complex have been reported, including defender against cell death 1 (DAD1), OST48, OST4, OSTC, ribophorin I (RPN1), ribophorin II (RPN2), TUSC3, MAGT1, STT3A, and STT3B (38) (39) (40) .
T61755 7438-7562 Sentence denotes The STT3 protein is the central enzyme of the OST complex, and two isoforms exist in mammalian cells: STT3A and STT3B (37) .
TextSentencer_T44 7438-7562 Sentence denotes The STT3 protein is the central enzyme of the OST complex, and two isoforms exist in mammalian cells: STT3A and STT3B (37) .
T31537 7563-7637 Sentence denotes MAGT1 and TUSC3 are specific subunits of STT3B with overlapping functions.
TextSentencer_T45 7563-7637 Sentence denotes MAGT1 and TUSC3 are specific subunits of STT3B with overlapping functions.
T3229 7638-7842 Sentence denotes Either MAGT1 or TUSC3 is incorporated into STT3B complexes and endows STT3B with the capability to posttranslationally glycosylate cysteine-proximal acceptor sites via their oxidoreductase activity (41) .
TextSentencer_T46 7638-7842 Sentence denotes Either MAGT1 or TUSC3 is incorporated into STT3B complexes and endows STT3B with the capability to posttranslationally glycosylate cysteine-proximal acceptor sites via their oxidoreductase activity (41) .
T79959 7843-7967 Sentence denotes Functional studies showed that STT3A and STT3B are essential for the propagation of a recombinant arenavirus rLCMV/LASV GPC.
TextSentencer_T47 7843-7967 Sentence denotes Functional studies showed that STT3A and STT3B are essential for the propagation of a recombinant arenavirus rLCMV/LASV GPC.
T20430 7968-8165 Sentence denotes Although most glycoproteins in host cells are efficiently modified by STT3A in a cotranslational manner (42) , our study indicated that LASV GP was preferentially modified by the STT3B-OST isoform.
TextSentencer_T48 7968-8165 Sentence denotes Although most glycoproteins in host cells are efficiently modified by STT3A in a cotranslational manner (42) , our study indicated that LASV GP was preferentially modified by the STT3B-OST isoform.
T3734 8166-8325 Sentence denotes Our study provides new insights into the host interactome of LASV GP and extends the potential targets for the development of novel therapeutics in the future.
TextSentencer_T49 8166-8325 Sentence denotes Our study provides new insights into the host interactome of LASV GP and extends the potential targets for the development of novel therapeutics in the future.
T97444 8326-8383 Sentence denotes Identification of host proteins interacting with LASV GP.
TextSentencer_T50 8326-8383 Sentence denotes Identification of host proteins interacting with LASV GP.
T4149 8384-8614 Sentence denotes To identify the host proteins interacting with LASV GP, we adopted a strategy to tag its C terminus with a Twin-Strep-tag, which is advantageous for the one-step purification of protein complexes from cell lysates (43) (44) (45) .
TextSentencer_T51 8384-8614 Sentence denotes To identify the host proteins interacting with LASV GP, we adopted a strategy to tag its C terminus with a Twin-Strep-tag, which is advantageous for the one-step purification of protein complexes from cell lysates (43) (44) (45) .
T96786 8615-8774 Sentence denotes No significant changes of the proteolytic cleavage, glycosylation, or cell surface transport were observed between the tagged and untagged LASV GPs (Fig. 1A) .
TextSentencer_T52 8615-8774 Sentence denotes No significant changes of the proteolytic cleavage, glycosylation, or cell surface transport were observed between the tagged and untagged LASV GPs (Fig. 1A) .
T83584 8775-8885 Sentence denotes Then, plasmids encoding the tagged LASV GP or vector plasmid as a control were transfected into HEK293T cells.
TextSentencer_T53 8775-8885 Sentence denotes Then, plasmids encoding the tagged LASV GP or vector plasmid as a control were transfected into HEK293T cells.
T42551 8886-9156 Sentence denotes At 48 h posttransfection, the cells were harvested, and LASV GP-associated host proteins were purified from the cell lysates by magnetic Sepharose beads coated with Strep-Tactin XT and subjected to Western blot analysis using a GP1-specific serum or anti-Strep antibody.
TextSentencer_T54 8886-9156 Sentence denotes At 48 h posttransfection, the cells were harvested, and LASV GP-associated host proteins were purified from the cell lysates by magnetic Sepharose beads coated with Strep-Tactin XT and subjected to Western blot analysis using a GP1-specific serum or anti-Strep antibody.
T70856 9157-9279 Sentence denotes Cleaved GP1 and GP2 were purified simultaneously from the cell lysates, together with a noncleaved form of GPC (Fig. 1B) .
TextSentencer_T55 9157-9279 Sentence denotes Cleaved GP1 and GP2 were purified simultaneously from the cell lysates, together with a noncleaved form of GPC (Fig. 1B) .
T83915 9280-9619 Sentence denotes The retention of cleaved GP1 with purified GP2 suggests that viral GP remained in the prefusion conformation during the purification process since GP1 and GP2 interact with each other through unstable noncovalent interactions, and irreversible conformation changes during the membrane fusion process lead to their disassociation (20, 25) .
TextSentencer_T56 9280-9619 Sentence denotes The retention of cleaved GP1 with purified GP2 suggests that viral GP remained in the prefusion conformation during the purification process since GP1 and GP2 interact with each other through unstable noncovalent interactions, and irreversible conformation changes during the membrane fusion process lead to their disassociation (20, 25) .
T10555 9620-9713 Sentence denotes Then, eluted proteins were trypsin digested and subjected to mass spectrometry (MS) analysis.
TextSentencer_T57 9620-9713 Sentence denotes Then, eluted proteins were trypsin digested and subjected to mass spectrometry (MS) analysis.
T42674 9714-9905 Sentence denotes Three independent replicate experiments were performed, and a total of 1,104 host proteins were identified from at least one independent replicate (see Table S1 in the supplemental material).
TextSentencer_T58 9714-9905 Sentence denotes Three independent replicate experiments were performed, and a total of 1,104 host proteins were identified from at least one independent replicate (see Table S1 in the supplemental material).
T12940 9906-10249 Sentence denotes Only proteins meeting the following criteria were considered as interactors of GP: (i) for proteins identified in only the GP group but not the control group, at least two peptides should be identified, or (ii) for proteins identified in both the GP and control groups, the GP versus control group peptide count ratios should be Ͼ3 (Fig. 1C) .
TextSentencer_T59 9906-10249 Sentence denotes Only proteins meeting the following criteria were considered as interactors of GP: (i) for proteins identified in only the GP group but not the control group, at least two peptides should be identified, or (ii) for proteins identified in both the GP and control groups, the GP versus control group peptide count ratios should be Ͼ3 (Fig. 1C) .
T12472 10250-10475 Sentence denotes With this standard, 591 proteins were considered as valid interactors of LASV GPs. ␣-DG, the host receptor of OW arenaviruses (23) , was detected in the GP groups with high abundance but not in the control groups (Table S1) .
TextSentencer_T60 10250-10475 Sentence denotes With this standard, 591 proteins were considered as valid interactors of LASV GPs. ␣-DG, the host receptor of OW arenaviruses (23) , was detected in the GP groups with high abundance but not in the control groups (Table S1) .
T1166 10476-10559 Sentence denotes Gene ontology analysis of LASV GP-interacting proteins highlighted the OST complex.
TextSentencer_T61 10476-10559 Sentence denotes Gene ontology analysis of LASV GP-interacting proteins highlighted the OST complex.
T49025 10560-10758 Sentence denotes To functionally annotate interactors, 591 host proteins identified here were submitted to Protein Annotation Through Evolutionary Relationship (PANTHER) to perform gene ontology (GO) analysis (46) .
TextSentencer_T62 10560-10758 Sentence denotes To functionally annotate interactors, 591 host proteins identified here were submitted to Protein Annotation Through Evolutionary Relationship (PANTHER) to perform gene ontology (GO) analysis (46) .
T18477 10759-10972 Sentence denotes As shown in Fig. 2A and Table S1 in the supplemental material, 591 proteins were clustered into 22 groups based on the cellular components, demonstrating the extensive cellular distribution of LASV GP interactors.
TextSentencer_T63 10759-10972 Sentence denotes As shown in Fig. 2A and Table S1 in the supplemental material, 591 proteins were clustered into 22 groups based on the cellular components, demonstrating the extensive cellular distribution of LASV GP interactors.
T23963 10973-11142 Sentence denotes Multiple proteins were clustered into compartments of the host secretory system, such as the ER, ER-Golgi intermediate compartment, Golgi apparatus, and plasma membrane.
TextSentencer_T64 10973-11142 Sentence denotes Multiple proteins were clustered into compartments of the host secretory system, such as the ER, ER-Golgi intermediate compartment, Golgi apparatus, and plasma membrane.
T11753 11143-11282 Sentence denotes Interactors residing in these cellular components might participate in the maturation process of LASV GP and thus affect viral replication.
TextSentencer_T65 11143-11282 Sentence denotes Interactors residing in these cellular components might participate in the maturation process of LASV GP and thus affect viral replication.
T53364 11283-11469 Sentence denotes To further explore the biological significance of GP-associated interactors, statistical overrepresentation tests for GO molecular functions and biological processes were also performed.
TextSentencer_T66 11283-11469 Sentence denotes To further explore the biological significance of GP-associated interactors, statistical overrepresentation tests for GO molecular functions and biological processes were also performed.
T52148 11470-11587 Sentence denotes Redundant GO terms were first eliminated by REVIGO based on semantic similarity (47) and further summarized manually.
TextSentencer_T67 11470-11587 Sentence denotes Redundant GO terms were first eliminated by REVIGO based on semantic similarity (47) and further summarized manually.
T39572 11588-11697 Sentence denotes Functional subsets of proteins with ranked fold enrichment values and -log10(P values) are shown in Fig. 2B .
TextSentencer_T68 11588-11697 Sentence denotes Functional subsets of proteins with ranked fold enrichment values and -log10(P values) are shown in Fig. 2B .
T67967 11698-11926 Sentence denotes The top overrepresented functional subsets from GO molecular function and biological process analyses with high fold enrichment values (Ͼ10) are highlighted in the scatterplot graph (central region) and listed in Tables 1 and 2.
TextSentencer_T69 11698-11926 Sentence denotes The top overrepresented functional subsets from GO molecular function and biological process analyses with high fold enrichment values (Ͼ10) are highlighted in the scatterplot graph (central region) and listed in Tables 1 and 2.
T27771 11927-11998 Sentence denotes Proteins responsible for host OST activity were highly overrepresented.
TextSentencer_T70 11927-11998 Sentence denotes Proteins responsible for host OST activity were highly overrepresented.
T54380 11999-12177 Sentence denotes STT3A and STT3B, the two isoforms of the catalytic subunit of the mammalian OST complex, together with their auxiliary subunits were identified as GP interactors here (Fig. 2C ).
TextSentencer_T71 11999-12177 Sentence denotes STT3A and STT3B, the two isoforms of the catalytic subunit of the mammalian OST complex, together with their auxiliary subunits were identified as GP interactors here (Fig. 2C ).
T78586 12178-12386 Sentence denotes In addition, proteins involved in the protein folding process and proteasome activity were also significantly enriched in the data set, hinting at possible roles of these proteins in arenavirus GP physiology.
TextSentencer_T72 12178-12386 Sentence denotes In addition, proteins involved in the protein folding process and proteasome activity were also significantly enriched in the data set, hinting at possible roles of these proteins in arenavirus GP physiology.
T70445 12387-12639 Sentence denotes Interestingly, multiple proteins responsible for nuclear transport or Ran GTPase binding were also enriched in the data set, consistent with the results of a proteomic survey of JUNV virions (48) , while their roles in virus replication remain unknown.
TextSentencer_T73 12387-12639 Sentence denotes Interestingly, multiple proteins responsible for nuclear transport or Ran GTPase binding were also enriched in the data set, consistent with the results of a proteomic survey of JUNV virions (48) , while their roles in virus replication remain unknown.
T31488 12640-12784 Sentence denotes To verify the interactions between LASV GP and the OST subunits identified here, coimmunoprecipitation and Western blot analyses were performed.
TextSentencer_T74 12640-12784 Sentence denotes To verify the interactions between LASV GP and the OST subunits identified here, coimmunoprecipitation and Western blot analyses were performed.
T68836 12785-12871 Sentence denotes Twin-Strep-tagged LASV GP with its associated proteins was purified from cell lysates.
TextSentencer_T75 12785-12871 Sentence denotes Twin-Strep-tagged LASV GP with its associated proteins was purified from cell lysates.
T59974 12872-12966 Sentence denotes Green fluorescent protein (GFP) tagged with a Twin-Strep-tag was also set as the control bait.
TextSentencer_T76 12872-12966 Sentence denotes Green fluorescent protein (GFP) tagged with a Twin-Strep-tag was also set as the control bait.
T62048 12967-13139 Sentence denotes Endogenous STT3A and STT3B or exogenously expressed RPN1, RPN2, OSTC, and DDOST/ OST48 were detected in the GP fraction but not in the GFP-purified fraction (Fig. 3A to F).
TextSentencer_T77 12967-13139 Sentence denotes Endogenous STT3A and STT3B or exogenously expressed RPN1, RPN2, OSTC, and DDOST/ OST48 were detected in the GP fraction but not in the GFP-purified fraction (Fig. 3A to F).
T56838 13140-13387 Sentence denotes Most of the OST subunits (excluding DDOST) migrated into diffused bands and HEK293T cells were transfected with a pCAGGs plasmid encoding LASV GP with a C-terminal Twin-Strep-tag or a pCAGGs plasmid expressing only the Twin-Strep-tag as a control.
TextSentencer_T78 13140-13387 Sentence denotes Most of the OST subunits (excluding DDOST) migrated into diffused bands and HEK293T cells were transfected with a pCAGGs plasmid encoding LASV GP with a C-terminal Twin-Strep-tag or a pCAGGs plasmid expressing only the Twin-Strep-tag as a control.
T54701 13388-13498 Sentence denotes At 48 h posttransfection, the cells were harvested and lysed by using a mild nonionic detergent buffer at 4°C.
TextSentencer_T79 13388-13498 Sentence denotes At 48 h posttransfection, the cells were harvested and lysed by using a mild nonionic detergent buffer at 4°C.
T41730 13499-13626 Sentence denotes LASV GP-associated host interactors were pulled down from cell lysates by magnetic Sepharose beads coated with Strep-Tactin XT.
TextSentencer_T80 13499-13626 Sentence denotes LASV GP-associated host interactors were pulled down from cell lysates by magnetic Sepharose beads coated with Strep-Tactin XT.
T66384 13627-13757 Sentence denotes Purified proteins were digested into peptides by trypsin and subjected to liquid chromatography-tandem mass spectrometry analysis.
TextSentencer_T81 13627-13757 Sentence denotes Purified proteins were digested into peptides by trypsin and subjected to liquid chromatography-tandem mass spectrometry analysis.
T63576 13758-13935 Sentence denotes Western blotting and immunofluorescence were used to test whether the Twin-Strep-tag would affect the proteolytic cleavage, glycosylation, and cell surface transport of LASV GP.
TextSentencer_T82 13758-13935 Sentence denotes Western blotting and immunofluorescence were used to test whether the Twin-Strep-tag would affect the proteolytic cleavage, glycosylation, and cell surface transport of LASV GP.
T56837 13936-14150 Sentence denotes The cleavage rates of tagged and untagged GP2 are shown above, as determined by densitometric quantification. (B) Silver-stained SDS-PAGE gel of purified LASV GP together with host interactors or the control group.
TextSentencer_T83 13936-14150 Sentence denotes The cleavage rates of tagged and untagged GP2 are shown above, as determined by densitometric quantification. (B) Silver-stained SDS-PAGE gel of purified LASV GP together with host interactors or the control group.
T95483 14151-14307 Sentence denotes Western blot analysis was also conducted to show the bands of viral GP1 and GP2, as detected by GP1-specific serum and an anti-Strep antibody, respectively.
TextSentencer_T84 14151-14307 Sentence denotes Western blot analysis was also conducted to show the bands of viral GP1 and GP2, as detected by GP1-specific serum and an anti-Strep antibody, respectively.
T87832 14308-14566 Sentence denotes The silver-stained and Western blot gels shown here are representatives of three independent replicates. (C) The left column diagram shows the distribution of detected peptide counts from proteins identified in only the GP group and not in the control group.
TextSentencer_T85 14308-14566 Sentence denotes The silver-stained and Western blot gels shown here are representatives of three independent replicates. (C) The left column diagram shows the distribution of detected peptide counts from proteins identified in only the GP group and not in the control group.
T60423 14567-14720 Sentence denotes The right column diagram shows the distribution of peptide count ratios from proteins identified in both the GP group and the control group (GP/control).
TextSentencer_T86 14567-14720 Sentence denotes The right column diagram shows the distribution of peptide count ratios from proteins identified in both the GP group and the control group (GP/control).
T84014 14721-14827 Sentence denotes Proteins that fulfilled our filtration standard in the two groups were considered to be valid interactors.
TextSentencer_T87 14721-14827 Sentence denotes Proteins that fulfilled our filtration standard in the two groups were considered to be valid interactors.
T61210 14828-14948 Sentence denotes formed high-molecular-weight aggregates, probably because of stable associations with other subunits of the OST complex.
TextSentencer_T88 14828-14948 Sentence denotes formed high-molecular-weight aggregates, probably because of stable associations with other subunits of the OST complex.
T26853 14949-15073 Sentence denotes We also compared our data set to a previous interactome of LCMV GP and found that 127 proteins were common (Table S1) (49) .
TextSentencer_T89 14949-15073 Sentence denotes We also compared our data set to a previous interactome of LCMV GP and found that 127 proteins were common (Table S1) (49) .
T46017 15074-15215 Sentence denotes Interestingly, subunits of the OST complex were also identified in the interactome of LCMV GP, including STT3B, DDOST, RPN1, RPN2, and MAGT1.
TextSentencer_T90 15074-15215 Sentence denotes Interestingly, subunits of the OST complex were also identified in the interactome of LCMV GP, including STT3B, DDOST, RPN1, RPN2, and MAGT1.
T7722 15216-15368 Sentence denotes These results suggested a high confidence level of our interactome results and confirmed that LASV GP interacted specifically with the host OST complex.
TextSentencer_T91 15216-15368 Sentence denotes These results suggested a high confidence level of our interactome results and confirmed that LASV GP interacted specifically with the host OST complex.
T73838 15369-15489 Sentence denotes CRISPR-Cas9-mediated isoform-specific knockouts of the OST complex impaired the propagation of the rLCMV/LASV GPC virus.
TextSentencer_T92 15369-15489 Sentence denotes CRISPR-Cas9-mediated isoform-specific knockouts of the OST complex impaired the propagation of the rLCMV/LASV GPC virus.
T81508 15490-15654 Sentence denotes The GPs of arenaviruses are highly glycosylated (34) , and the absence of even a single GP glycosylation site could globally attenuate the arenavirus in vivo (50) .
TextSentencer_T93 15490-15654 Sentence denotes The GPs of arenaviruses are highly glycosylated (34) , and the absence of even a single GP glycosylation site could globally attenuate the arenavirus in vivo (50) .
T87588 15655-15781 Sentence denotes We hypothesized that the OST complex is central to GP modification and might therefore play a vital role in virus propagation.
TextSentencer_T94 15655-15781 Sentence denotes We hypothesized that the OST complex is central to GP modification and might therefore play a vital role in virus propagation.
T86269 15782-16034 Sentence denotes Because of partly redundant functions of the two isoforms in N-linked glycosylation, most glycoproteins in host cells can be modified by both OST isoforms except for a few special proteins that are preferentially modified by either STT3A or STT3B (51).
TextSentencer_T95 15782-16034 Sentence denotes Because of partly redundant functions of the two isoforms in N-linked glycosylation, most glycoproteins in host cells can be modified by both OST isoforms except for a few special proteins that are preferentially modified by either STT3A or STT3B (51).
T26301 16035-16147 Sentence denotes STT3A and STT3B also display distinct enzymatic properties, and differential utilization of the Tables 1 and 2 .
TextSentencer_T96 16035-16147 Sentence denotes STT3A and STT3B also display distinct enzymatic properties, and differential utilization of the Tables 1 and 2 .
T23280 16148-16407 Sentence denotes The test was performed using the Fisher exact test with an FDR multiple test correction of Ͻ0.05. (C) Representative overview of the LASV GP interactome classified based on both biological processes and molecular functions, which were visualized by Cytoscape.
TextSentencer_T97 16148-16407 Sentence denotes The test was performed using the Fisher exact test with an FDR multiple test correction of Ͻ0.05. (C) Representative overview of the LASV GP interactome classified based on both biological processes and molecular functions, which were visualized by Cytoscape.
T13029 16408-16468 Sentence denotes Subunits of the OST complex are highlighted by a red square.
TextSentencer_T98 16408-16468 Sentence denotes Subunits of the OST complex are highlighted by a red square.
T16169 16469-16575 Sentence denotes MAGT1 and TUSC3 were validated by the coimmunoprecipitation assay shown below and are also presented here.
TextSentencer_T99 16469-16575 Sentence denotes MAGT1 and TUSC3 were validated by the coimmunoprecipitation assay shown below and are also presented here.
T23307 16576-16629 Sentence denotes Note that not all the interactors are presented here.
TextSentencer_T100 16576-16629 Sentence denotes Note that not all the interactors are presented here.
T93402 16630-16775 Sentence denotes In addition, note that one protein may be classified into more than one subset. two isoforms may represent distinct glycosylation patterns (52) .
TextSentencer_T101 16630-16775 Sentence denotes In addition, note that one protein may be classified into more than one subset. two isoforms may represent distinct glycosylation patterns (52) .
T37513 16776-16859 Sentence denotes It remains unknown whether the glycosylation of LASV GP requires both OST isoforms.
TextSentencer_T102 16776-16859 Sentence denotes It remains unknown whether the glycosylation of LASV GP requires both OST isoforms.
T66042 16860-17162 Sentence denotes Since the small interfering RNA (siRNA)-mediated knockdown of OST subunits in HEK293 cells is reported to be relatively ineffective (53), we generated STT3A and STT3B knockout cells (STT3Aand STT3Bcells) by using the CRISPR-Cas9 system to explore the roles of STT3A and STT3B in arenavirus propagation.
TextSentencer_T103 16860-17162 Sentence denotes Since the small interfering RNA (siRNA)-mediated knockdown of OST subunits in HEK293 cells is reported to be relatively ineffective (53), we generated STT3A and STT3B knockout cells (STT3Aand STT3Bcells) by using the CRISPR-Cas9 system to explore the roles of STT3A and STT3B in arenavirus propagation.
T54202 17163-17318 Sentence denotes Plasmids encoding single-guide RNAs (sgRNAs) targeting the exons of the STT3A and STT3B genes were transfected into HEK293T cells to direct genome editing.
TextSentencer_T104 17163-17318 Sentence denotes Plasmids encoding single-guide RNAs (sgRNAs) targeting the exons of the STT3A and STT3B genes were transfected into HEK293T cells to direct genome editing.
T68964 17319-17474 Sentence denotes Knockouts of STT3A and STT3B were confirmed by sequencing (Fig. 4A , frameshift mutations at the corresponding sites) and Western blot analysis (Fig. 4B ).
TextSentencer_T105 17319-17474 Sentence denotes Knockouts of STT3A and STT3B were confirmed by sequencing (Fig. 4A , frameshift mutations at the corresponding sites) and Western blot analysis (Fig. 4B ).
T12543 17475-17767 Sentence denotes To further confirm the loss of STT3A and STT3B catalytic activity, the N-glycosylation of two plasmids expressing progranulin (pGRN) or sex hormone- binding globulin (SHBG), which were reported to be specific N-glycosylation substrates of STT3A or STT3B, respectively, was examined (54, 55) .
TextSentencer_T106 17475-17767 Sentence denotes To further confirm the loss of STT3A and STT3B catalytic activity, the N-glycosylation of two plasmids expressing progranulin (pGRN) or sex hormone- binding globulin (SHBG), which were reported to be specific N-glycosylation substrates of STT3A or STT3B, respectively, was examined (54, 55) .
T20578 17768-17958 Sentence denotes As shown in Fig. 4C , N-glycosylation of pGRN was inhibited in STT3Acells but not in wild-type (WT) cells or STT3Bcells, whereas knockout of STT3B inhibited the N-glycosylation of only SHBG.
TextSentencer_T107 17768-17958 Sentence denotes As shown in Fig. 4C , N-glycosylation of pGRN was inhibited in STT3Acells but not in wild-type (WT) cells or STT3Bcells, whereas knockout of STT3B inhibited the N-glycosylation of only SHBG.
T36270 17959-18158 Sentence denotes To explore whether STT3A and STT3B affect viral replication, we rescued a recombinant arenavirus, rLCMV/LASV GPC, in which LCMV GP was replaced by LASV GP, while the backbone of LCMV was not altered.
TextSentencer_T108 17959-18158 Sentence denotes To explore whether STT3A and STT3B affect viral replication, we rescued a recombinant arenavirus, rLCMV/LASV GPC, in which LCMV GP was replaced by LASV GP, while the backbone of LCMV was not altered.
T1285 18159-18303 Sentence denotes This recombinant virus can be manipulated in BSL-2 conditions and reportedly exhibits high fitness with intact characteristics of LASV GP (56) .
TextSentencer_T109 18159-18303 Sentence denotes This recombinant virus can be manipulated in BSL-2 conditions and reportedly exhibits high fitness with intact characteristics of LASV GP (56) .
T889 18304-18401 Sentence denotes STT3Aand STT3Bcells were infected with rLCMV/LASV GPC and harvested at the indicated time points.
TextSentencer_T110 18304-18401 Sentence denotes STT3Aand STT3Bcells were infected with rLCMV/LASV GPC and harvested at the indicated time points.
T24360 18402-18648 Sentence denotes The intracellular viral level was determined based on the amount of viral S genomic RNA(ϩ), as determined by quantitative reverse transcription-PCR (qRT-PCR), and the viral titer in the supernatant was determined by an immunological plaque assay.
TextSentencer_T111 18402-18648 Sentence denotes The intracellular viral level was determined based on the amount of viral S genomic RNA(ϩ), as determined by quantitative reverse transcription-PCR (qRT-PCR), and the viral titer in the supernatant was determined by an immunological plaque assay.
T56863 18649-18872 Sentence denotes As shown in Fig. 4D , the intracellular level of the viral S genome was only slightly reduced in STT3Aor STT3Bcells, indicating that viral genome replication was not significantly affected by the knockout of STT3A or STT3B.
TextSentencer_T112 18649-18872 Sentence denotes As shown in Fig. 4D , the intracellular level of the viral S genome was only slightly reduced in STT3Aor STT3Bcells, indicating that viral genome replication was not significantly affected by the knockout of STT3A or STT3B.
T69847 18873-19040 Sentence denotes The titers in the supernatants of STT3Aand STT3Bcells were reduced dramatically, indicating that knockout of STT3A or STT3B impaired the propagation of rLCMV/LASV GPC.
TextSentencer_T113 18873-19040 Sentence denotes The titers in the supernatants of STT3Aand STT3Bcells were reduced dramatically, indicating that knockout of STT3A or STT3B impaired the propagation of rLCMV/LASV GPC.
T39172 19041-19132 Sentence denotes These results showed that both STT3A and STT3B are host factors on which the virus depends.
TextSentencer_T114 19041-19132 Sentence denotes These results showed that both STT3A and STT3B are host factors on which the virus depends.
T87183 19133-19225 Sentence denotes Knockout of STT3A or STT3B led to the formation of viral particles with reduced infectivity.
TextSentencer_T115 19133-19225 Sentence denotes Knockout of STT3A or STT3B led to the formation of viral particles with reduced infectivity.
T86864 19226-19429 Sentence denotes To explore whether STT3A or STT3B plays roles in productive viral entry and early infection, STT3A -, STT3B -, and WT cells were infected with rLCMV/LASV GPC at a multiplicity of infection (MOI) of 0.01.
TextSentencer_T116 19226-19429 Sentence denotes To explore whether STT3A or STT3B plays roles in productive viral entry and early infection, STT3A -, STT3B -, and WT cells were infected with rLCMV/LASV GPC at a multiplicity of infection (MOI) of 0.01.
T90821 19430-19580 Sentence denotes We examined intracellular levels of viral nucleoprotein (NP) at 8 h postinfection (hpi), at which time point LASV has reportedly finished entry (57) .
TextSentencer_T117 19430-19580 Sentence denotes We examined intracellular levels of viral nucleoprotein (NP) at 8 h postinfection (hpi), at which time point LASV has reportedly finished entry (57) .
T90660 19581-19730 Sentence denotes As shown in Fig. 5A , no significant changes were observed, suggesting that knockout of STT3A or STT3B did not affect viral entry or early infection.
TextSentencer_T118 19581-19730 Sentence denotes As shown in Fig. 5A , no significant changes were observed, suggesting that knockout of STT3A or STT3B did not affect viral entry or early infection.
T16330 19731-19936 Sentence denotes Since knockout of STT3A or STT3B had no significant effects on the replication of the rLCMV/LASV GPC genome (Fig. 4D ), we tested whether knockout of STT3A or STT3B affected the release of viral particles.
TextSentencer_T119 19731-19936 Sentence denotes Since knockout of STT3A or STT3B had no significant effects on the replication of the rLCMV/LASV GPC genome (Fig. 4D ), we tested whether knockout of STT3A or STT3B affected the release of viral particles.
T20421 19937-20092 Sentence denotes To this end, STT3Aor STT3Bcells were infected with rLCMV/LASV GPC, and both intracellular and supernatant viral genomes were measured by qRT-PCR at 48 hpi.
TextSentencer_T120 19937-20092 Sentence denotes To this end, STT3Aor STT3Bcells were infected with rLCMV/LASV GPC, and both intracellular and supernatant viral genomes were measured by qRT-PCR at 48 hpi.
T31263 20093-20241 Sentence denotes The ratio of the supernatant viral genome level versus the intracellular viral genome level was calculated as an indicator of virus budding ability.
TextSentencer_T121 20093-20241 Sentence denotes The ratio of the supernatant viral genome level versus the intracellular viral genome level was calculated as an indicator of virus budding ability.
T79530 20242-20393 Sentence denotes Knockout of STT3A or STT3B had no significant effect on virus budding ability ( Fig. 5B ), suggesting that STT3A or STT3B did not affect viral release.
TextSentencer_T122 20242-20393 Sentence denotes Knockout of STT3A or STT3B had no significant effect on virus budding ability ( Fig. 5B ), suggesting that STT3A or STT3B did not affect viral release.
T55531 20394-20641 Sentence denotes Although the absolute viral genome levels were partly reduced in STT3Aand STT3Bcells, the extent of reduction (Ͻ2-fold) was insufficient to explain the dramatic reduction in viral titers in the supernatants (Ͼ30-fold reduction, shown in Fig. 4D ).
TextSentencer_T123 20394-20641 Sentence denotes Although the absolute viral genome levels were partly reduced in STT3Aand STT3Bcells, the extent of reduction (Ͻ2-fold) was insufficient to explain the dramatic reduction in viral titers in the supernatants (Ͼ30-fold reduction, shown in Fig. 4D ).
T59526 20642-20893 Sentence denotes The viral titers decreased dramatically with only mild reductions in the viral genome RNA levels in the supernatants of STT3Aor STT3Bcells ( Fig. 5C ), suggesting that viral particles derived from STT3Aor STT3Bcells may have reduced viral infectivity.
TextSentencer_T124 20642-20893 Sentence denotes The viral titers decreased dramatically with only mild reductions in the viral genome RNA levels in the supernatants of STT3Aor STT3Bcells ( Fig. 5C ), suggesting that viral particles derived from STT3Aor STT3Bcells may have reduced viral infectivity.
T13983 20894-21023 Sentence denotes We calculated the ratio of viral titers to viral genome RNA copy numbers in the supernatant as an indicator of viral infectivity.
TextSentencer_T125 20894-21023 Sentence denotes We calculated the ratio of viral titers to viral genome RNA copy numbers in the supernatant as an indicator of viral infectivity.
T65722 21024-21139 Sentence denotes As shown in Fig. 5D , viral particles derived from STT3Aor STT3Bknockout cells exhibited reduced viral infectivity.
TextSentencer_T126 21024-21139 Sentence denotes As shown in Fig. 5D , viral particles derived from STT3Aor STT3Bknockout cells exhibited reduced viral infectivity.
T42566 21140-21306 Sentence denotes Viral infectivity was further visualized by the infection of a rLCMV (NP-P2A-GFP)/LASV GPC virus, in which LCMV NP was linked with GFP by a P2A self-cleaving peptide.
TextSentencer_T127 21140-21306 Sentence denotes Viral infectivity was further visualized by the infection of a rLCMV (NP-P2A-GFP)/LASV GPC virus, in which LCMV NP was linked with GFP by a P2A self-cleaving peptide.
T31229 21307-21437 Sentence denotes Cells infected with the rLCMV (NP-P2A-GFP)/LASV GPC virus were immobilized, and viral foci were observed at different time points.
TextSentencer_T128 21307-21437 Sentence denotes Cells infected with the rLCMV (NP-P2A-GFP)/LASV GPC virus were immobilized, and viral foci were observed at different time points.
T16812 21438-21590 Sentence denotes As shown in Fig. 5E , knockout of STT3A and STT3B did not reduce the number of viral foci; however, the viral foci in STT3Aand STT3Bcells were notably .
TextSentencer_T129 21438-21590 Sentence denotes As shown in Fig. 5E , knockout of STT3A and STT3B did not reduce the number of viral foci; however, the viral foci in STT3Aand STT3Bcells were notably .
T93521 21591-21691 Sentence denotes GAPDH was also detected as a control of cell lysate input and bead fraction output (A to H, bottom).
TextSentencer_T130 21591-21691 Sentence denotes GAPDH was also detected as a control of cell lysate input and bead fraction output (A to H, bottom).
T44489 21692-21795 Sentence denotes Bands indicating specific interactions between LASV GP and the OST subunits are marked with a red star.
TextSentencer_T131 21692-21795 Sentence denotes Bands indicating specific interactions between LASV GP and the OST subunits are marked with a red star.
T86305 21796-21939 Sentence denotes Note that some of the OST subunits were found to migrated into diffused bands and formed high-molecular-weight aggregates in the SDS-PAGE gels.
TextSentencer_T132 21796-21939 Sentence denotes Note that some of the OST subunits were found to migrated into diffused bands and formed high-molecular-weight aggregates in the SDS-PAGE gels.
T12250 21940-22114 Sentence denotes LASV GP but not the control GFP was able to pull down all of the subunits identified in our MS data set. smaller than those in WT cells, suggesting reduced virus infectivity.
TextSentencer_T133 21940-22114 Sentence denotes LASV GP but not the control GFP was able to pull down all of the subunits identified in our MS data set. smaller than those in WT cells, suggesting reduced virus infectivity.
T51731 22115-22293 Sentence denotes Based on these results, we concluded that the inhibited propagation of the rLCMV/LASV GPC virus by the knockout of STT3A or STT3B was mainly due to the reduced viral infectivity.
TextSentencer_T134 22115-22293 Sentence denotes Based on these results, we concluded that the inhibited propagation of the rLCMV/LASV GPC virus by the knockout of STT3A or STT3B was mainly due to the reduced viral infectivity.
T64931 22294-22348 Sentence denotes Knockout of STT3B caused hypoglycosylation of LASV GP.
TextSentencer_T135 22294-22348 Sentence denotes Knockout of STT3B caused hypoglycosylation of LASV GP.
T42866 22349-22495 Sentence denotes Since both STT3A and STT3B play roles in virus propagation, we sought to investigate the glycosylation profile of viral GP in STT3Aand STT3Bcells.
TextSentencer_T136 22349-22495 Sentence denotes Since both STT3A and STT3B play roles in virus propagation, we sought to investigate the glycosylation profile of viral GP in STT3Aand STT3Bcells.
T68126 22496-22619 Sentence denotes Cells infected with the rLCMV/LASV GPC virus were harvested at the indicated time points and subjected to Western blotting.
TextSentencer_T137 22496-22619 Sentence denotes Cells infected with the rLCMV/LASV GPC virus were harvested at the indicated time points and subjected to Western blotting.
T38298 22620-22808 Sentence denotes In STT3Acells, the viral GP displayed the same glycosylation pattern as that in WT cells, but the proteolytic cleavage process was hindered in the early stage of infection (24 and 36 hpi).
TextSentencer_T138 22620-22808 Sentence denotes In STT3Acells, the viral GP displayed the same glycosylation pattern as that in WT cells, but the proteolytic cleavage process was hindered in the early stage of infection (24 and 36 hpi).
T80679 22809-22954 Sentence denotes Even so, the viral GP in STT3Acells reached a level of maturation similar to that observed in WT cells at the late stage of infection (Fig. 6A) .
TextSentencer_T139 22809-22954 Sentence denotes Even so, the viral GP in STT3Acells reached a level of maturation similar to that observed in WT cells at the late stage of infection (Fig. 6A) .
T58014 22955-23148 Sentence denotes Knockout of STT3A did not significantly affect the glycosylation of LASV GP, which might be explained by the functionally compensatory effect executed by the STT3B isoform of OST in STT3Acells.
TextSentencer_T140 22955-23148 Sentence denotes Knockout of STT3A did not significantly affect the glycosylation of LASV GP, which might be explained by the functionally compensatory effect executed by the STT3B isoform of OST in STT3Acells.
T43558 23149-23237 Sentence denotes However, we observed an obviously hypoglycosylated form of noncleaved GPC in STT3Bcells.
TextSentencer_T141 23149-23237 Sentence denotes However, we observed an obviously hypoglycosylated form of noncleaved GPC in STT3Bcells.
T63845 23238-23476 Sentence denotes To exclude the possibility that the reduced molecular weight of viral GPC was caused by other modifications, such as phosphorylation, viral proteins from different cell lines were subjected to cleavage by PNGase F to remove the N-glycans.
TextSentencer_T142 23238-23476 Sentence denotes To exclude the possibility that the reduced molecular weight of viral GPC was caused by other modifications, such as phosphorylation, viral proteins from different cell lines were subjected to cleavage by PNGase F to remove the N-glycans.
T37002 23477-23732 Sentence denotes As shown in Fig. 6B , the migration of the unglycosylated form of noncleaved GPC was identical among these cells, suggesting that the differential migration of the glycosylated form of GPC in STT3Bcells was due to the distinct glycosylation status of GPC.
TextSentencer_T143 23477-23732 Sentence denotes As shown in Fig. 6B , the migration of the unglycosylated form of noncleaved GPC was identical among these cells, suggesting that the differential migration of the glycosylated form of GPC in STT3Bcells was due to the distinct glycosylation status of GPC.
T92399 23733-23896 Sentence denotes Taken together, these data showed that LASV GP was a preferential substrate of STT3B-OST and that the full glycosylation of LASV GP requires the STT3B-OST isoform.
TextSentencer_T144 23733-23896 Sentence denotes Taken together, these data showed that LASV GP was a preferential substrate of STT3B-OST and that the full glycosylation of LASV GP requires the STT3B-OST isoform.
T32839 23897-24027 Sentence denotes Although STT3A was not an essential prerequisite for the glycosylation of LASV GP, loss of STT3A delayed its proteolytic cleavage.
TextSentencer_T145 23897-24027 Sentence denotes Although STT3A was not an essential prerequisite for the glycosylation of LASV GP, loss of STT3A delayed its proteolytic cleavage.
T50117 24028-24110 Sentence denotes Incorporation of viral GP into viral particles was reduced in STT3Aand STT3Bcells.
TextSentencer_T146 24028-24110 Sentence denotes Incorporation of viral GP into viral particles was reduced in STT3Aand STT3Bcells.
T7382 24111-24277 Sentence denotes Since knockout of STT3A or STT3B hindered the proteolytic cleavage of GPC, we explored whether the incorporation of GP in virions was affected in STT3Aand STT3Bcells.
TextSentencer_T147 24111-24277 Sentence denotes Since knockout of STT3A or STT3B hindered the proteolytic cleavage of GPC, we explored whether the incorporation of GP in virions was affected in STT3Aand STT3Bcells.
T18577 24278-24401 Sentence denotes Virions derived from different cells were collected and screened for viral proteins (GP1, GP2, and NP) by Western blotting.
TextSentencer_T148 24278-24401 Sentence denotes Virions derived from different cells were collected and screened for viral proteins (GP1, GP2, and NP) by Western blotting.
T66699 24402-24591 Sentence denotes As shown in Fig. 6C , only cleaved GP1 or GP2 was detected, which was in line with a previous report demonstrating that cleavage is necessary for the incorporation of GP into virions (14) .
TextSentencer_T149 24402-24591 Sentence denotes As shown in Fig. 6C , only cleaved GP1 or GP2 was detected, which was in line with a previous report demonstrating that cleavage is necessary for the incorporation of GP into virions (14) .
T84742 24592-24724 Sentence denotes Viral NP, GP1, and GP2 levels were reduced in viral particles derived from STT3Aand STT3Bcells, suggesting reduced virus production.
TextSentencer_T150 24592-24724 Sentence denotes Viral NP, GP1, and GP2 levels were reduced in viral particles derived from STT3Aand STT3Bcells, suggesting reduced virus production.
T85299 24725-24859 Sentence denotes The GP2/NP band intensity ratios were calculated as an indicator of the number of viral GPs incorporated into a single viral particle.
TextSentencer_T151 24725-24859 Sentence denotes The GP2/NP band intensity ratios were calculated as an indicator of the number of viral GPs incorporated into a single viral particle.
T44651 24860-25062 Sentence denotes As shown in Fig. 6D , the ratios of GP2 to NP derived from both STT3Aand STT3Bcells were significantly reduced compared to those from WT cells, suggesting that the GP composition in virions was reduced.
TextSentencer_T152 24860-25062 Sentence denotes As shown in Fig. 6D , the ratios of GP2 to NP derived from both STT3Aand STT3Bcells were significantly reduced compared to those from WT cells, suggesting that the GP composition in virions was reduced.
T25605 25063-25222 Sentence denotes To explore whether the reduced GP levels in virions derived from STT3Aor STT3Bcells affect virus infection, the binding abilities of these virions were tested.
TextSentencer_T153 25063-25222 Sentence denotes To explore whether the reduced GP levels in virions derived from STT3Aor STT3Bcells affect virus infection, the binding abilities of these virions were tested.
T63634 25223-25364 Sentence denotes Genome RNA-normalized virions derived from different cells were added to BHK-21 cells, and the virus binding ability was measured by qRT-PCR.
TextSentencer_T154 25223-25364 Sentence denotes Genome RNA-normalized virions derived from different cells were added to BHK-21 cells, and the virus binding ability was measured by qRT-PCR.
T10396 25365-25505 Sentence denotes As shown in Fig. 6E , virions derived from STT3Aand STT3Bcells exhibited a partial defect in their ability to attach to normal BHK-21 cells.
TextSentencer_T155 25365-25505 Sentence denotes As shown in Fig. 6E , virions derived from STT3Aand STT3Bcells exhibited a partial defect in their ability to attach to normal BHK-21 cells.
T88010 25506-25697 Sentence denotes Based on these results, we concluded that knockout of STT3A and STT3B reduced the level of GP incorporated into viral particles and hindered the ability of the virus to bind permissive cells.
TextSentencer_T156 25506-25697 Sentence denotes Based on these results, we concluded that knockout of STT3A and STT3B reduced the level of GP incorporated into viral particles and hindered the ability of the virus to bind permissive cells.
T44302 25698-25766 Sentence denotes MAGT1 and TUSC3 were required for the full glycosylation of LASV GP.
TextSentencer_T157 25698-25766 Sentence denotes MAGT1 and TUSC3 were required for the full glycosylation of LASV GP.
T20691 25767-25856 Sentence denotes The results [resented above revealed that LASV GP was a preferred substrate of STT3B-OST.
TextSentencer_T158 25767-25856 Sentence denotes The results [resented above revealed that LASV GP was a preferred substrate of STT3B-OST.
T17304 25857-25920 Sentence denotes MAGT1 and TUSC3 are specific subunits of the STT3B-OST complex.
TextSentencer_T159 25857-25920 Sentence denotes MAGT1 and TUSC3 are specific subunits of the STT3B-OST complex.
T96117 25921-26088 Sentence denotes Despite their replaceable functions, MAGT1 mRNA was shown to be widely expressed in human tissues, whereas the expression of TUSC3 is relatively more restricted (58) .
TextSentencer_T160 25921-26088 Sentence denotes Despite their replaceable functions, MAGT1 mRNA was shown to be widely expressed in human tissues, whereas the expression of TUSC3 is relatively more restricted (58) .
T21834 26089-26209 Sentence denotes The expression of TUSC3 in several cultured cell lines was reported to be difficult to detect by Western blotting (53) .
TextSentencer_T161 26089-26209 Sentence denotes The expression of TUSC3 in several cultured cell lines was reported to be difficult to detect by Western blotting (53) .
T6418 26210-26321 Sentence denotes MAGT1 was found to weakly interact with LASV GP in our MS data set, while TUSC3 was not identified (Table S1 ).
TextSentencer_T162 26210-26321 Sentence denotes MAGT1 was found to weakly interact with LASV GP in our MS data set, while TUSC3 was not identified (Table S1 ).
T31859 26322-26485 Sentence denotes This result could be explained by previous reports demonstrating that MAGT1 and TUSC3 easily dissociated from the canine OST during the purification process (52) .
TextSentencer_T163 26322-26485 Sentence denotes This result could be explained by previous reports demonstrating that MAGT1 and TUSC3 easily dissociated from the canine OST during the purification process (52) .
T66866 26486-26668 Sentence denotes To confirm that MAGT1 and TUSC3 were host interactors of LASV GP, a pCAGGs plasmid encoding 6ϫHis-tagged MAGT1 or Flag-tagged TUSC3 was cotransfected with LASV GP into HEK293T cells.
TextSentencer_T164 26486-26668 Sentence denotes To confirm that MAGT1 and TUSC3 were host interactors of LASV GP, a pCAGGs plasmid encoding 6ϫHis-tagged MAGT1 or Flag-tagged TUSC3 was cotransfected with LASV GP into HEK293T cells.
T36098 26669-26899 Sentence denotes Coimmunoprecipitation and Western blot analyses revealed that viral GP but not GFP was able to pull down exogenously expressed MAGT1 and TUSC3, indicating that these proteins were also host interactors of LASV GP (Fig. 3G and H) .
TextSentencer_T165 26669-26899 Sentence denotes Coimmunoprecipitation and Western blot analyses revealed that viral GP but not GFP was able to pull down exogenously expressed MAGT1 and TUSC3, indicating that these proteins were also host interactors of LASV GP (Fig. 3G and H) .
T6615 26900-26976 Sentence denotes We then sought to explore the roles of MAGT1 and TUSC3 in virus propagation.
TextSentencer_T166 26900-26976 Sentence denotes We then sought to explore the roles of MAGT1 and TUSC3 in virus propagation.
T37732 26977-27170 Sentence denotes CRISPR-Cas9-mediated knockout of MAGT1 and TUSC3 cell lines were constructed (MAGT1and TUSC3cells) as described above and confirmed by sequencing (Fig. 7A) and Western blot analysis (Fig. 7C) .
TextSentencer_T167 26977-27170 Sentence denotes CRISPR-Cas9-mediated knockout of MAGT1 and TUSC3 cell lines were constructed (MAGT1and TUSC3cells) as described above and confirmed by sequencing (Fig. 7A) and Western blot analysis (Fig. 7C) .
T36870 27171-27318 Sentence denotes The expression levels of both MAGT1 and TUSC3 were also decreased in STT3Bcells, indicating that their expression relies on the existence of STT3B.
TextSentencer_T168 27171-27318 Sentence denotes The expression levels of both MAGT1 and TUSC3 were also decreased in STT3Bcells, indicating that their expression relies on the existence of STT3B.
T51758 27319-27506 Sentence denotes Although virus titers were partly reduced in MAGT1and TUSC3cells compared to that in WT cells (Fig. 7C, right) , glycosylation of LASV GP was not significantly altered in these two cells.
TextSentencer_T169 27319-27506 Sentence denotes Although virus titers were partly reduced in MAGT1and TUSC3cells compared to that in WT cells (Fig. 7C, right) , glycosylation of LASV GP was not significantly altered in these two cells.
T63325 27507-27622 Sentence denotes The inefficiency of functional knockout might be explained by the functional compensation between the two proteins.
TextSentencer_T170 27507-27622 Sentence denotes The inefficiency of functional knockout might be explained by the functional compensation between the two proteins.
T3880 27623-27813 Sentence denotes The level of TUSC3 in WT cells was almost undetectable by Western blotting, while a deficiency of MAGT1 was accompanied by obviously increased expression of TUSC3 (Fig. 7C, lanes 1 and 5) .
TextSentencer_T171 27623-27813 Sentence denotes The level of TUSC3 in WT cells was almost undetectable by Western blotting, while a deficiency of MAGT1 was accompanied by obviously increased expression of TUSC3 (Fig. 7C, lanes 1 and 5) .
T35472 27814-27892 Sentence denotes To confirm this finding, the MAGT1 -TUSC3cell line was constructed (Fig. 7B) .
TextSentencer_T172 27814-27892 Sentence denotes To confirm this finding, the MAGT1 -TUSC3cell line was constructed (Fig. 7B) .
T6890 27893-28219 Sentence denotes Both MAGT1 -TUSC3cells and STT3Bcells were then infected with the rLCMV/LASV GPC virus, and we observed the same hypoglycosylation pattern of viral GP in the two cells compared to the glycosylation pattern in WT cells (Fig. 7C) , indicating that MAGT1 Journal of Virology or TUSC3 was required for full viral GP glycosylation.
TextSentencer_T173 27893-28219 Sentence denotes Both MAGT1 -TUSC3cells and STT3Bcells were then infected with the rLCMV/LASV GPC virus, and we observed the same hypoglycosylation pattern of viral GP in the two cells compared to the glycosylation pattern in WT cells (Fig. 7C) , indicating that MAGT1 Journal of Virology or TUSC3 was required for full viral GP glycosylation.
T3224 28220-28347 Sentence denotes The virus titer derived from MAGT1 -TUSC3cells was also dramatically reduced compared to that derived from WT cells (Fig. 7C) .
TextSentencer_T174 28220-28347 Sentence denotes The virus titer derived from MAGT1 -TUSC3cells was also dramatically reduced compared to that derived from WT cells (Fig. 7C) .
T16300 28348-28468 Sentence denotes Similarly, the viral foci in MAGT1 -TUSC3cells were notably smaller than those in WT cells (Fig. 5D) , as in STT3Bcells.
TextSentencer_T175 28348-28468 Sentence denotes Similarly, the viral foci in MAGT1 -TUSC3cells were notably smaller than those in WT cells (Fig. 5D) , as in STT3Bcells.
T4451 28469-28555 Sentence denotes Full glycosylation of LASV GP requires the CXXC active-site motifs of MAGT1 and TUSC3.
TextSentencer_T176 28469-28555 Sentence denotes Full glycosylation of LASV GP requires the CXXC active-site motifs of MAGT1 and TUSC3.
T22110 28556-28701 Sentence denotes MAGT1 and TUSC3 are thioredoxin homologs, and a luminally oriented CXXC active-site motif is responsible for their oxidoreductase activity (59) .
TextSentencer_T177 28556-28701 Sentence denotes MAGT1 and TUSC3 are thioredoxin homologs, and a luminally oriented CXXC active-site motif is responsible for their oxidoreductase activity (59) .
T73800 28702-28841 Sentence denotes A protein tertiary structure stabilized by disulfide bonds is a negative regulatory factor for their posttranslational glycosylation (60) .
TextSentencer_T178 28702-28841 Sentence denotes A protein tertiary structure stabilized by disulfide bonds is a negative regulatory factor for their posttranslational glycosylation (60) .
T11577 28842-29050 Sentence denotes MAGT1 and TUSC3 delay the folding of nascent polypeptides by forming mixed disulfide bonds with cysteine-proximal glycosylation sequons via their CXXC site motifs and thereby facilitate access to STT3B (41) .
TextSentencer_T179 28842-29050 Sentence denotes MAGT1 and TUSC3 delay the folding of nascent polypeptides by forming mixed disulfide bonds with cysteine-proximal glycosylation sequons via their CXXC site motifs and thereby facilitate access to STT3B (41) .
T1789 29051-29189 Sentence denotes Mutation of the active site cysteines of MAGT1 or TUSC3 resulted in the hypoglycosylation of a subset of STT3B-dependent substrates (41) .
TextSentencer_T180 29051-29189 Sentence denotes Mutation of the active site cysteines of MAGT1 or TUSC3 resulted in the hypoglycosylation of a subset of STT3B-dependent substrates (41) .
T49869 29190-29452 Sentence denotes To test whether the glycosylation of LASV GP requires the oxidoreductase activity of MAGT1 and TUSC3, plasmids encoding MAGT1/TUSC3 or MAGT1/TUSC3 with SXXC, CXXS, or SXXS mutations were transfected into MAGT1 -TUSC3cells to restore the glycosylation of LASV GP.
TextSentencer_T181 29190-29452 Sentence denotes To test whether the glycosylation of LASV GP requires the oxidoreductase activity of MAGT1 and TUSC3, plasmids encoding MAGT1/TUSC3 or MAGT1/TUSC3 with SXXC, CXXS, or SXXS mutations were transfected into MAGT1 -TUSC3cells to restore the glycosylation of LASV GP.
T82664 29453-29739 Sentence denotes As shown in Fig. 8 , the expression of WT MAGT1 or WT TUSC3 was able to restore the glycosylation of LASV GPC (lanes 1, 5, and 6), whereas MAGT1 and TUSC3 with mutations of any cysteine in their CXXC site motifs failed to restore glycosylation and virus replication (lanes 2, 3, and 4).
TextSentencer_T182 29453-29739 Sentence denotes As shown in Fig. 8 , the expression of WT MAGT1 or WT TUSC3 was able to restore the glycosylation of LASV GPC (lanes 1, 5, and 6), whereas MAGT1 and TUSC3 with mutations of any cysteine in their CXXC site motifs failed to restore glycosylation and virus replication (lanes 2, 3, and 4).
T72389 29740-29876 Sentence denotes Our results revealed that the oxidoreductase CXXC active-site motifs of MAGT1 and TUSC3 play roles in the full glycosylation of LASV GP.
TextSentencer_T183 29740-29876 Sentence denotes Our results revealed that the oxidoreductase CXXC active-site motifs of MAGT1 and TUSC3 play roles in the full glycosylation of LASV GP.
T9971 29877-29961 Sentence denotes A small-molecule OST inhibitor impaired the propagation of the rLCMV/LASV GPC virus.
TextSentencer_T184 29877-29961 Sentence denotes A small-molecule OST inhibitor impaired the propagation of the rLCMV/LASV GPC virus.
T78589 29962-30102 Sentence denotes NGI-1, a small-molecule OST inhibitor, was reported to directly target and block the function of the OST catalytic subunits STT3A and STT3B.
TextSentencer_T185 29962-30102 Sentence denotes NGI-1, a small-molecule OST inhibitor, was reported to directly target and block the function of the OST catalytic subunits STT3A and STT3B.
T66552 30103-30342 Sentence denotes Unlike tunicamycin, NGI-1 does not completely inhibit all the N-glycosylation sites, and this probably determines the reduced cellular toxicity of NGI-1, making it an excellent approach to modulate N-glycosylation in mammalian cells (61) .
TextSentencer_T186 30103-30342 Sentence denotes Unlike tunicamycin, NGI-1 does not completely inhibit all the N-glycosylation sites, and this probably determines the reduced cellular toxicity of NGI-1, making it an excellent approach to modulate N-glycosylation in mammalian cells (61) .
T59372 30343-30568 Sentence denotes To test the inhibitory effect of NGI-1 on the N-glycosylation of LASV GP, STT3A -, STT3B -, MAGT1 -TUSC3 -, and WT cells were infected with the rLCMV/LASV GPC virus and then treated with NGI-1 at the indicated concentrations.
TextSentencer_T187 30343-30568 Sentence denotes To test the inhibitory effect of NGI-1 on the N-glycosylation of LASV GP, STT3A -, STT3B -, MAGT1 -TUSC3 -, and WT cells were infected with the rLCMV/LASV GPC virus and then treated with NGI-1 at the indicated concentrations.
T69538 30569-30665 Sentence denotes None of the concentrations showed cellular toxicity during the incubation time (data not shown).
TextSentencer_T188 30569-30665 Sentence denotes None of the concentrations showed cellular toxicity during the incubation time (data not shown).
T38257 30666-30736 Sentence denotes Cells were harvested at 36 hpi and subjected to Western blot analysis.
TextSentencer_T189 30666-30736 Sentence denotes Cells were harvested at 36 hpi and subjected to Western blot analysis.
T97832 30737-30962 Sentence denotes As shown in Fig. 9A , NGI-1 was able to inhibit the glycosylation of LASV GP mediated by STT3A-OST (in STT3Band MAGT1 -TUSC3cells) or STT3B-OST (in STT3Acells) and impaired its proteolytic cleavage in a dose-dependent manner.
TextSentencer_T190 30737-30962 Sentence denotes As shown in Fig. 9A , NGI-1 was able to inhibit the glycosylation of LASV GP mediated by STT3A-OST (in STT3Band MAGT1 -TUSC3cells) or STT3B-OST (in STT3Acells) and impaired its proteolytic cleavage in a dose-dependent manner.
T75946 30963-31110 Sentence denotes At the same NGI-1 concentrations, hypoglycosylation of LASV GP was most severe in STT3Band MAGT1 -TUSC3cells compared to that in STT3Aand WT cells.
TextSentencer_T191 30963-31110 Sentence denotes At the same NGI-1 concentrations, hypoglycosylation of LASV GP was most severe in STT3Band MAGT1 -TUSC3cells compared to that in STT3Aand WT cells.
T132 31111-31301 Sentence denotes To further evaluate the effect of NGI-1 on virus propagation, supernatant viral titers and viral RNA copy numbers were determined by the immunological plaque assay and qRT-PCR, respectively.
TextSentencer_T192 31111-31301 Sentence denotes To further evaluate the effect of NGI-1 on virus propagation, supernatant viral titers and viral RNA copy numbers were determined by the immunological plaque assay and qRT-PCR, respectively.
T67132 31302-31542 Sentence denotes As shown in Fig. 9B , NGI-1 treatment significantly reduced the viral titers, while the viral RNA copy numbers were only mildly reduced, indicating that NGI-1 mainly impaired virus infectivity but not the number of released progeny viruses.
TextSentencer_T193 31302-31542 Sentence denotes As shown in Fig. 9B , NGI-1 treatment significantly reduced the viral titers, while the viral RNA copy numbers were only mildly reduced, indicating that NGI-1 mainly impaired virus infectivity but not the number of released progeny viruses.
T86638 31543-31843 Sentence denotes The effect of NGI-1 on LASV GP and virus propagation was also tested in several other human cell lines, including A549, HeLa, Huh7, and HEK293 cells, and both hypoglycosylation of LASV GP and reduced viral titer were observed ( Fig. 9C and D) , which is consistent with the findings in HEK293T cells.
TextSentencer_T194 31543-31843 Sentence denotes The effect of NGI-1 on LASV GP and virus propagation was also tested in several other human cell lines, including A549, HeLa, Huh7, and HEK293 cells, and both hypoglycosylation of LASV GP and reduced viral titer were observed ( Fig. 9C and D) , which is consistent with the findings in HEK293T cells.
T54422 31844-31948 Sentence denotes The preferential requirement for STT3B-dependent N-glycosylation of GP was conserved among arenaviruses.
TextSentencer_T195 31844-31948 Sentence denotes The preferential requirement for STT3B-dependent N-glycosylation of GP was conserved among arenaviruses.
T47653 31949-31992 Sentence denotes Arenavirus GPs are all highly glycosylated.
TextSentencer_T196 31949-31992 Sentence denotes Arenavirus GPs are all highly glycosylated.
T17156 31993-32130 Sentence denotes We next sought to explore whether the preferential requirement for STT3B-dependent N-glycosylation is conserved among other arenaviruses.
TextSentencer_T197 31993-32130 Sentence denotes We next sought to explore whether the preferential requirement for STT3B-dependent N-glycosylation is conserved among other arenaviruses.
T99638 32131-32252 Sentence denotes Plasmids encoding GPs of OW arenaviruses, including LCMV, Mopeia virus (MOPV), Lujo virus (LUJV), and Dandenong detected.
TextSentencer_T198 32131-32252 Sentence denotes Plasmids encoding GPs of OW arenaviruses, including LCMV, Mopeia virus (MOPV), Lujo virus (LUJV), and Dandenong detected.
T12246 32253-32307 Sentence denotes GAPDH was detected as a loading control for each lane.
TextSentencer_T199 32253-32307 Sentence denotes GAPDH was detected as a loading control for each lane.
T81718 32308-32378 Sentence denotes Hypoglycosylation of viral glycoprotein is indicated by red triangles.
TextSentencer_T200 32308-32378 Sentence denotes Hypoglycosylation of viral glycoprotein is indicated by red triangles.
T39644 32379-32488 Sentence denotes Supernatant viral titers derived from different cell lines were determined by the immunological plaque assay.
TextSentencer_T201 32379-32488 Sentence denotes Supernatant viral titers derived from different cell lines were determined by the immunological plaque assay.
T8461 32489-32780 Sentence denotes The data presented here represent the means Ϯ the SD of three independent experiments, and each independent experiment had two replicates. virus (DNAV) (Fig. 10A ) and NW arenaviruses, including JUNV and MACV (Fig. 10B) , were transfected into STT3A -, STT3B -, MAGT1 -TUSC3 -, and WT cells.
TextSentencer_T202 32489-32780 Sentence denotes The data presented here represent the means Ϯ the SD of three independent experiments, and each independent experiment had two replicates. virus (DNAV) (Fig. 10A ) and NW arenaviruses, including JUNV and MACV (Fig. 10B) , were transfected into STT3A -, STT3B -, MAGT1 -TUSC3 -, and WT cells.
T76377 32781-32860 Sentence denotes The glycosylation patterns of viral GPs were then analyzed by Western blotting.
TextSentencer_T203 32781-32860 Sentence denotes The glycosylation patterns of viral GPs were then analyzed by Western blotting.
T61413 32861-33056 Sentence denotes We observed hypoglycosylation patterns for all the arenavirus GPs tested in STT3Band MAGT1 -TUSC3cells, indicating the conserved requirement of STT3B and MAGT1/TUSC3 for arenavirus glycosylation.
TextSentencer_T204 32861-33056 Sentence denotes We observed hypoglycosylation patterns for all the arenavirus GPs tested in STT3Band MAGT1 -TUSC3cells, indicating the conserved requirement of STT3B and MAGT1/TUSC3 for arenavirus glycosylation.
T58765 33057-33233 Sentence denotes We also tested the effect of knockout of STT3A or STT3B on the glycoproteins of vesicular stomatitis virus (VSV), influenza A virus, and human immunodeficiency virus 1 (HIV-1).
TextSentencer_T205 33057-33233 Sentence denotes We also tested the effect of knockout of STT3A or STT3B on the glycoproteins of vesicular stomatitis virus (VSV), influenza A virus, and human immunodeficiency virus 1 (HIV-1).
T80973 33234-33397 Sentence denotes As shown in Fig. 10C , influenza HA was only affected by knockout of STT3B, whereas HIV-1 envelope glycoprotein (GP160) was affected by knockout of STT3A or STT3B.
TextSentencer_T206 33234-33397 Sentence denotes As shown in Fig. 10C , influenza HA was only affected by knockout of STT3B, whereas HIV-1 envelope glycoprotein (GP160) was affected by knockout of STT3A or STT3B.
T75463 33398-33483 Sentence denotes No significant changes of molecular weight were observed in VSV glycoprotein (VSV-G).
TextSentencer_T207 33398-33483 Sentence denotes No significant changes of molecular weight were observed in VSV glycoprotein (VSV-G).
T32402 33484-33746 Sentence denotes To test whether STT3A and STT3B can affect the infectivity of other arenaviruses, two other viruses, LCMV and rLCMV/MACV GPC, were chosen as representatives of OW and NW arenaviruses to explore their propagation in STT3A -, STT3B -, MAGT1 -TUSC3 -, and WT cells.
TextSentencer_T208 33484-33746 Sentence denotes To test whether STT3A and STT3B can affect the infectivity of other arenaviruses, two other viruses, LCMV and rLCMV/MACV GPC, were chosen as representatives of OW and NW arenaviruses to explore their propagation in STT3A -, STT3B -, MAGT1 -TUSC3 -, and WT cells.
T15445 33747-33804 Sentence denotes Cells were infected with viruses and harvested at 36 hpi.
TextSentencer_T209 33747-33804 Sentence denotes Cells were infected with viruses and harvested at 36 hpi.
T89834 33805-33933 Sentence denotes Supernatant viral titers and viral RNA copy numbers were determined by the immunological plaque assay and qRT-PCR, respectively.
TextSentencer_T210 33805-33933 Sentence denotes Supernatant viral titers and viral RNA copy numbers were determined by the immunological plaque assay and qRT-PCR, respectively.
T43135 33934-34138 Sentence denotes As shown in Fig. 10D , both the titers and the RNA copy numbers of the LCMV and rLCMV/MACV GPC viruses were reduced in the three OST-knockout cells, demonstrating the impaired propagation of both viruses.
TextSentencer_T211 33934-34138 Sentence denotes As shown in Fig. 10D , both the titers and the RNA copy numbers of the LCMV and rLCMV/MACV GPC viruses were reduced in the three OST-knockout cells, demonstrating the impaired propagation of both viruses.
T3700 34139-34360 Sentence denotes Even so, the viral RNA copy numbers were reduced less than the viral titers, especially for the rLCMV/MACV GPC virus, indicating that virus infectivity was affected, which is in line with that of the rLCMV/LASV GPC virus.
TextSentencer_T212 34139-34360 Sentence denotes Even so, the viral RNA copy numbers were reduced less than the viral titers, especially for the rLCMV/MACV GPC virus, indicating that virus infectivity was affected, which is in line with that of the rLCMV/LASV GPC virus.
T24664 34361-34486 Sentence denotes NGI-1 was also able to severely reduce the viral titers, whereas viral RNA copy numbers were only mildly reduced (Fig. 10E) .
TextSentencer_T213 34361-34486 Sentence denotes NGI-1 was also able to severely reduce the viral titers, whereas viral RNA copy numbers were only mildly reduced (Fig. 10E) .
T29125 34487-34615 Sentence denotes The viral infectivity was further visualized by the infection of the rLCMV (NP-P2A-GFP) and rLCMV (NP-P2A-GFP)/MACV GPC viruses.
TextSentencer_T214 34487-34615 Sentence denotes The viral infectivity was further visualized by the infection of the rLCMV (NP-P2A-GFP) and rLCMV (NP-P2A-GFP)/MACV GPC viruses.
T53576 34616-34771 Sentence denotes Similarly, the viral foci (36 hpi) in OST-knockout cells were notably smaller than those in WT cells, especially in STT3Band MAGT1 -TUSC3cells (Fig. 10F) .
TextSentencer_T215 34616-34771 Sentence denotes Similarly, the viral foci (36 hpi) in OST-knockout cells were notably smaller than those in WT cells, especially in STT3Band MAGT1 -TUSC3cells (Fig. 10F) .
T13097 34772-34870 Sentence denotes Our results revealed that the dependence on the host OST complex was conserved among arenaviruses.
TextSentencer_T216 34772-34870 Sentence denotes Our results revealed that the dependence on the host OST complex was conserved among arenaviruses.
T87253 34871-34931 Sentence denotes Arenavirus GPs play critical roles in the viral life cycles.
TextSentencer_T217 34871-34931 Sentence denotes Arenavirus GPs play critical roles in the viral life cycles.
T61433 34932-35206 Sentence denotes They facilitate viral entry via binding to the virus receptor at the extracellular membrane or promoting membrane fusion in the endosome and participate in virus budding via interacting with the virus matrix protein Z to be incorporated into the envelope of nascent virions.
TextSentencer_T218 34932-35206 Sentence denotes They facilitate viral entry via binding to the virus receptor at the extracellular membrane or promoting membrane fusion in the endosome and participate in virus budding via interacting with the virus matrix protein Z to be incorporated into the envelope of nascent virions.
T88087 35207-35447 Sentence denotes Arenavirus GP is first translated into the ER lumen as a GPC precursor, which is mediated by SSP, and then undergoes a series of folding and modification processes along the secretory pathway to achieve a mature and functional conformation.
TextSentencer_T219 35207-35447 Sentence denotes Arenavirus GP is first translated into the ER lumen as a GPC precursor, which is mediated by SSP, and then undergoes a series of folding and modification processes along the secretory pathway to achieve a mature and functional conformation.
T44311 35448-35548 Sentence denotes Among these processes, N-glycosylation in the ER lumen is the most dominant modification of LASV GP.
TextSentencer_T220 35448-35548 Sentence denotes Among these processes, N-glycosylation in the ER lumen is the most dominant modification of LASV GP.
T23946 35549-35635 Sentence denotes We systematically identified the host interactors of LASV GP using the AP-MS approach.
TextSentencer_T221 35549-35635 Sentence denotes We systematically identified the host interactors of LASV GP using the AP-MS approach.
T57678 35636-35811 Sentence denotes This methodology enables us to gain detailed insights into the host machinery involved in stages of LASV GP synthesis, processing, and transport through the secretory pathway.
TextSentencer_T222 35636-35811 Sentence denotes This methodology enables us to gain detailed insights into the host machinery involved in stages of LASV GP synthesis, processing, and transport through the secretory pathway.
T84495 35812-35905 Sentence denotes Proteomic analysis identified multiple proteins of the OST complex as interactors of LASV GP.
TextSentencer_T223 35812-35905 Sentence denotes Proteomic analysis identified multiple proteins of the OST complex as interactors of LASV GP.
T7768 35906-36024 Sentence denotes This was consistent with a previous interactome of LCMV GP (Table S1 ), although their roles were not examined (49) .
TextSentencer_T224 35906-36024 Sentence denotes This was consistent with a previous interactome of LCMV GP (Table S1 ), although their roles were not examined (49) .
T36742 36025-36221 Sentence denotes The congruence between the interactomes of LASV and LCMV GPs highlights the reliability of these observations and prompted us to investigate the conserved roles of the OST complex in arenaviruses.
TextSentencer_T225 36025-36221 Sentence denotes The congruence between the interactomes of LASV and LCMV GPs highlights the reliability of these observations and prompted us to investigate the conserved roles of the OST complex in arenaviruses.
T90409 36222-36391 Sentence denotes Although most viral membrane proteins are glycoproteins, the relationship between viruses and the OST complex has not been investigated in detail, except for flavivirus.
TextSentencer_T226 36222-36391 Sentence denotes Although most viral membrane proteins are glycoproteins, the relationship between viruses and the OST complex has not been investigated in detail, except for flavivirus.
T43036 36392-36696 Sentence denotes A global host interactome analysis and a pooled CRISPR genetic screening revealed that the OST complex interacts with dengue virus (DENV) nonstructural proteins (NS1, NS3, and NS4B) (62) and is crucially involved in DENV RNA replication independent of its canonical roles in N-linked glycosylation (63) .
TextSentencer_T227 36392-36696 Sentence denotes A global host interactome analysis and a pooled CRISPR genetic screening revealed that the OST complex interacts with dengue virus (DENV) nonstructural proteins (NS1, NS3, and NS4B) (62) and is crucially involved in DENV RNA replication independent of its canonical roles in N-linked glycosylation (63) .
T47859 36697-36798 Sentence denotes The oxidoreductase activity of STT3B-OST was also reported to be necessary for its propagation (64) .
TextSentencer_T228 36697-36798 Sentence denotes The oxidoreductase activity of STT3B-OST was also reported to be necessary for its propagation (64) .
T15327 36799-36995 Sentence denotes Our further functional study indicated that the OST complex is a host factor on which the arenaviruses depend, suggesting that the OST complex might broadly participate in host-virus interactions.
TextSentencer_T229 36799-36995 Sentence denotes Our further functional study indicated that the OST complex is a host factor on which the arenaviruses depend, suggesting that the OST complex might broadly participate in host-virus interactions.
T71525 36996-37223 Sentence denotes We found that knockout of STT3B caused hypoglycosylation of viral GPC, while knockout of STT3A did not have such an effect (Fig. 6A) , suggesting a preferential requirement for the STT3B isoform in the glycosylation of LASV GP.
TextSentencer_T230 36996-37223 Sentence denotes We found that knockout of STT3B caused hypoglycosylation of viral GPC, while knockout of STT3A did not have such an effect (Fig. 6A) , suggesting a preferential requirement for the STT3B isoform in the glycosylation of LASV GP.
T99454 37224-37500 Sentence denotes This result shows characteristics that differ from those of flavivirus, since DENV NS1 and NS4B were shown to be fully glycosylated in STT3A or STT3B knockout cells (63, 64) , and only simultaneous knockdown of STT3A and STT3B causes a major glycosylation defect of NS1 (62) .
TextSentencer_T231 37224-37500 Sentence denotes This result shows characteristics that differ from those of flavivirus, since DENV NS1 and NS4B were shown to be fully glycosylated in STT3A or STT3B knockout cells (63, 64) , and only simultaneous knockdown of STT3A and STT3B causes a major glycosylation defect of NS1 (62) .
T54165 37501-37721 Sentence denotes Different dependencies of STT3A and STT3B for N-glycosylation were also found in VSV-G, influenza HA, and HIV-1 GP160 proteins, indicating the diverse mechanisms of modification utilized by different viruses (Fig. 10C) .
TextSentencer_T232 37501-37721 Sentence denotes Different dependencies of STT3A and STT3B for N-glycosylation were also found in VSV-G, influenza HA, and HIV-1 GP160 proteins, indicating the diverse mechanisms of modification utilized by different viruses (Fig. 10C) .
T26674 37722-37953 Sentence denotes Nevertheless, both STT3A and STT3B were shown to be directly or indirectly required for the formation of infectious rLCMV/LASV GPC viruses but did not significantly influence the number of progeny viruses released (Fig. 5C and D) .
TextSentencer_T233 37722-37953 Sentence denotes Nevertheless, both STT3A and STT3B were shown to be directly or indirectly required for the formation of infectious rLCMV/LASV GPC viruses but did not significantly influence the number of progeny viruses released (Fig. 5C and D) .
T75936 37954-38129 Sentence denotes Virions released from STT3Aand STT3Bcells showed reduced incorporation of GPs into virion particles and a partly reduced binding ability to normal permissive cells (Fig. 6E) .
TextSentencer_T234 37954-38129 Sentence denotes Virions released from STT3Aand STT3Bcells showed reduced incorporation of GPs into virion particles and a partly reduced binding ability to normal permissive cells (Fig. 6E) .
T45655 38130-38266 Sentence denotes NGI-1, a small-molecule OST inhibitor, was able to strongly inhibit virus propagation (Fig. 9A) by affecting virus infectivity (Fig. 9B)
TextSentencer_T235 38130-38266 Sentence denotes NGI-1, a small-molecule OST inhibitor, was able to strongly inhibit virus propagation (Fig. 9A) by affecting virus infectivity (Fig. 9B)
T38719 38268-38301 Sentence denotes added to cells after virus entry.
TextSentencer_T236 38268-38301 Sentence denotes added to cells after virus entry.
T53727 38302-38330 Sentence denotes DMSO was added as a control.
TextSentencer_T237 38302-38330 Sentence denotes DMSO was added as a control.
T15394 38331-38379 Sentence denotes Cells and supernatants were harvested at 36 hpi.
TextSentencer_T238 38331-38379 Sentence denotes Cells and supernatants were harvested at 36 hpi.
T75770 38380-38489 Sentence denotes The glycosylation patterns of viral glycoprotein were determined by Western blotting with GP2-specific serum.
TextSentencer_T239 38380-38489 Sentence denotes The glycosylation patterns of viral glycoprotein were determined by Western blotting with GP2-specific serum.
T21441 38490-38655 Sentence denotes GAPDH was also detected as a loading control for each lane. (D) Supernatant viral titers were determined by the immunological plaque assay and qRT-PCR, respectively.
TextSentencer_T240 38490-38655 Sentence denotes GAPDH was also detected as a loading control for each lane. (D) Supernatant viral titers were determined by the immunological plaque assay and qRT-PCR, respectively.
T46462 38656-38754 Sentence denotes Viral titers of Ͻ10 PFU/ml were considered undetected and are marked with a red number sign ("#").
TextSentencer_T241 38656-38754 Sentence denotes Viral titers of Ͻ10 PFU/ml were considered undetected and are marked with a red number sign ("#").
T95774 38755-38821 Sentence denotes Journal of Virology without resulting in significant cytotoxicity.
TextSentencer_T242 38755-38821 Sentence denotes Journal of Virology without resulting in significant cytotoxicity.
T49322 38822-39027 Sentence denotes Thus, pharmacological inhibition of the host OST complex by NGI-1 may provide a useful treatment option to efficiently inhibit virus spread and reduce the fatality rate caused by Lassa fever in the future.
TextSentencer_T243 38822-39027 Sentence denotes Thus, pharmacological inhibition of the host OST complex by NGI-1 may provide a useful treatment option to efficiently inhibit virus spread and reduce the fatality rate caused by Lassa fever in the future.
T34386 39028-39170 Sentence denotes The relative importance of the STT3B isoform of OST in LASV infection may be related to the distinct enzymatic mechanisms of the two isoforms.
TextSentencer_T244 39028-39170 Sentence denotes The relative importance of the STT3B isoform of OST in LASV infection may be related to the distinct enzymatic mechanisms of the two isoforms.
T21284 39171-39334 Sentence denotes In mammalian cells, the OST complex is a hetero-oligomeric complex consisting of a catalytically active subunit with several noncatalytic auxiliary subunits (39) .
TextSentencer_T245 39171-39334 Sentence denotes In mammalian cells, the OST complex is a hetero-oligomeric complex consisting of a catalytically active subunit with several noncatalytic auxiliary subunits (39) .
T73773 39335-39545 Sentence denotes The additional components either play a structural role to support the structural stability and enzymatic activity of the OST complex or modulate the N-glycosylation efficiency for certain precursors (65, 66) .
TextSentencer_T246 39335-39545 Sentence denotes The additional components either play a structural role to support the structural stability and enzymatic activity of the OST complex or modulate the N-glycosylation efficiency for certain precursors (65, 66) .
T21898 39546-39702 Sentence denotes STT3A and STT3B arose from the same ancestral STT3 gene during the evolution of multicellular eukaryotes and share a 59% amino acid sequence identity (39) .
TextSentencer_T247 39546-39702 Sentence denotes STT3A and STT3B arose from the same ancestral STT3 gene during the evolution of multicellular eukaryotes and share a 59% amino acid sequence identity (39) .
T85274 39703-39851 Sentence denotes Both STT3A and STT3B are widely expressed in human tissues, and the full glycosylation of polypeptides involves the cooperation of the two isoforms.
TextSentencer_T248 39703-39851 Sentence denotes Both STT3A and STT3B are widely expressed in human tissues, and the full glycosylation of polypeptides involves the cooperation of the two isoforms.
T71779 39852-40109 Sentence denotes The STT3A-OST isoform is primarily responsible for the cotranslational modification of sequons as nascent polypeptide chains enter the lumen of the rough endoplasmic reticulum (RER) through direct interaction with the Sec61 translocon complex (51, 67, 68) .
TextSentencer_T249 39852-40109 Sentence denotes The STT3A-OST isoform is primarily responsible for the cotranslational modification of sequons as nascent polypeptide chains enter the lumen of the rough endoplasmic reticulum (RER) through direct interaction with the Sec61 translocon complex (51, 67, 68) .
T5817 40110-40379 Sentence denotes Most acceptor sites in host glycoproteins are modified by the cotranslational pathway, and depletion of STT3A by siRNA upregulates the level of the luminal ER chaperone BiP and induces the unfolded protein response in response to the hypoglycosylation of host proteins.
TextSentencer_T250 40110-40379 Sentence denotes Most acceptor sites in host glycoproteins are modified by the cotranslational pathway, and depletion of STT3A by siRNA upregulates the level of the luminal ER chaperone BiP and induces the unfolded protein response in response to the hypoglycosylation of host proteins.
T16029 40380-40632 Sentence denotes Unlike STT3A-OST, the STT3B-OST isoform is less competent for the cotranslational modification and efficiently mediates posttranslational modification of glycosylation sites that are skipped by STT3A after nascent polypeptides enter the ER lumen (51) .
TextSentencer_T251 40380-40632 Sentence denotes Unlike STT3A-OST, the STT3B-OST isoform is less competent for the cotranslational modification and efficiently mediates posttranslational modification of glycosylation sites that are skipped by STT3A after nascent polypeptides enter the ER lumen (51) .
T65609 40633-41046 Sentence denotes Here, no significant changes in GP molecular weight were observed in STT3Acells, implying that the glycosylation acceptor sites for STT3A may also be targeted by STT3B, whereas in STT3Bcells, the glycosylation acceptor site/sites for STT3B may not be fully rescued by STT3A; thus, the reduction in GP molecular weight was observed, and the GP maturation process and virion infectivity were impaired significantly.
TextSentencer_T252 40633-41046 Sentence denotes Here, no significant changes in GP molecular weight were observed in STT3Acells, implying that the glycosylation acceptor sites for STT3A may also be targeted by STT3B, whereas in STT3Bcells, the glycosylation acceptor site/sites for STT3B may not be fully rescued by STT3A; thus, the reduction in GP molecular weight was observed, and the GP maturation process and virion infectivity were impaired significantly.
T26219 41047-41229 Sentence denotes These results suggested the existence of glycosylation sites in viral GPC that are prone to being skipped by STT3A-OST and designated to be posttranslationally modified by STT3B-OST.
TextSentencer_T253 41047-41229 Sentence denotes These results suggested the existence of glycosylation sites in viral GPC that are prone to being skipped by STT3A-OST and designated to be posttranslationally modified by STT3B-OST.
T15580 41230-41313 Sentence denotes MAGT1 and TUSC3 are specific subunits of STT3B-OST that have overlapping functions.
TextSentencer_T254 41230-41313 Sentence denotes MAGT1 and TUSC3 are specific subunits of STT3B-OST that have overlapping functions.
T5965 41314-41620 Sentence denotes CRISPR-Cas9-mediated knockout of either MAGTI or TUSC3 did not reduce the glycosylation of LASV GP, whereas knockout of both led to the same hypoglycosylation pattern as that observed in STT3Bcells, indicating that MAGT1 and TUSC3 exhibit compensatory functions for the glycosylation of LASV GP (Fig. 7B) .
TextSentencer_T255 41314-41620 Sentence denotes CRISPR-Cas9-mediated knockout of either MAGTI or TUSC3 did not reduce the glycosylation of LASV GP, whereas knockout of both led to the same hypoglycosylation pattern as that observed in STT3Bcells, indicating that MAGT1 and TUSC3 exhibit compensatory functions for the glycosylation of LASV GP (Fig. 7B) .
T92334 41621-41786 Sentence denotes Site-directed mutagenesis further revealed that the oxidoreductase CXXC active site motif of MAGT1 or TUSC3 was essential for the glycosylation of LASV GP (Fig. 8) .
TextSentencer_T256 41621-41786 Sentence denotes Site-directed mutagenesis further revealed that the oxidoreductase CXXC active site motif of MAGT1 or TUSC3 was essential for the glycosylation of LASV GP (Fig. 8) .
T60842 41787-41881 Sentence denotes This finding provided novel details regarding the virus glycosylation process in the ER lumen.
TextSentencer_T257 41787-41881 Sentence denotes This finding provided novel details regarding the virus glycosylation process in the ER lumen.
T20981 41882-42166 Sentence denotes STT3A and STT3B show relatively differential expression profiles in human tissues; STT3A expression was reported to be very low in the brain, lung, and kidney and high in the placenta, liver, skeletal muscle, and pancreas, whereas STT3B showed more uniform levels of expression (52) .
TextSentencer_T258 41882-42166 Sentence denotes STT3A and STT3B show relatively differential expression profiles in human tissues; STT3A expression was reported to be very low in the brain, lung, and kidney and high in the placenta, liver, skeletal muscle, and pancreas, whereas STT3B showed more uniform levels of expression (52) .
T3585 42167-42517 Sentence denotes Although STT3A and STT3B show tissue-specific expression, this phenomenon likely does not link the preferential requirement for the STT3B-OST isoform with the tissue tropism of virus infection in vivo, since STT3A was also here demonstrated to be a host prerequisite for virus propagation by indirectly influencing the infectivity of progeny viruses.
TextSentencer_T259 42167-42517 Sentence denotes Although STT3A and STT3B show tissue-specific expression, this phenomenon likely does not link the preferential requirement for the STT3B-OST isoform with the tissue tropism of virus infection in vivo, since STT3A was also here demonstrated to be a host prerequisite for virus propagation by indirectly influencing the infectivity of progeny viruses.
T39506 42518-42729 Sentence denotes The OST complex utilizes dolichol-linked oligosaccharides (OS-PP-Dol) as donor substrates for the N-linked glycosylation of asparagine residues in the N-X-T/S consensus sites of newly synthesized proteins (69) .
TextSentencer_T260 42518-42729 Sentence denotes The OST complex utilizes dolichol-linked oligosaccharides (OS-PP-Dol) as donor substrates for the N-linked glycosylation of asparagine residues in the N-X-T/S consensus sites of newly synthesized proteins (69) .
T53976 42730-42972 Sentence denotes The fully assembled OS-PP-Dol is Glc 3 Man 9 GlcNAc 2 -PP-Dol, which is assembled on the cytoplasmic face of the RER by glycosyltransferases that mediate the transfer of single glycosyl residues onto the dolichol phosphate step by step (70) .
TextSentencer_T261 42730-42972 Sentence denotes The fully assembled OS-PP-Dol is Glc 3 Man 9 GlcNAc 2 -PP-Dol, which is assembled on the cytoplasmic face of the RER by glycosyltransferases that mediate the transfer of single glycosyl residues onto the dolichol phosphate step by step (70) .
T52119 42973-43158 Sentence denotes Assembly intermediates of OS-PP-Dol with different lengths (Glc 0 -2 Man 0 -9 GlcNAc 2 -PP-Dol) can also serve as the donor substrate for the OST complex in vivo and in vitro (71, 72) .
TextSentencer_T262 42973-43158 Sentence denotes Assembly intermediates of OS-PP-Dol with different lengths (Glc 0 -2 Man 0 -9 GlcNAc 2 -PP-Dol) can also serve as the donor substrate for the OST complex in vivo and in vitro (71, 72) .
T39685 43159-43474 Sentence denotes It was reported that STT3A and STT3B assembled into different OST complexes with a distinct discrimination ability to select Glc 3 Man 9 GlcNAc 2 -PP-Dol over its assembly intermediate Man 9 GlcNAc 2 -PP-Dol, which lacks the terminal glucose residue as the oligosaccharide donor substrate for N-glycosylation (52) .
TextSentencer_T263 43159-43474 Sentence denotes It was reported that STT3A and STT3B assembled into different OST complexes with a distinct discrimination ability to select Glc 3 Man 9 GlcNAc 2 -PP-Dol over its assembly intermediate Man 9 GlcNAc 2 -PP-Dol, which lacks the terminal glucose residue as the oligosaccharide donor substrate for N-glycosylation (52) .
T4353 43475-43775 Sentence denotes The STT3B-OST complex is substantially more active and shows a reduced ability to discriminate different oligosaccharide structures; in contract, the STT3A-OST complex is extremely selective and preferentially glycosylates nascent proteins with the fully assembled Glc 3 Man 9 GlcNAc 2 -PP-Dol (52) .
TextSentencer_T264 43475-43775 Sentence denotes The STT3B-OST complex is substantially more active and shows a reduced ability to discriminate different oligosaccharide structures; in contract, the STT3A-OST complex is extremely selective and preferentially glycosylates nascent proteins with the fully assembled Glc 3 Man 9 GlcNAc 2 -PP-Dol (52) .
T99921 43776-43934 Sentence denotes It is interesting to associate this distinct substrate-selective characteristic of STT3A and STT3B with the recently reported glycan heterogeneity of LASV GP.
TextSentencer_T265 43776-43934 Sentence denotes It is interesting to associate this distinct substrate-selective characteristic of STT3A and STT3B with the recently reported glycan heterogeneity of LASV GP.
T44261 43935-44252 Sentence denotes Analysis of the LASV glycome composition by hydrophilic interaction chromatography ultraperformance liquid chromatography revealed that the virus possesses an abundance of underprocessed oligomannose-type glycans, which form punctuated clusters to shield the proteinous surface from the humoral immune response (73) .
TextSentencer_T266 43935-44252 Sentence denotes Analysis of the LASV glycome composition by hydrophilic interaction chromatography ultraperformance liquid chromatography revealed that the virus possesses an abundance of underprocessed oligomannose-type glycans, which form punctuated clusters to shield the proteinous surface from the humoral immune response (73) .
T7586 44253-44453 Sentence denotes It remains unknown whether the site-specific heterogeneity of virion surface glycans has any relevance to the preferential utilization of host OST isoforms by viruses during the glycosylation process.
TextSentencer_T267 44253-44453 Sentence denotes It remains unknown whether the site-specific heterogeneity of virion surface glycans has any relevance to the preferential utilization of host OST isoforms by viruses during the glycosylation process.
T27424 44454-44723 Sentence denotes Further studies are needed to deeply elucidate the physiological significance of this host glycosylation strategy utilized by arenaviruses. and HIV-1 GP160 (isolate NL43clone, GenBank AY669735.1) were gifts from Chen JianJun and Peng Ke, respectively, in our institute.
TextSentencer_T268 44454-44723 Sentence denotes Further studies are needed to deeply elucidate the physiological significance of this host glycosylation strategy utilized by arenaviruses. and HIV-1 GP160 (isolate NL43clone, GenBank AY669735.1) were gifts from Chen JianJun and Peng Ke, respectively, in our institute.
T69286 44724-45198 Sentence denotes The cDNA sequences of viral GPs and GFP were cloned into pCAGGs plasmids with a C-terminal Twin-Strep-tag (WSHPQFEKGGGSGGGSGGSAWSHPQFEK). pLX304 plasmids encoding V5-tagged RPN1, RPN2, OSTC, DDOST, and pGRN were obtained from a purchased public genome-scale lentiviral expression library of human ORFs (74) . pcDNA3.1(-) plasmids encoding 6ϫHis-tagged MAGT1, Flag-tagged TUSC3, and Strep-tagged SHBG were constructed manually by PCR and an In-Fusion HD cloning kit (TaKaRa).
TextSentencer_T269 44724-45198 Sentence denotes The cDNA sequences of viral GPs and GFP were cloned into pCAGGs plasmids with a C-terminal Twin-Strep-tag (WSHPQFEKGGGSGGGSGGSAWSHPQFEK). pLX304 plasmids encoding V5-tagged RPN1, RPN2, OSTC, DDOST, and pGRN were obtained from a purchased public genome-scale lentiviral expression library of human ORFs (74) . pcDNA3.1(-) plasmids encoding 6ϫHis-tagged MAGT1, Flag-tagged TUSC3, and Strep-tagged SHBG were constructed manually by PCR and an In-Fusion HD cloning kit (TaKaRa).
T97108 45199-45469 Sentence denotes Cysteine mutations of MAGT1 and TUSC3 were generated by PCR-directed site mutagenesis. sgRNA sequences specific to STT3A, STT3B, MAGT1, and TUSC3 were cloned into pSpCas9(BB)-2A-Puro (PX459) according to a standard target sequence cloning protocol described below (75) .
TextSentencer_T270 45199-45469 Sentence denotes Cysteine mutations of MAGT1 and TUSC3 were generated by PCR-directed site mutagenesis. sgRNA sequences specific to STT3A, STT3B, MAGT1, and TUSC3 were cloned into pSpCas9(BB)-2A-Puro (PX459) according to a standard target sequence cloning protocol described below (75) .
T72095 45470-45528 Sentence denotes All of these plasmids were confirmed by Sanger sequencing.
TextSentencer_T271 45470-45528 Sentence denotes All of these plasmids were confirmed by Sanger sequencing.
T3888 45529-45535 Sentence denotes Virus.
TextSentencer_T272 45529-45535 Sentence denotes Virus.
T14080 45536-45718 Sentence denotes Recombinant LCMV (ARM strain) expressing LASV and MACV GPs (rLCMV/LASV GPC and rLCMV/MACV GPC viruses) were generated by reverse genetic techniques, as previously reported (76, 77) .
TextSentencer_T273 45536-45718 Sentence denotes Recombinant LCMV (ARM strain) expressing LASV and MACV GPs (rLCMV/LASV GPC and rLCMV/MACV GPC viruses) were generated by reverse genetic techniques, as previously reported (76, 77) .
T62832 45719-46046 Sentence denotes Briefly, we constructed plasmids containing full-length antigenomic cDNA of the LCMV (ARM strain) L and S segments (or an S segment in which NP was linked with GFP via a P2A self-cleaving peptide sequence) flanked by a T7 promoter in their 5= termini and a hepatitis delta riboenzyme sequence in their 3= termini, respectively.
TextSentencer_T274 45719-46046 Sentence denotes Briefly, we constructed plasmids containing full-length antigenomic cDNA of the LCMV (ARM strain) L and S segments (or an S segment in which NP was linked with GFP via a P2A self-cleaving peptide sequence) flanked by a T7 promoter in their 5= termini and a hepatitis delta riboenzyme sequence in their 3= termini, respectively.
T79018 46047-46181 Sentence denotes Then, LCMV GP was replaced by LASV GP (Josiah strain) or MACV GP (Carvallo strain) using PCR and an In-Fusion HD cloning kit (TaKaRa).
TextSentencer_T275 46047-46181 Sentence denotes Then, LCMV GP was replaced by LASV GP (Josiah strain) or MACV GP (Carvallo strain) using PCR and an In-Fusion HD cloning kit (TaKaRa).
T97455 46182-46386 Sentence denotes The two plasmids were cotransfected into T7 RNA polymerase stably expressing cells (BSR-T7) to direct the intracellular synthesis of viral L and S RNA antigenomes and the initial translation of NP and LP.
TextSentencer_T276 46182-46386 Sentence denotes The two plasmids were cotransfected into T7 RNA polymerase stably expressing cells (BSR-T7) to direct the intracellular synthesis of viral L and S RNA antigenomes and the initial translation of NP and LP.
T80437 46387-46508 Sentence denotes Four days after transfection, the initially rescued viruses were transferred into BHK-21 cells for further amplification.
TextSentencer_T277 46387-46508 Sentence denotes Four days after transfection, the initially rescued viruses were transferred into BHK-21 cells for further amplification.
T87656 46509-46533 Sentence denotes Antibodies and reagents.
TextSentencer_T278 46509-46533 Sentence denotes Antibodies and reagents.
T82293 46534-46648 Sentence denotes Antisera specific to viral GP1, GP2, and NP were generated by immunizing BALB/c mice with purified viral proteins.
TextSentencer_T279 46534-46648 Sentence denotes Antisera specific to viral GP1, GP2, and NP were generated by immunizing BALB/c mice with purified viral proteins.
T26631 46649-46715 Sentence denotes Coimmunoprecipitation/affinity purification and mass spectrometry.
TextSentencer_T280 46649-46715 Sentence denotes Coimmunoprecipitation/affinity purification and mass spectrometry.
T28615 46716-46980 Sentence denotes For AP-MS, 5.0 ϫ 10 6 cells preseeded in 10-cm dishes were transfected with 10 g of plasmid encoding LASV GP with a C-terminal Twin-Strep-tag or an equal amount of plasmid encoding the single Twin-Strep-tag as a control using the cationic polymer polyethylenimine.
TextSentencer_T281 46716-46980 Sentence denotes For AP-MS, 5.0 ϫ 10 6 cells preseeded in 10-cm dishes were transfected with 10 g of plasmid encoding LASV GP with a C-terminal Twin-Strep-tag or an equal amount of plasmid encoding the single Twin-Strep-tag as a control using the cationic polymer polyethylenimine.
T28673 46981-47137 Sentence denotes For coimmunoprecipitation, plasmids encoding the OST subunits were cotransfected into HEK293T cells with Twin-Strep-tagged LASV GP or GFP as a control bait.
TextSentencer_T282 46981-47137 Sentence denotes For coimmunoprecipitation, plasmids encoding the OST subunits were cotransfected into HEK293T cells with Twin-Strep-tagged LASV GP or GFP as a control bait.
T54730 47138-47248 Sentence denotes At 48 h posttransfection, the cells were collected and washed with prechilled PBS by low-speed centrifugation.
TextSentencer_T283 47138-47248 Sentence denotes At 48 h posttransfection, the cells were collected and washed with prechilled PBS by low-speed centrifugation.
T59398 47249-47488 Sentence denotes The cells were then lysed in 500 l of prechilled lysis buffer (50 mM Tris, 150 mM NaCl, 5% glycerol, 1% NP-40, and complete protease inhibitor cocktail [Roche]; pH 8.0) for 1 h and cleared by centrifugation at 4°C for 20 min at 13,000 ϫ g.
TextSentencer_T284 47249-47488 Sentence denotes The cells were then lysed in 500 l of prechilled lysis buffer (50 mM Tris, 150 mM NaCl, 5% glycerol, 1% NP-40, and complete protease inhibitor cocktail [Roche]; pH 8.0) for 1 h and cleared by centrifugation at 4°C for 20 min at 13,000 ϫ g.
T36972 47489-47567 Sentence denotes The supernatant was incubated with 60 l of MagStrep XT beads overnight at 4°C.
TextSentencer_T285 47489-47567 Sentence denotes The supernatant was incubated with 60 l of MagStrep XT beads overnight at 4°C.
T26969 47568-47691 Sentence denotes Then, the beads were washed with prechilled wash buffer (50 mM Tris [pH 8.0], 150 mM NaCl, and 0.02% Tween 20) three times.
TextSentencer_T286 47568-47691 Sentence denotes Then, the beads were washed with prechilled wash buffer (50 mM Tris [pH 8.0], 150 mM NaCl, and 0.02% Tween 20) three times.
T57655 47692-47822 Sentence denotes For coimmunoprecipitation, purified bead fractions were eluted by buffer BXT, and eluates were subjected to Western blot analysis.
TextSentencer_T287 47692-47822 Sentence denotes For coimmunoprecipitation, purified bead fractions were eluted by buffer BXT, and eluates were subjected to Western blot analysis.
T61567 47823-47912 Sentence denotes For AP-MS, an innovative in-bead digestion strategy was used to obtain the highest yield.
TextSentencer_T288 47823-47912 Sentence denotes For AP-MS, an innovative in-bead digestion strategy was used to obtain the highest yield.
T82215 47913-48160 Sentence denotes Briefly, washed beads were resuspended in 100 l of distilled water and then reduced in 2 mM dithiothreitol (Sigma-Aldrich) at 56°C for 30 min, followed by alkylation in 5 mM iodoacetamide (Sigma-Aldrich) for 30 min at room temperature in the dark.
TextSentencer_T289 47913-48160 Sentence denotes Briefly, washed beads were resuspended in 100 l of distilled water and then reduced in 2 mM dithiothreitol (Sigma-Aldrich) at 56°C for 30 min, followed by alkylation in 5 mM iodoacetamide (Sigma-Aldrich) for 30 min at room temperature in the dark.
T62811 48161-48275 Sentence denotes Then, 0.5 g of sequencing-grade modified trypsin (Promega) was added, and the mix was incubated overnight at 37°C.
TextSentencer_T290 48161-48275 Sentence denotes Then, 0.5 g of sequencing-grade modified trypsin (Promega) was added, and the mix was incubated overnight at 37°C.
T59121 48276-48449 Sentence denotes The resulting peptides were separated from the beads by a magnetic rack and subjected to desalination and concentration by C 18 bonded Solid Phase Extraction Disks (Empore).
TextSentencer_T291 48276-48449 Sentence denotes The resulting peptides were separated from the beads by a magnetic rack and subjected to desalination and concentration by C 18 bonded Solid Phase Extraction Disks (Empore).
T68750 48450-48617 Sentence denotes Purified peptides were then subjected to electrospray ionization, followed by liquid chromatography-mass spectrometry (LC-MS) detection, as described previously (78) .
TextSentencer_T292 48450-48617 Sentence denotes Purified peptides were then subjected to electrospray ionization, followed by liquid chromatography-mass spectrometry (LC-MS) detection, as described previously (78) .
T13126 48618-48833 Sentence denotes The obtained raw MA spectra were subjected to analysis by ProteinPilot version 5.0 for peptide sequence identification against the Swiss-Prot database (downloaded in 2017), which was set to human species restricted.
TextSentencer_T293 48618-48833 Sentence denotes The obtained raw MA spectra were subjected to analysis by ProteinPilot version 5.0 for peptide sequence identification against the Swiss-Prot database (downloaded in 2017), which was set to human species restricted.
T99538 48834-48905 Sentence denotes The threshold value of the false discovery rate (FDR) was set to Ͻ0.05.
TextSentencer_T294 48834-48905 Sentence denotes The threshold value of the false discovery rate (FDR) was set to Ͻ0.05.
T88415 48906-48918 Sentence denotes GO analysis.
TextSentencer_T295 48906-48918 Sentence denotes GO analysis.
T6444 48919-49004 Sentence denotes The ID list of host interactors was submitted to PANTHER (http://www.pantherdb.org/).
TextSentencer_T296 48919-49004 Sentence denotes The ID list of host interactors was submitted to PANTHER (http://www.pantherdb.org/).
T31787 49005-49188 Sentence denotes Statistical overrepresentation tests for cellular component, molecular function, and biological process annotations were performed by using a Fisher exact test with an FDR correction.
TextSentencer_T297 49005-49188 Sentence denotes Statistical overrepresentation tests for cellular component, molecular function, and biological process annotations were performed by using a Fisher exact test with an FDR correction.
T83883 49189-49264 Sentence denotes Total genes in the Home sapiens database were selected as a reference list.
TextSentencer_T298 49189-49264 Sentence denotes Total genes in the Home sapiens database were selected as a reference list.
T31577 49265-49312 Sentence denotes The threshold value of the FDR was set to 0.05.
TextSentencer_T299 49265-49312 Sentence denotes The threshold value of the FDR was set to 0.05.
T88671 49313-49459 Sentence denotes Redundant GO terms were then first eliminated by REVIGO (http://revigo.irb.hr/) based on semantic similarity (47) and further summarized manually.
TextSentencer_T300 49313-49459 Sentence denotes Redundant GO terms were then first eliminated by REVIGO (http://revigo.irb.hr/) based on semantic similarity (47) and further summarized manually.
T6965 49460-49575 Sentence denotes The allowed similarity in REVIGO was set to "Medium (0.7)." A semantic similarity measure of "SimRel" was selected.
TextSentencer_T301 49460-49575 Sentence denotes The allowed similarity in REVIGO was set to "Medium (0.7)." A semantic similarity measure of "SimRel" was selected.
T59250 49576-49705 Sentence denotes A subset of the terms with ranked fold enrichment values and the number of mapped proteins was visualized in a scatterplot graph.
TextSentencer_T302 49576-49705 Sentence denotes A subset of the terms with ranked fold enrichment values and the number of mapped proteins was visualized in a scatterplot graph.
T74386 49706-49843 Sentence denotes The top representative functional subsets with highest fold enrichment values are highlighted in the central region and listed in tables.
TextSentencer_T303 49706-49843 Sentence denotes The top representative functional subsets with highest fold enrichment values are highlighted in the central region and listed in tables.
T52268 49844-49956 Sentence denotes Proteins clustered into functional modules based on highly enriched GO terms were visualized by Cytoscape 3.6.0.
TextSentencer_T304 49844-49956 Sentence denotes Proteins clustered into functional modules based on highly enriched GO terms were visualized by Cytoscape 3.6.0.
T23827 49957-50074 Sentence denotes Note that not all the interactors were exhibited, and one protein may have been classified into more than one subset.
TextSentencer_T305 49957-50074 Sentence denotes Note that not all the interactors were exhibited, and one protein may have been classified into more than one subset.
T90202 50075-50092 Sentence denotes Western blotting.
TextSentencer_T306 50075-50092 Sentence denotes Western blotting.
T11251 50093-50243 Sentence denotes Cells were collected and lysed by radioimmunoprecipitation assay lysis buffer (Beyotime, China) supplemented with protease inhibitor cocktail (Roche).
TextSentencer_T307 50093-50243 Sentence denotes Cells were collected and lysed by radioimmunoprecipitation assay lysis buffer (Beyotime, China) supplemented with protease inhibitor cocktail (Roche).
T23011 50244-50368 Sentence denotes Cell lysates were denatured by adding loading buffer (containing ␤-mercaptoethanol) followed by heating for 10 min at 100°C.
TextSentencer_T308 50244-50368 Sentence denotes Cell lysates were denatured by adding loading buffer (containing ␤-mercaptoethanol) followed by heating for 10 min at 100°C.
T9129 50369-50589 Sentence denotes The proteins were then separated on SDS-10% PAGE gels (Bio-Rad) and transferred onto polyvinylidene difluoride membranes by a Trans-Blot Turbo rapid transfer system (Bio-Rad) according to the manufacturer's instructions.
TextSentencer_T309 50369-50589 Sentence denotes The proteins were then separated on SDS-10% PAGE gels (Bio-Rad) and transferred onto polyvinylidene difluoride membranes by a Trans-Blot Turbo rapid transfer system (Bio-Rad) according to the manufacturer's instructions.
T80582 50590-50800 Sentence denotes The membranes were blocked in 5% defatted milk (dissolved in Tris-buffered saline [TBS]) for 1 h at room temperature and then incubated with a primary antibody for 1.5 h at room temperature or overnight at 4°C.
TextSentencer_T310 50590-50800 Sentence denotes The membranes were blocked in 5% defatted milk (dissolved in Tris-buffered saline [TBS]) for 1 h at room temperature and then incubated with a primary antibody for 1.5 h at room temperature or overnight at 4°C.
T15248 50801-51124 Sentence denotes The membranes were then washed extensively in wash buffer (TBS containing 0.1% Tween 20) three times (for 5 min each time) with agitation and incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody (Proteintech, China) for 1 h at room temperature according to the species source of the primary antibody.
TextSentencer_T311 50801-51124 Sentence denotes The membranes were then washed extensively in wash buffer (TBS containing 0.1% Tween 20) three times (for 5 min each time) with agitation and incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody (Proteintech, China) for 1 h at room temperature according to the species source of the primary antibody.
T92077 51125-51296 Sentence denotes The membranes were washed three times in wash buffer and imaged using an enhanced chemiluminescence substrate solution (Millipore, Germany) to visualize the protein bands.
TextSentencer_T312 51125-51296 Sentence denotes The membranes were washed three times in wash buffer and imaged using an enhanced chemiluminescence substrate solution (Millipore, Germany) to visualize the protein bands.
T86932 51297-51522 Sentence denotes GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was utilized as a loading control by stripping the membranes with stripping buffer (Beyotime, China) and reprobing with an anti-GAPDH antibody according to the same procedures.
TextSentencer_T313 51297-51522 Sentence denotes GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was utilized as a loading control by stripping the membranes with stripping buffer (Beyotime, China) and reprobing with an anti-GAPDH antibody according to the same procedures.
T41720 51523-51781 Sentence denotes Plasmid-based CRISPR-Cas9 engineering of knockout cells. sgRNA sequences targeting exons of the human STT3A, STT3B, MAGT1, or TUSC3 genes were designed by using the GeneArt CRISPR search and design tool (https://apps.thermofisher.com/apps/crispr/index.html).
TextSentencer_T314 51523-51781 Sentence denotes Plasmid-based CRISPR-Cas9 engineering of knockout cells. sgRNA sequences targeting exons of the human STT3A, STT3B, MAGT1, or TUSC3 genes were designed by using the GeneArt CRISPR search and design tool (https://apps.thermofisher.com/apps/crispr/index.html).
T62197 51782-51870 Sentence denotes Predesigned sequences with the fewest predicted off-target cleavage sites were selected.
TextSentencer_T315 51782-51870 Sentence denotes Predesigned sequences with the fewest predicted off-target cleavage sites were selected.
T44260 51871-52095 Sentence denotes For STT3A and STT3B, two target sequences were selected for each gene (STT3A-target-1, TATATCTCCCGATCTGTGGC; STT3A-target-2, ACAGACATTCCGAA TGTCGA; STT3B-target-1, GACGACTTGTGCTTGCTCTC; STT3B-target-2, CGTGGATGATGCTTTCGAAG).
TextSentencer_T316 51871-52095 Sentence denotes For STT3A and STT3B, two target sequences were selected for each gene (STT3A-target-1, TATATCTCCCGATCTGTGGC; STT3A-target-2, ACAGACATTCCGAA TGTCGA; STT3B-target-1, GACGACTTGTGCTTGCTCTC; STT3B-target-2, CGTGGATGATGCTTTCGAAG).
T91834 52096-52227 Sentence denotes For MAGT1 and TUSC3, one target sequence was selected (MAGT1-target-1, ATAACGGAGTAATTTCTCGG; TUSC3-target-1, CGCTCAATCTTCCGAATGAA).
TextSentencer_T317 52096-52227 Sentence denotes For MAGT1 and TUSC3, one target sequence was selected (MAGT1-target-1, ATAACGGAGTAATTTCTCGG; TUSC3-target-1, CGCTCAATCTTCCGAATGAA).
T88254 52228-52390 Sentence denotes A pair of partially cDNA oligonucleotides encoding each sgRNA sequence was synthesized and ligated into a pSpCas9(BB)-2A-Puro plasmid (PX459; Addgene, catalog no.
TextSentencer_T318 52228-52390 Sentence denotes A pair of partially cDNA oligonucleotides encoding each sgRNA sequence was synthesized and ligated into a pSpCas9(BB)-2A-Puro plasmid (PX459; Addgene, catalog no.
T33771 52391-52506 Sentence denotes 62988), which bears both the Cas9 gene, and the sgRNA scaffold backbone containing an oligonucleotide cloning site.
TextSentencer_T319 52391-52506 Sentence denotes 62988), which bears both the Cas9 gene, and the sgRNA scaffold backbone containing an oligonucleotide cloning site.
T44598 52507-52665 Sentence denotes Construction of the plasmids was performed according to a standard target sequence cloning protocol involving an annealing step and a ligation reaction (75) .
TextSentencer_T320 52507-52665 Sentence denotes Construction of the plasmids was performed according to a standard target sequence cloning protocol involving an annealing step and a ligation reaction (75) .
T87154 52666-52856 Sentence denotes Briefly, the DNA oligonucleotide pairs encoding the 20-nucleotide sgRNA were 5= phosphorylated by T4 polynucleotide kinase (NEB) and annealed in a thermocycler with the following parameters:
TextSentencer_T321 52666-52856 Sentence denotes Briefly, the DNA oligonucleotide pairs encoding the 20-nucleotide sgRNA were 5= phosphorylated by T4 polynucleotide kinase (NEB) and annealed in a thermocycler with the following parameters:
T43026 52857-52925 Sentence denotes 37°C for 30 min, 95°C for 5 min, and cooling to 25°C at 5°C min Ϫ1 .
TextSentencer_T322 52857-52925 Sentence denotes 37°C for 30 min, 95°C for 5 min, and cooling to 25°C at 5°C min Ϫ1 .
T69979 52926-53072 Sentence denotes The DNA oligonucleotides were then ligated into the linearized pSpCas9(BB)-2A-Puro vector using Quick ligase (NEB) at room temperature for 10 min.
TextSentencer_T323 52926-53072 Sentence denotes The DNA oligonucleotides were then ligated into the linearized pSpCas9(BB)-2A-Puro vector using Quick ligase (NEB) at room temperature for 10 min.
T56462 53073-53239 Sentence denotes Finally, the ligated plasmids were transformed into a competent E. coli strain, plated on an LB plate containing 100 g/ml ampicillin, and incubated overnight at 37°C.
TextSentencer_T324 53073-53239 Sentence denotes Finally, the ligated plasmids were transformed into a competent E. coli strain, plated on an LB plate containing 100 g/ml ampicillin, and incubated overnight at 37°C.
T45837 53240-53315 Sentence denotes The colonies were checked by Sanger sequencing for correct sgRNA insertion.
TextSentencer_T325 53240-53315 Sentence denotes The colonies were checked by Sanger sequencing for correct sgRNA insertion.
T38521 53316-53487 Sentence denotes Plasmids encoding Cas9 and each sgRNA were isolated and transfected into HEK293T cells using Lipofectamine 2000 transfection reagent (Invitrogen) to direct genome editing.
TextSentencer_T326 53316-53487 Sentence denotes Plasmids encoding Cas9 and each sgRNA were isolated and transfected into HEK293T cells using Lipofectamine 2000 transfection reagent (Invitrogen) to direct genome editing.
T27807 53488-53673 Sentence denotes The trans-fected cells were selected by incubating with 2 g/ml puromycin for 72 h, and then isogenic cell lines were isolated by serial dilutions and allowed to expand for 2 to 3 weeks.
TextSentencer_T327 53488-53673 Sentence denotes The trans-fected cells were selected by incubating with 2 g/ml puromycin for 72 h, and then isogenic cell lines were isolated by serial dilutions and allowed to expand for 2 to 3 weeks.
T87169 53674-53789 Sentence denotes Genomic DNA from the isogenic cell lines was extracted by using a TIANamp genomic DNA kit (DP304; Tiangen Biotech).
TextSentencer_T328 53674-53789 Sentence denotes Genomic DNA from the isogenic cell lines was extracted by using a TIANamp genomic DNA kit (DP304; Tiangen Biotech).
T54823 53790-54046 Sentence denotes PCR amplification of the modified regions was defined by Sanger sequencing using specific genomic cleavage detection primers, and cell lines exhibiting frameshift mutations at the corresponding sites were selected and further confirmed by Western blotting.
TextSentencer_T329 53790-54046 Sentence denotes PCR amplification of the modified regions was defined by Sanger sequencing using specific genomic cleavage detection primers, and cell lines exhibiting frameshift mutations at the corresponding sites were selected and further confirmed by Western blotting.
T47867 54047-54208 Sentence denotes MAGT1 and TUSC3 double-knockout cells (MAGT1 -TUSC3 -) were constructed by transfecting the TUSC3-sgRNA plasmid into MAGT1cells to direct a second editing event.
TextSentencer_T330 54047-54208 Sentence denotes MAGT1 and TUSC3 double-knockout cells (MAGT1 -TUSC3 -) were constructed by transfecting the TUSC3-sgRNA plasmid into MAGT1cells to direct a second editing event.
T851 54209-54310 Sentence denotes Isogenic cell lines bearing the desired editing outcomes were sequenced and selected in the same way.
TextSentencer_T331 54209-54310 Sentence denotes Isogenic cell lines bearing the desired editing outcomes were sequenced and selected in the same way.
T9691 54311-54336 Sentence denotes Virus-cell binding assay.
TextSentencer_T332 54311-54336 Sentence denotes Virus-cell binding assay.
T36998 54337-54449 Sentence denotes BHK-21 cells were preseeded in 12-well plates in advance and incubated overnight to reach 90 to 100% confluence.
TextSentencer_T333 54337-54449 Sentence denotes BHK-21 cells were preseeded in 12-well plates in advance and incubated overnight to reach 90 to 100% confluence.
T27148 54450-54585 Sentence denotes Prechilled cells were infected with RNA-normalized viruses derived from STT3A -, STT3B -, and WT cells and incubated at 4°C for 60 min.
TextSentencer_T334 54450-54585 Sentence denotes Prechilled cells were infected with RNA-normalized viruses derived from STT3A -, STT3B -, and WT cells and incubated at 4°C for 60 min.
T53146 54586-54692 Sentence denotes After incubation, the cells were washed extensively with prechilled PBS to remove unbound viral particles.
TextSentencer_T335 54586-54692 Sentence denotes After incubation, the cells were washed extensively with prechilled PBS to remove unbound viral particles.
T58171 54693-54778 Sentence denotes The cellular total RNA was then extracted and purified using a total RNA kit (Omega).
TextSentencer_T336 54693-54778 Sentence denotes The cellular total RNA was then extracted and purified using a total RNA kit (Omega).
T82751 54779-54876 Sentence denotes Cell-attached viral S genomes were measured by qRT-PCR and normalized to the level of GAPDH mRNA.
TextSentencer_T337 54779-54876 Sentence denotes Cell-attached viral S genomes were measured by qRT-PCR and normalized to the level of GAPDH mRNA.
T38409 54877-54916 Sentence denotes Quantitative reverse transcription-PCR.
TextSentencer_T338 54877-54916 Sentence denotes Quantitative reverse transcription-PCR.
T9692 54917-55057 Sentence denotes RNA was extracted from cells and supernatants with a total RNA kit and a viral RNA kit (Omega) according to the manufacturer's instructions.
TextSentencer_T339 54917-55057 Sentence denotes RNA was extracted from cells and supernatants with a total RNA kit and a viral RNA kit (Omega) according to the manufacturer's instructions.
T76907 55058-55183 Sentence denotes Reverse transcription was performed using the PrimeScript RT reagent kit with gDNA Eraser (TaKaRa, Japan) and random primers.
TextSentencer_T340 55058-55183 Sentence denotes Reverse transcription was performed using the PrimeScript RT reagent kit with gDNA Eraser (TaKaRa, Japan) and random primers.
T7665 55184-55485 Sentence denotes Specifically, S genome (ϩ) cDNA of the rLCMV/LASV GPC virus was synthesized using a genome-specific primer (GTACAAGCGCTCACAGACCT) to distinguish from the S antigenome (-) or viral mRNA. qRT-PCR was performed using TB Green Premix Ex Taq II (TaKaRa, Japan) and the following gene-specific primer pairs:
TextSentencer_T341 55184-55485 Sentence denotes Specifically, S genome (ϩ) cDNA of the rLCMV/LASV GPC virus was synthesized using a genome-specific primer (GTACAAGCGCTCACAGACCT) to distinguish from the S antigenome (-) or viral mRNA. qRT-PCR was performed using TB Green Premix Ex Taq II (TaKaRa, Japan) and the following gene-specific primer pairs:
T81314 55486-55636 Sentence denotes S genome (ϩ) (forward, GTACAAGCGCTCACAGACCT; reverse, GTTACCCCCA TCCAACAGGG) and GAPDH (forward, AGAAGGCTGGGGCTCATTTG; reverse, AGGGGCCATCCACAGTCTTC).
TextSentencer_T342 55486-55636 Sentence denotes S genome (ϩ) (forward, GTACAAGCGCTCACAGACCT; reverse, GTTACCCCCA TCCAACAGGG) and GAPDH (forward, AGAAGGCTGGGGCTCATTTG; reverse, AGGGGCCATCCACAGTCTTC).
T9728 55637-55822 Sentence denotes For supernatant viral RNAs, the absolute quantity of the viral S genome was determined by performing a standard curve experiment using an S genome-encoding plasmid as a standard sample.
TextSentencer_T343 55637-55822 Sentence denotes For supernatant viral RNAs, the absolute quantity of the viral S genome was determined by performing a standard curve experiment using an S genome-encoding plasmid as a standard sample.
T37952 55823-55990 Sentence denotes For cellular RNAs, the relative quantity of the viral S genome was determined by performing a comparative C T (ΔΔC T ) experiment using GAPDH as an endogenous control.
TextSentencer_T344 55823-55990 Sentence denotes For cellular RNAs, the relative quantity of the viral S genome was determined by performing a comparative C T (ΔΔC T ) experiment using GAPDH as an endogenous control.
T1400 55991-56018 Sentence denotes Immunological plaque assay.
TextSentencer_T345 55991-56018 Sentence denotes Immunological plaque assay.
T8285 56019-56113 Sentence denotes BHK-21 cells preseeded in 24-well plates were infected with 10-fold serial dilutions of virus.
TextSentencer_T346 56019-56113 Sentence denotes BHK-21 cells preseeded in 24-well plates were infected with 10-fold serial dilutions of virus.
T18932 56114-56264 Sentence denotes After incubation for 1 h, viral supernatants were discarded, and DMEM containing 1.1% sodium carboxymethylcellulose and 2% FBS was added to the cells.
TextSentencer_T347 56114-56264 Sentence denotes After incubation for 1 h, viral supernatants were discarded, and DMEM containing 1.1% sodium carboxymethylcellulose and 2% FBS was added to the cells.
T330 56265-56489 Sentence denotes At 48 h postinfection, the cells were fixed with 4% paraformaldehyde for 30 min at room temperature, permeabilized, and blocked in 5% defatted milk containing 0.3% Triton X-100 (dissolved in PBS) for 1 h at room temperature.
TextSentencer_T348 56265-56489 Sentence denotes At 48 h postinfection, the cells were fixed with 4% paraformaldehyde for 30 min at room temperature, permeabilized, and blocked in 5% defatted milk containing 0.3% Triton X-100 (dissolved in PBS) for 1 h at room temperature.
T83211 56490-56602 Sentence denotes Next, the cells were incubated with anti-NP serum (1:200 dilution) for 1 h at room temperature or 4°C overnight.
TextSentencer_T349 56490-56602 Sentence denotes Next, the cells were incubated with anti-NP serum (1:200 dilution) for 1 h at room temperature or 4°C overnight.
T99914 56603-56840 Sentence denotes Then, the plates were washed extensively in wash buffer (PBS containing 0.05% Tween 20) three times for 5 min each, followed by incubation with an HRP-conjugated anti-mouse secondary antibody (1:300 dilution) for 1 h at room temperature.
TextSentencer_T350 56603-56840 Sentence denotes Then, the plates were washed extensively in wash buffer (PBS containing 0.05% Tween 20) three times for 5 min each, followed by incubation with an HRP-conjugated anti-mouse secondary antibody (1:300 dilution) for 1 h at room temperature.
T38714 56841-56998 Sentence denotes Finally, the cells were washed three more times, and viral plaques were stained using an enhanced HRP-DAB chromogenic substrate kit (Tiangen Biotech, China).
TextSentencer_T351 56841-56998 Sentence denotes Finally, the cells were washed three more times, and viral plaques were stained using an enhanced HRP-DAB chromogenic substrate kit (Tiangen Biotech, China).
T85819 56999-57055 Sentence denotes Viral titers were determined based on the number of PFU.
TextSentencer_T352 56999-57055 Sentence denotes Viral titers were determined based on the number of PFU.
T90712 57056-57075 Sentence denotes Immunofluorescence.
TextSentencer_T353 57056-57075 Sentence denotes Immunofluorescence.
T43124 57076-57192 Sentence denotes Confocal microscopy was used to visualize the cell surface transport of tagged or untagged LASV GP in HEK293T cells.
TextSentencer_T354 57076-57192 Sentence denotes Confocal microscopy was used to visualize the cell surface transport of tagged or untagged LASV GP in HEK293T cells.
T56523 57193-57441 Sentence denotes HEK293T cells were seeded in 15-mm glass-bottom culture dishes (801002; NEST Biotechnology) and transfected the next day with pCAGGs plasmids encoding Twin-Strep-tagged or untagged LASV GP using Lipofectamine 2000 transfection reagent (Invitrogen).
TextSentencer_T355 57193-57441 Sentence denotes HEK293T cells were seeded in 15-mm glass-bottom culture dishes (801002; NEST Biotechnology) and transfected the next day with pCAGGs plasmids encoding Twin-Strep-tagged or untagged LASV GP using Lipofectamine 2000 transfection reagent (Invitrogen).
T67417 57442-57589 Sentence denotes At 36 h posttransfection, living cells were incubated with a 1:50 dilution of GP2-specific serum in PBS supplemented with 3% FBS at 4°C for 30 min.
TextSentencer_T356 57442-57589 Sentence denotes At 36 h posttransfection, living cells were incubated with a 1:50 dilution of GP2-specific serum in PBS supplemented with 3% FBS at 4°C for 30 min.
T82789 57590-57749 Sentence denotes After three washes in PBS supplemented with 3% FBS, the cells were incubated with a 1:200 dilution of Dylight 488-labeled anti-mouse IgG(HϩL) (KPL, catalog no.
TextSentencer_T357 57590-57749 Sentence denotes After three washes in PBS supplemented with 3% FBS, the cells were incubated with a 1:200 dilution of Dylight 488-labeled anti-mouse IgG(HϩL) (KPL, catalog no.
T77442 57750-57796 Sentence denotes 072-03-18-06) and washed three times with PBS.
TextSentencer_T358 57750-57796 Sentence denotes 072-03-18-06) and washed three times with PBS.
T87244 57797-58042 Sentence denotes After live-cell staining, the cells were fixed in 4% paraformaldehyde, stained with DAPI (4=,6=-diamidino-2-phenylindole) for 10 min, washed three times with PBS, and then subjected to imaging using a Nikon A1 MP multiphoton confocal microscope.
TextSentencer_T359 57797-58042 Sentence denotes After live-cell staining, the cells were fixed in 4% paraformaldehyde, stained with DAPI (4=,6=-diamidino-2-phenylindole) for 10 min, washed three times with PBS, and then subjected to imaging using a Nikon A1 MP multiphoton confocal microscope.
T43184 58043-58091 Sentence denotes Images were captured under a 60ϫ lens objective.
TextSentencer_T360 58043-58091 Sentence denotes Images were captured under a 60ϫ lens objective.
T10210 58092-58131 Sentence denotes Ultracentrifugation of viral particles.
TextSentencer_T361 58092-58131 Sentence denotes Ultracentrifugation of viral particles.
T23653 58132-58292 Sentence denotes Viral supernatants derived from different cells were first cleared by two rounds of centrifugation at 1,000 ϫ g and 10,000 ϫ g for 30 min to remove cell debris.
TextSentencer_T362 58132-58292 Sentence denotes Viral supernatants derived from different cells were first cleared by two rounds of centrifugation at 1,000 ϫ g and 10,000 ϫ g for 30 min to remove cell debris.
T77916 58293-58440 Sentence denotes Cleared supernatants were then ultracentrifuged at 20,000 rpm in a SW32 Ti rotor (Beckman) for 2.5 h at 4°C and layered onto a 20% sucrose cushion.
TextSentencer_T363 58293-58440 Sentence denotes Cleared supernatants were then ultracentrifuged at 20,000 rpm in a SW32 Ti rotor (Beckman) for 2.5 h at 4°C and layered onto a 20% sucrose cushion.
T68327 58441-58560 Sentence denotes The supernatants were discarded, and the pellets were gently resuspended in PBS and subjected to Western blot analysis.
TextSentencer_T364 58441-58560 Sentence denotes The supernatants were discarded, and the pellets were gently resuspended in PBS and subjected to Western blot analysis.
T68508 58561-58654 Sentence denotes Supplemental material for this article may be found at https://doi.org/10.1128/JVI .01443-19.
TextSentencer_T365 58561-58654 Sentence denotes Supplemental material for this article may be found at https://doi.org/10.1128/JVI .01443-19.
T30814 58655-58694 Sentence denotes SUPPLEMENTAL FILE 1, XLSX file, 0.1 MB.
TextSentencer_T366 58655-58694 Sentence denotes SUPPLEMENTAL FILE 1, XLSX file, 0.1 MB.

CORD-PICO

Id Subject Object Predicate Lexical cue
p1_all0 101-142 Intervention denotes Glycoprotein Abstract Lassa virus (LASV)
p1_all1 171-205 Population denotes fatal hemorrhagic fever in humans.
p1_all2 210-235 Intervention denotes glycoprotein (GP) of LASV
p1_all3 605-644 Outcome denotes oligosaccharyltransferase (OST) complex
p2_o6 1002-1030 Physical denotes hypoglycosylation of LASV GP
p2_o7 1259-1287 Physical denotes hypoglycosylation of LASV GP
p1_all4 1259-1319 Outcome denotes hypoglycosylation of LASV GP and affected virus propagation.
p2_i0 1476-1481 Pharmacological denotes NGI-1
p1_all5 1476-1481 Intervention denotes NGI-1
p1_all6 2451-2456 Intervention denotes TUSC3